Search Results

Search found 38244 results on 1530 pages for 'recursive function'.

Page 934/1530 | < Previous Page | 930 931 932 933 934 935 936 937 938 939 940 941  | Next Page >

  • Multiple click events

    - by Le_Coeur
    I have some popup dialogs on my webpage, in each of this dialogs i have defined some click event with jquery : $(".links_view").click(function(e){ //code }); But the problem is when i activate one this click event, it will be executed in each dialog...

    Read the article

  • MVC + Extjs + IIS6 + Wildcard Mapping = Post Form resulting in 302 object moved

    - by Orkun Balkanci
    Everything seems to work fine until i want to submit the form and update the database. Wildcard mapping works on requests like "/navigation/edit/1", but when i submit the form as: var ajaxPost = function(Url, Params) { Ext.Ajax.request({ url: Url, params: Params, method: 'POST', async: false, scope: this }); }; it says "200 bad response: syntax error" and in firebug there is "Failed to load source for: http://.../Navigation/edit/1". Any help?

    Read the article

  • PHP curly string syntax question

    - by zildjohn01
    I'm running PHP 5.3.0. I've found that the curly string syntax only works when the first character of the expression is $. Is there a way to include other types of expressions (function calls, etc)? Trivial example: <?php $x = '05'; echo "{$x}"; // works as expected echo "{intval($x)}"; // hoped for "5", got "{intval(05)}"

    Read the article

  • Is VisualAssistX's autorenaming reliable?

    - by Stefan Monov
    I'm using the VS addon called VisualAssistX. Using it for C++ only. In particular i'm using the feature "rename this entity projectwide", mainly for class names and function names. My question is: does this use fuzzy heuristics, or does it actually reliably implement C++ semantics so there's no false negatives/false positives? Has it ever renamed something wrong for you?

    Read the article

  • Netbean 6.8: "Test RESTful Web Service" shows nothing

    - by Harry Pham
    I follow this tutorial here to create RESTful web service on Netbean 6.8. However, when I right click on the project node and select Test RESTful Web Service, the browser pop up, and supposedly my project would be listed on the left, and supposedly I would be able to select it, and test against various function that listed on the right. However, I dont see any of that. Any idea why?

    Read the article

  • jQuery Dynamic Button Click Handler

    - by Neb
    I have a code the change the html of a div to make a button. When I make a click handler for the dynamic button, nothing happens $('#signinup').html("<button id=\"login_submit\">Sign In</button>"); And the handler: $('#login_submit').click(function() { alert("Works!"); });

    Read the article

  • Problem with PHP/Java bridge.

    - by Jack
    I am using Tomcat 6. I am running a php script using the JavaBridge. I get the following error when I run my code. Fatal error: Call to undefined function mysqli_connect() in C:\Program Files\apache-tomcat-6.0.26\webapps\JavaBridge\xxxx\xxxxx.php on line 534 Please help.

    Read the article

  • open source twitter?

    - by George2
    Hello everyone, I want to add twitter like function to my site, like t.mysite.com. Any open source, stable and easy to setup/use twitter software? thanks in advance, George

    Read the article

  • How can i put my form value in javascript array

    - by Lucas van den Abbeele
    I want to make a script where i can put my form in the javascript array invoer[] and display the total It constantly stops working and i searched a lot, i really can't find the right way :D This is my javascript code var strijk = ['broek', 'hemd', 'tshirt', 'lakens', 'korte broek', 'babykledij']; var minuten = [5, 10, 5, 6, 3, 3]; function invoerstrijk() { document.write("<form action='' method='get' name='strijkform'>"); for (var a = 0; a < minuten.length; a++) { document.write(strijk[a] + "<input id='" + strijk[a] + "' name ='" + strijk[a] + "' type='text' />" + "<BR>"); } document.write("<button onclick='opgeven()'>opgeven</button>"); document.write("</form>"); } function opgeven() { var invoer = []; for (var a = 0; a < minuten.length; a++) { invoer[a] = document.getElementByI(strijk[a]).value; } var totaal; for (var a = 0; a < minuten.length; a++) { totaal += parseint(invoer[a]) * parseint(minuten[a]); } document.write("<input name=" + strijk[a] + " type='text' value=" + invoer[a] + " readonly />"); if (invoer != []) { document.write("totaal aantal minuten" + totaal); } else { document.write("geen invoer"); } } my html looks likes this <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> </head> <body> <script type="text/javascript" > //my javasccript </script> <button id="B1" onclick="invoerstrijk()" >Nieuwe strijk</button> </body> </html>

