Search Results

Search found 25284 results on 1012 pages for 'test driven'.

Page 952/1012 | < Previous Page | 948 949 950 951 952 953 954 955 956 957 958 959  | Next Page >

  • How do I create a simple seach box with a submit button to bring back a result set in MVC?

    - by RJ
    I am very new to MVC and just learning the basics. I have been following along in Nerd Dinner and used the demo as a way to create my own app. I have created a page that lists out some food items with calories, fat, protein,etc... (http://rjsfitness.net/CalorieList) This is one of my own personal sites that I set up to test out MVC. I got a lot of it working but I am stuck on the textbox with a search button. My view page has this code for the search: <form action="/CalorieList/Search" method="post" id="searchForm"> <input type="text" name="searchTerm" id="searchTerm" value="" size="10" maxlength ="30" /> <input type ="submit" value="Search" /> </form> My global.asax has this code for the routing: routes.MapRoute( "Search", // Route name "CalorieList/Search/{searchTerm}", // URL with parameters new { controller = "CalorieList", action = "Search", search = "" } // Parameter defaults ); My Controller has this code: public ActionResult Index(int? page) { const int pageSize = 10; //load a list with the calorie list var calorieLists = calorieListRepository.GetAllCalorieLists(); //var paginatedCalorieLists = calorieLists.Skip((page ?? 0) * pageSize).Take(pageSize).ToList(); var paginatedCalorieLists = new PaginatedList<CalorieList>(calorieLists, page ?? 0, pageSize); return View("Index", paginatedCalorieLists); } public ActionResult Search(String searchTerm) { const int pageSize = 100; int? page = 0; var calorieLists = calorieListRepository.GetCalorieListsBySearch(searchTerm); var paginatedCalorieLists = new PaginatedList<CalorieList>(calorieLists, page ?? 0, pageSize); return View("Index", paginatedCalorieLists); } return View("Index", paginatedCalorieLists); } When I enter a value and click the button, the Index method fires instead of the Seach method in the controller and I get the full list again. If I manually type the url (http://rjsfitness.net/CalorieList/Search/choc) I get the right listing. Why isn't my button click using the right routing and giving me the search results?

    Read the article

  • Usage of Document() function in XSLT 1.0

    - by infant programmer
    I am triggering the transformation using a .NET code, unless I add "EnableDocumentFunction" property to the XSL-Setting, the program throws error saying .. "Usage of Document() function is prohibited", Actually the program is not editable and a kind of read-only .. is it possible to edit the XSL code itself so that I can use document() function?? The sample XSL and XMLs are Here: Sample XML : <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" > <xsl:output method="xml" indent="yes"/> <xsl:template match="@* | node()"> <xsl:copy> <xsl:apply-templates select="@* | node()"/> </xsl:copy> </xsl:template> <xsl:variable name="State_Code_Trn"> <State In="California" Out="CA"/> <State In="CA" Out="CA"/> <State In="Texas" Out="TX"/> <State In="TX" Out="TX"/> </xsl:variable> <xsl:template name="testing" match="test_node"> <xsl:variable name="test_val"> <xsl:value-of select="."/> </xsl:variable> <xsl:element name="{name()}"> <xsl:choose> <xsl:when test="document('')/*/xsl:variable[@name='State_Code_Trn'] /State[@In=$test_val]"> <xsl:value-of select="document('')/*/xsl:variable[@name='State_Code_Trn'] /State[@In=$test_val]/@Out"/> </xsl:when> <xsl:otherwise> <xsl:text>Other</xsl:text> </xsl:otherwise> </xsl:choose> </xsl:element> </xsl:template> </xsl:stylesheet> And the sample XML : <?xml version="1.0" encoding="utf-8"?> <root> <test_node>California</test_node> <test_node>CA</test_node> <test_node> CA</test_node> <test_node>Texas</test_node> <test_node>TX</test_node> <test_node>CAA</test_node> <test_node></test_node> </root>

