Search Results

Search found 45328 results on 1814 pages for 'iphone developer program'.

Page 927/1814 | < Previous Page | 923 924 925 926 927 928 929 930 931 932 933 934  | Next Page >

  • How can I flush the output of disp in Octave?

    - by Nathan Fellman
    I have a program in Octave that has a loop - running a function with various parameters, not something that I can turn into matrices. At the beginning of each iteration I print the current parameters using disp. The first times I ran it I had a brazillion warnings, and then I also got these prints. Now that I cleaned them up, I no longer see them. My guess is that they're stuck in a buffer, and I'll see them when the program ends or the buffer fills. Is there any way to force a flush of the print buffer so that I can see my prints?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • Special thanks to everyone that helped me in 2010.

    - by mbcrump
    2010 has been a very good year for me and I wanted to create a list and thank everyone for what they have done for me.  I also wanted to thank everyone for reading and subscribing to my blog. It is hard to believe that people actually want to read what I write. I feel like I owe a huge thanks to everyone listed below. Looking back upon 2010, I feel that I’ve grown as a developer and you are part of that reason. Sometimes we get caught up in day to day work and forget to give thanks to those that helped us along the way. The list below is mine, it includes people and companies. This list is obviously not going to include everyone that has helped, just those that have stood out in my mind. When I think back upon 2010, their names keep popping up in my head. So here goes, in no particular order.  People Dave Campbell – For everything he has done for the Silverlight Community with his Silverlight Cream blog. I can’t think of a better person to get recognition at the Silverlight FireStarter event. I also wanted to thank him for spending several hours of his time helping me track down a bug in my feedburner account. Victor Gaudioso – For his large collection of video tutorials on his blog and the passion and enthusiasm he has for Silverlight. We have talked on the phone and I’ve never met anyone so fired up for Silverlight. Kunal Chowdhury – Kunal has always been available for me to bounce ideas off of. Kunal has also answered a lot of questions that stumped me. His blog and CodeProject article have green a great help to me and the Silverlight Community. Glen Gordon – I was looking frantically for a Windows Phone 7 several months before release and Glen found one for me. This allowed me to start a blog series on the Windows Phone 7 hardware and developing an application from start to finish that Scott Guthrie retweeted.  Jeff Blankenburg – For listening to my complaints in the early stages of Windows Phone 7. Jeff was always very polite and gave me his cell phone number to talk it over. He also walked me through several problems that I was having early on. Pete Brown – For writing Silverlight 4 in Action. This book is definitely a labor of love. I followed Pete on Twitter as he was writing it and he spent a lot of late nights and weekends working on it. I felt a lot smarter after reading it the first time. The second time was even better. John Papa – For all of his work on the Silverlight Firestarter and the Silverlight community in general. He has also helped me on a personal level with several things. Daniel Heisler – For putting up with me the past year while we worked on many .NET projects together in 2010. Alvin Ashcraft – For publishing a daily blog post on the best of .NET links. He has linked to my site many times and I really appreciate what he does for the community. Chris Alcock – For publishing the Morning Brew every weekday. I remember when I first appeared on his site, I started getting hundreds of hits on my site and wondered if I was getting a DOS attack or something. It was great to find out that Chris had linked to one of my articles. Joel Cochran – For spending a week teaching “Blend-O-Rama”. This was my one of my favorite sessions of this year. I learned a lot about Expression Blend from it and the best part was that it was free and during lunchtime. Jeremy Likness – Jeremy is smart – very smart. I have learned a lot from Jeremy over the past year. He is also involved in the Silverlight