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • How do I get the current time in a Windows 7 gadget?

    - by norlando02
    For my first windows gadget I'm trying to make one that displays the current time and date. The code below is what I have, but I can't figure out why the javascript is not running. Any ideas? <html> <head> http-equiv="Content-Type" content="text/html; charset=Unicode" /> <title>Clock</title> <style type="text/css"> body { width: 130px; height: 60px; margin: 1 1 1 2; } body { font-family: Segoe UI, Arial; font-size: 11px; font-weight: bold; white-space: nowrap; } </style> <script type="text/javascript"> var background; var interval; var connection_id; var timeZone; var now; function load() { try { interval = 1000; connection_id = 0; timeZone = System.Time.currentTimeZone; update(); } catch(e){} } function update() { try { now = new Date(Date.parse(System.Time.getLocalTime(timeZone))); curDate.innerHTML = now.format('M jS, Y'); curTime.innerHTML = now.format('h:i:s A'); clearTimeout(connection_id); connection_id = setTimeout("update()", interval); } catch(e) {} </script> </head> <body onload="load()"> <div id="curDate"> </div> <div id="curTime"> </div> </body> </html>

    Read the article

  • How can get autosuggest in cake php

    - by rajesh
    i hav entered my code in controller like below function keyup(){ $this-Note-simple(); if(strlen($searchq)0){ while ($row = mysql_fetch_array($getRecord)) { echo $row['name']; echo $row['department']; } return $row; } } as soon as i entered this one it doesn't display any info .... what correction should require.......

    Read the article

  • a href nested in DIV element in ASP.NET C#

    - by Gal V
    Hello all, My question is quite simple, I created a DIV, with a HyperLink control in it. As following: I created an 'onclick' event in jQuery for the DIV as well: $('#divOne').click(function() { alert('You clicked on the DIV element'); }); My goal is to trigger this event when the DIV area is clicked (working fine), BUT- When the HyperLink is clicked, I need the page to redirect WITHOUT triggering the DIV 'onclick' event (can use JavaScript or jQuery as needed). Thanks all!

    Read the article

  • stop execution of process for miliseconds.

    - by Viral
    hi friends, I m creating a Tic tac toe game, in that after click made by user automatically the cpu will respond. I want the cpu response after 0.50 seconds, the sleep() function takes too many time, i don't want that much time, is there any other way to do so???

    Read the article

  • window.open causing error in IE only.

    - by John Isaacks
    I am calling this from ie8: function verify_ssl() { window.open ("https://seal.godaddy.com/verifySeal?sealID=129275340046e2e09512711f05bc73f617fac022950185486622550", "ssl-window","status=0,toolbar=0,menubar=0,resizable=0,width=540,height=435"); } It says invalid argument, It works fine in FF and Chrome. Any idea what the issue is in IE?

    Read the article

  • Write a few things to a session in cakephp

    - by kwokwai
    Hi all, I am learning Session function in CakePhp, and see some examples like this on cakePHP cookBook web site: For example: write($mysession1, 'testing') I am not sure if a session can only hold up a particular thing in it. Is it possible to write an array to a session like: mysession[0] = 'Testing0'; mysession[1] = 'Testing1'; mysession[2] = 'Testing2';

    Read the article

  • jquery fade element does not show elements styled 'visibility: hidden'

    - by kalpaitch
    I have a bunch of thumbnails which I am loading with a style of visibility: hidden; so that they all maintain their correct layouts. Once the page is fully loaded I have a jquery function that fades them in. This worked when their style was set to display: none; but obviously the layout screwed up then. Any suggestions? Heres the fade line: $('.littleme').fadeIn('slow');

    Read the article

  • WPF RichTextBox support for document links?

