Search Results

Search found 38244 results on 1530 pages for 'recursive function'.

Page 935/1530 | < Previous Page | 931 932 933 934 935 936 937 938 939 940 941 942  | Next Page >

  • can i get the font information from Graphics System.Drawing.Graphics in c#

    - by Bahgat Mashaly
    Hello i get the Graphics from Graphics g= System.Drawing.Graphics.FromHwnd(button1.Handle); can i get the font information from this Graphics i was try to get a font by using GetTextFace api function but it return "system" it mean default font in OS and i was try to use SendMessage(button1.Handle, WM_GETFONT, 0, 0); bu it return me 0 also it is mean default font in OS I have known the cause of the problem, it due to FlatStyle property See this link http://blogs.msdn.com/b/michkap/archive/2008/09/26/8965526.aspx thanks

    Read the article

  • WPF RichTextBox support for document links?

    - by Rox Wen
    I'm attempting to render RTF documents using the WPF RichTextBox control. So far, the appearance of the rendered RTF documents is quite true to the originals which were authored using MS Word. The one issue I've found is that the "document anchors" which are hyperlinks to different locations within the document, do not function as hoped. While they look like links, clicking on them does nothing. Can the WPF RichTextBox support this type of link?

    Read the article

  • window.open causing error in IE only.

    - by John Isaacks
    I am calling this from ie8: function verify_ssl() { window.open ("https://seal.godaddy.com/verifySeal?sealID=129275340046e2e09512711f05bc73f617fac022950185486622550", "ssl-window","status=0,toolbar=0,menubar=0,resizable=0,width=540,height=435"); } It says invalid argument, It works fine in FF and Chrome. Any idea what the issue is in IE?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Simple wave generator with SDL in c++

    - by Vlad Popescu
    i am having problems understanding how the audio part of the sdl library works now, i know that when you initialize it, you have to specify the frequency and a callback<< function, which i think is then called automatically at the given frequency. can anyone who worked with the sdl library write a simple example that would use sdl_audio to generate a 440 hz square wave (since it is the simplest waveform) at a sampling frequency of 44000 hz? thanks in advance

    Read the article

  • passing an array structure as an array

    - by Matias
    I'm having trouble passing a structure array as a parameter of a function struct Estructure{ int a; int b; }; and a funtion Begining(Estructure &s1[]) { //modifi the estructure s1 }; and the main would be something like this int main() { Estructure m[200]; Begining(m); }; is this valid?

    Read the article

  • PHP Force Apache error

    - by Rolf
    Hi dear stackers :P Thanks to this forum, I learnt PHP header function does not actually send header to Apache server but only to the client. What I wanna do is to generate an error 500, and let Apache displays its corresponding page. Is there a way to force it ? Thanks in advance ! (and allez les bleus !)

    Read the article

  • Just a small problem regarding javscript BOM question

    - by caramel1991
    The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

    Read the article

  • Overloading new, delete in C++

    - by user265260
    i came across this line is stroustrup An operator function must either be a member or take at least one argument of a user-defined type (functions redefining the new and delete operators need not). Dont operator new and operator delete take an user defined type as one of their arguments? what does it mean, am i missing something here

    Read the article

  • How to detect application préference changes.

    - by Raphael Pinto
    I created a Settings.bundle in my app where the user can change some properties like font size. It works. But when I leave my App, and I change my setting, I don't know how I can get notified of the change. For the moment, I create a function call each time a view is loaded that check for app settings. But I wonder if there is an other and proper way to do this.

    Read the article

  • How can I cast authoritatively in asp classic?

    - by Tchalvak
    In asp classic, the cint() function or procedure or whatever it is won't allow me to cast arbitrary strings, like "bob" or "null" or anything like that. Is there anything that will allow me to simply cast integers, numeric strings, and arbitrary strings to actual integers, with some sane default like 0 for strings?

    Read the article

  • PHP problem with die()

    - by ThinkingInBits
    So, I have this code: } else { $photograph_moderation = new PhotographModeration($this->photograph_id); $photograph_moderation->purgePhotograph(); //eventually take to an error page die('image is not big enough to upload'); } the purgePhotograph() function gets called properly when this condition is met, but the script never appears to die. Is there a reason why die wouldn't get called here? purgePhotograph() has no script killing commands either.

    Read the article

  • JQuery $.ajax doesn't return anything, but only in Google Chrome!?

    - by Shawson
    Hi All, I'm hoping someone can help me with this as I'm at a loss. I'm trying to simply load a plain text file into a page at runtime using jquery- everything works fine in IE8 (8.0.7600.16385), Firefox 3.6.3, however in Google Chrome 5.0.375.55 the "data" comes back as nothing- i get an empty alert box. This is the code i'm using; <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Animation Test</title> <script type="text/javascript" language="javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript" language="javascript"> $(document).ready(function () { $.ajax({ url: 'level1.txt', success: function (data) { alert(data); }, async: true, type: 'GET' }); }); </script> </head> <body> <canvas id="canvas" width="640" height="480"> Unsupported Browser </canvas> </body> </html> The file I'm loading in is a plain text file containing this; Central Cavern 100 O.........1.C....C...........1.O O................1.............O O..............................O O..............................O O......................B1..B...O O=============~~~~=~~~~========O O.............................1O O===...........................O O............A..OOO.B..........O O====...<<<<<<<<<<<<<<<<<<<<...O O............................==O O..............................O O..........B........OOO.....===O O....===============...........O O%............................XO O==============================O (Yes- it's the first level from Manic Miner! I'm making a javascript version using the html5 canvas to get my head around using it.) I'm at a total loss- it can't be the code because it runs in the other 2 browsers- is there an issue with jquery and this version of Chrome? Thanks for reading!! Shaw.

    Read the article

  • How to handle a Security Alert Pop Up on IE by VBScript

    - by eightants
    I need to create a VBScript (WSH) to automatically open Internet Explorer and navigate a security web page. However, it always pops up a security alert before displaying that website. Can anyone provide a solution for either disables the pop up function (security certification) in IE or accepts the pop-up by the script? Here is my script: Dim objIE Set objIE = CreateObject("InternetExplorer.Application") objIE.Visible = True objIE.Navigate "https://10.10.10.101:9000/Portal" ???? Set objIE = Nothing Thanks a lot.

    Read the article

  • specific draggable is above a specific droppable

    - by hopes
    Hi everyone, I am a begginer in JQuery and I want to make a simple matching quiz so I used this code to create the qustions div and answers div The Capital of KSA The Capital of UK The Capital of USA Riyadh London Washington I want to know after submit button is clicked if all accepted draggables are now dragged to the suitable droppables I used this code to make the answers divs draggable and to make them accepted for their questions divs $(function() { $("#a3").draggable(); $("#q3").droppable({ accept: '#a3', }); }); your help will be appreciated :)

    Read the article

  • list or container O(1)-ish insertion/deletion performance, with array semantics

    - by Chris Kaminski
    I'm looking for a collection that offers list semantics, but also allows array semantics. Say I have a list with the following items: apple orange carrot pear then my container array would: container[0] == apple container[1] == orangle container[2] == carrot Then say I delete the orange element: container[0] == apple container[1] == carrot I don't particularly care if sort order is maintained, I'd just like the array values to function as accelerators to the list items, and I want to collapse gaps in the array without having to do an explicit resizing.

    Read the article

< Previous Page | 931 932 933 934 935 936 937 938 939 940 941 942  | Next Page >