community in every way possible, from forums to blog post to screencast to open source. It goes on and on. The people that I met at VSLive Orlando 2010. I had a great time chatting with Walt Ritscher, Wallace McClure, Tim Huckabee and David Platt. Also a special thanks to all of my friends on Twitter like @wilhil, @DBVaughan, @DataArtist, @wbm, @DirkStrauss and @rsringeri and many many more. Software Companies / Events / May of gave me FREE stuff. =) Microsoft (3) – I was sent a free coupon code by Microsoft to take the Silverlight 4 Beta Exam. I jumped on the offer and took the exam. It was great being selected to try out the exam before it goes public even though Microsoft eventually published a universal coupon code for everyone. I am still waiting to find out if I passed the exam. My fingers are crossed. Microsoft reaching out to me with some questions regarding the .NET Community. I’ve never had a company contact me with such interest in the community. Having a contest where 75 people could win a $100 gift certificate and a T-Shirt for submitting a Windows Phone 7 app. I submitted my app and won. All of the free launch events this year (Windows Phone 7, Visual Studio 2010, ASP.NET MVC). Wintellect – For providing an awesome day of free technical training called T.E.N. Where else can you get free training from some of the best programmers in the world? I also won a contest from them that included a NETAdvantage Ultimate License from Infragistics. VSLive – I attended the Orlando 2010 Conference and it was the best developer’s conference that I have ever attended. I got to know a lot of people at this conference and hang out with many wonderful speakers. I live tweeted the event and while it may have annoyed some, the organizers of VSLive loved it. I won the contest on Twitter and they invited me back to the 2011 session of my choice. This is a very nice gift and I really appreciate the generosity. BarcodeLib.com – For providing free barcode generating tools for a Non-Profit ASP.NET project that I was working on. Their third party controls really made this a breeze compared to my existing solution. NDepend – It is absolutely the best tool to improve code quality. The product is extremely large and I would recommend heading over to their site to check it out. Silverlight Spy – I was writing a blog post on Silverlight Spy and Koen Zwikstra provided a FREE license to me. If you ever wanted to peek inside of a Silverlight Application then this is the tool for you. He is also working on a version that will support OOB and Windows Phone 7. I would recommend checking out his site. Birmingham .NET Users Group / Silverlight Nights User Group – It takes a lot of time to put together a user group meeting every month yet it always seems to happen. I don’t want to name names for fear of leaving someone out but both of these User Groups are excellent if you live in the Birmingham, Alabama area. Publishing Companies Manning Publishing – For giving me early access to Silverlight 4 in Action by Pete Brown. It was really nice to be able to read this awesome book while Pete was writing it. I was also one of the first people to publish a review of the book. Sams Publishing and DZone – For providing a copy of Silverlight 4 Unleashed by Laurent Bugnion for me to review for their site. The review is coming in January 2011. Special Shoutout to the following 3rd Party Silverlight Controls It has been a great pleasure to work with the following companies on 3rd Party Control Giveaways every month. It always amazes me how every 3rd Party Control company is so eager to help out the community. I’ve never been turned down by any of these companies! These giveaways have sparked a lot of interest in Silverlight and hopefully I can continue giving away a new set every month. If you are a 3rd Party Control company and are interested in participating in these giveaways then please email me at mbcrump29[at]gmail[d0t].com. The companies below have already participated in my giveaways: Infragistics (December 2010) - Win a set of Infragistics Silverlight Controls with Data Visualization!  Mindscape (November 2010) - Mindscape Silverlight Controls + Free Mega Pack Contest Telerik (October 2010) - Win Telerik RadControls for Silverlight! ($799 Value) Again, I just wanted to say Thanks to everyone for helping me grow as a developer.  Subscribe to my feed