    - by Rox Wen
    I'm attempting to render RTF documents using the WPF RichTextBox control. So far, the appearance of the rendered RTF documents is quite true to the originals which were authored using MS Word. The one issue I've found is that the "document anchors" which are hyperlinks to different locations within the document, do not function as hoped. While they look like links, clicking on them does nothing. Can the WPF RichTextBox support this type of link?

    Read the article

  • can i get the font information from Graphics System.Drawing.Graphics in c#

    - by Bahgat Mashaly
    Hello i get the Graphics from Graphics g= System.Drawing.Graphics.FromHwnd(button1.Handle); can i get the font information from this Graphics i was try to get a font by using GetTextFace api function but it return "system" it mean default font in OS and i was try to use SendMessage(button1.Handle, WM_GETFONT, 0, 0); bu it return me 0 also it is mean default font in OS I have known the cause of the problem, it due to FlatStyle property See this link http://blogs.msdn.com/b/michkap/archive/2008/09/26/8965526.aspx thanks

    Read the article

  • color objects in C or C ++ [closed]

    - by jazz
    Possible Duplicate: Colors in C language i copied a game from a book which name is paratrooper i ask this question again i also provide the code of the objects which i create there i want to change the color of these objects but i didn't understand how to do that so can any one plz help me how to do that.Listen guys they are not the standard functions but i use the graphics library for these functions and i can't find the function in the library file of graphics. i hope u understand know.this code will not run properly so plz tell me something about the function which color it i can't put the image other wize i show u the image it will make alot easieer #include "graphics.h" #include "stdio.h" #include "conio.h" #include "process.h" #include "alloc.h" #include "stdlib.h" #include "math.h" #include "dos.h" main() { int gm=CGAHI, gd=CGA, key=0, area; initgraph(&gd, &gm, "C:\\tc\\bgi"); helidraw(246,50,-1); getch(); return 0; } helidraw ( int x, int y, int d ) { int direction, i, j ; if ( d ) direction = -1 ; else direction = 1 ; i = 3 ; j = 8 ; line ( x - j - 8, y - i - 2, x + j + 8, y - i - 2 ) ; line ( x - j + 5, y - i - 1, x + j - 5, y - i - 1 ) ; line ( x - j, y - i, x + j, y - i ) ; for ( ; i > 0 ; i--, j += 2 ) { putpixel ( x - ( direction * j ), y - i, 1 ) ; line ( x + ( direction * j ), y - i, x + ( direction * ( j - 8 ) ), y - i ) ; } i = 0 ; j -= 2 ; line ( x - ( direction * j ), y - i, x - ( direction * ( j + 17 ) ), y - i ) ; line ( x - ( direction * j ), y - i + 1, x - ( direction * ( j + 7 ) ), y - i + 1 ) ; putpixel ( x - ( direction * ( j + 19 ) ), y - i - 1, 1 ) ; for ( ; i < 3 ; i++, j -= 2 ) { putpixel ( x - j, y + i, 1 ) ; putpixel ( x + j, y + i, 1 ) ; } line ( x - j, y + i, x + j, y + i ) ; putpixel ( x - j + 3, y + i + 1, 1 ) ; putpixel ( x + j - 3, y + i + 1, 1 ) ; line ( x - j - 10, y + i + 2, x + j + 10, y + i + 2 ) ; putpixel ( x + ( direction * ( j + 12 ) ), y + i + 1, 1 ) ; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 930 931 932 933 934 935 936 937 938 939 940 941  | Next Page >