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • MIDL2003 Error in VC6 project

    - by graham.reeds
    While bug fixing I tracked a problem to an old vc6 compiled dll that hasn't been touched in nearly 3 years. After checking out the most recent source I am getting the following error when trying to compile. Processing C:\PROGRAM FILES\MICROSOFT SDK\INCLUDE\msxml.idl msxml.idl .\ocidl.idl(1524) : error MIDL2003 : redefinition : IErrorLog .\ocidl.idl(1541) : error MIDL2003 : redefinition : IPropertyBag Google gives lots of suggestions regarding Visual Studio 2002 - 2003 errors but I can't find anything that relates to Visual Studio 6 or can be applied to my problem. I did find this page but following it's advice didn't fix my problem. Does anyone have any suggestions on how to fix this? (I am presuming that it did work once.) Other items of interest: I have the February 2003 Platform SDK installed, and looking at the add/remove program page I have Micrsoft XML Parser and SDK, MSXML 4.0 SP2 and MSXML 6.0 Parser too.

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • VS2010 - Add template to New Project window

    - by gbogumil
    I am trying to add a new project template for an often used pattern. Starting from the class library template I have done the following (it still does not show up in the new project window): opened the .vstemplate file changed name and description to 'hard coded' values (my template). The values in there pulled from the csharpui.dll resources. changed the TemplateID, DefaultName, and ProjectItems included. saved these to the ProjectemplatesCache folder and as a zip in the ProjectTemplates folder. restarted VS2010 and checked the new project location which should have shown my new template. specifically, the folders I saved to were.. C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplatesCache\CSharp\Windows\1033\HostComm.zip (the zip is the folder name, not a zip file) and C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplates\CSharp\Windows\1033 (this folder has a HostComm.zip file in it) Has anyone else done this? Can it be done? If it can then what did I miss?

    Read the article

  • Windows Workflow and sql script in declarative config like InRule

    - by Satish
    We have been using InRule for our Rule needs we have found that it does not scale well and so are investigating the Windows Work Flow. Within InRule we could configure pretty much have any task for example our sql scripts and stored procedures where all part of a separate rule config file, I am wondering if there is a similar functionality within windows work flow where I could just call a declarative task and pass it a bunch of parameters – This task should contain the sql script I would be executing , we should be able to change the script at runtime without recompilation to the WF code. Is this possible in Windows Work flow – How can I accomplish this within work flow. Additionally for sql execution within Work Flow, how does it get the connection string. Should it be passed from the calling program – is passing it as input parameter from the Calling app via the Dictionary object the best way or can the work flow code have visibility to my calling program app.config and get the connection string ?

    Read the article

  • RAR password recovery on GPU using ATI Stream processor

    - by Wajdy Essam
    Hello, I'm newbie in GPU programming , and i work on brute force RAR Password Recovery on ATI Stream Processor using brook+ language, but i see that the kernel written in brook+ language doesn't allow any calling to normal functions (except kernel functions) , my questions is : 1) how to use unrar.dll (to unrar archive files) API in this situation? and is this the only way to program RAR password recovery? 2) what about crack and ElcomSoft software that use GPU , how they work ? 3) what exactly the role for the function work inside GPU (ATI Stream processor or CUDA) in this program? 4) is nVidia/CUDA technology is easier/more flexible than ATI/brook+ language ?

    Read the article

  • interaction between javascript (desktop application) and C#

    - by Roman Dorevich
    Hello. I am writing for my desktop some application for handling some services. I wrote in C# an application that calculates something (lets call it cl.exe) I created a .bat file that starts the cl.exe. I want to call that .bat file from my javascript so I WShell.Run(**.bat). 2 question: The javascript program will not continue till the cl.exe will end ? (It is synchronized ?) The cl.exe returns a value. How can the javascript take it (It is a javascript program that call .bat file that wrapp the execution of the cl.exe) ? Thanks

    Read the article

  • C# SerialPort - Problems mixing ports with different baud rates.

    - by GrandAdmiral
    Greetings, I have two devices that I would like to connect over a serial interface, but they have incompatible connections. To get around this problem, I connected them both to my PC and I'm working on a C# program that will route traffic on COM port X to COM port Y and vice versa. The program connects to two COM ports. In the data received event handler, I read in incoming data and write it to the other COM port. To do this, I have the following code: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); } } } That code worked fine as long as the outgoing COM port operated at a higher baud rate than the incoming COM port. If the incoming COM port was faster than the outgoing COM port, I started missing data. I had to correct the code like this: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); while (outPort.BytesToWrite > 0); //<-- Change to fix problem } } } I don't understand why I need that fix. I'm new to C# (this is my first program), so I'm wondering if there is something I am missing. The SerialPort defaults to a 2048 byte write buffer and my commands are less than ten bytes. The write buffer should have the ability to buffer the data until it can be written to a slower COM port. In summary, I'm receiving data on COM X and writing the data to COM Y. COM X is connected at a faster baud rate than COM Y. Why doesn't the buffering in the write buffer handle this difference? Why does it seem that I need to wait for the write buffer to drain to avoid losing data? Thanks!

    Read the article

< Previous Page | 923 924 925 926 927 928 929 930 931 932 933 934  | Next Page >