    Read the article

  • Hibernate3: Self-Referencing Objects

    - by monojohnny
    Need some help on understanding how to do this; I'm going to be running recursive 'find' on a file system and I want to keep the information in a single DB table - with a self-referencing hierarchial structure: This is my DB Table structure I want to populate. DirObject Table: id int NOT NULL, name varchar(255) NOT NULL, parentid int NOT NULL); Here is the proposed Java Class I want to map (Fields only shown): public DirObject { int id; String name; DirObject parent; ... For the 'root' directory was going to use parentid=0; real ids will start at 1, and ideally I want hibernate to autogenerate the ids. Can somebody provide a suggested mapping file for this please; as a secondary question I thought about doing the Java Class like this instead: public DirObject { int id; String name; List<DirObject> subdirs; Could I use the same data model for either of these two methods ? (With a different mapping file of course). --- UPDATE: so I tried the mapping file suggested below (thanks!), repeated here for reference: <hibernate-mapping> <class name="my.proj.DirObject" table="category"> ... <set name="subDirs" lazy="true" inverse="true"> <key column="parentId"/> <one-to-many class="my.proj.DirObject"/> </set> <many-to-one name="parent" class="my.proj.DirObject" column="parentId" cascade="all" /> </class> ...and altered my Java class to have BOTH 'parentid' and 'getSubDirs' [returning a 'HashSet']. This appears to work - thanks, but this is the test code I used to drive this - I think I'm not doing something right here, because I thought Hibernate would take care of saving the subordinate objects in the Set without me having to do this explicitly ? DirObject dirobject=new DirObject(); dirobject.setName("/files"); dirobject.setParent(dirobject); DirObject d1, d2; d1=new DirObject(); d1.setName("subdir1"); d1.setParent(dirobject); d2=new DirObject(); d2.setName("subdir2"); d2.setParent(dirobject); HashSet<DirObject> subdirs=new HashSet<DirObject>(); subdirs.add(d1); subdirs.add(d2); dirobject.setSubdirs(subdirs); session.save(dirobject); session.save(d1); session.save(d2);

    Read the article

  • Nested Transaction issues within custom Windows Service

    - by pdwetz
    I have a custom Windows Service I recently upgraded to use TransactionScope for nested transactions. It worked fine locally on my old dev machine (XP sp3) and on a test server (Server 2003). However, it fails on my new Windows 7 machine as well as on 2008 Server. It was targeting 2.0 framework; I tried targeting 3.5 instead, but it still fails. The strange part is really in how it fails; no exception is thrown. The service itself merely times out. I added tracing code, and it fails when opening the connection for Database lookup #2 below. I also enabled tracing for System.Transactions; it literally cuts out partway while writing the block for the failed connection. We ran a SQL trace, but only the first lookup shows up. I put in code traces, and it gets to the trace the line before the second lookup, but nothing after. I've had the same experience hitting two different SQL servers (both are SQL 2005 running on Server 2003). The connection string is utilizing a SQL account (not Windows integration). All connections are against the same database in this case, but given the nature of the code it is being escalated to MSDTC. Here's the basic code structure: TransactionOptions options = new TransactionOptions(); options.IsolationLevel = System.Transactions.IsolationLevel.ReadCommitted; using (TransactionScope scope = new TransactionScope(TransactionScopeOption.RequiresNew, options)) { // Database lookup #1 TransactionOptions options = new TransactionOptions(); options.IsolationLevel = Transaction.Current != null ? Transaction.Current.IsolationLevel : System.Transactions.IsolationLevel.ReadCommitted; using (TransactionScope scope = new TransactionScope(TransactionScopeOption.Required, options)) { // Database lookup #2; fails on connection.Open() // Database save (never reached) scope.Complete();<br/> } scope.Complete();<br/> } My local firewall is disabled. The service normally runs using Network Service, but I also tried my user account (same results). The short of it is that I use the same general technique widely in my web applications and haven't had any issues. I pulled out the code and ran it fine within a local Windows Form application. If anyone has any additional debugging ideas (or, even better, solutions) I'd love to hear them.

    Read the article

  • PHP 'instanceof' failing with class constant

    - by Nathan Loding
    I'm working on a framework that I'm trying to type as strongly as I possibly can. (I'm working within PHP and taking some of the ideas that I like from C# and trying to utilize them within this framework.) I'm creating a Collection class that is a collection of domain entities/objects. It's kinda modeled after the List<T> object in .Net. I've run into an obstacle that is preventing me from typing this class. If I have a UserCollection, it should only allow User objects into it. If I have a PostCollection, it should only allow Post objects. All Collections in this framework need to have certain basic functions, such as add, remove, iterate. I created an interface, but found that I couldn't do the following: interface ICollection { public function add($obj) } class PostCollection implements ICollection { public function add(Post $obj) {} } This broke it's compliance with the interface. But I can't have the interface strongly typed because then all Collections are of the same type. So I attempted the following: interface ICollection { public function add($obj) } abstract class Collection implements ICollection { const type = 'null'; } class PostCollection { const type = 'Post'; public function add($obj) { if(!($obj instanceof self::type)) { throw new UhOhException(); } } } When I attempt to run this code, I get syntax error, unexpected T_STRING, expecting T_VARIABLE or '$' on the instanceof statement. A little research into the issue and it looks like the root of the cause is that $obj instanceof self is valid to test against the class. It appears that PHP doesn't process the entire self::type constant statement in the expression. Adding parentheses around the self::type variable threw an error regarding an unexpected '('. An obvious workaround is to not make the type variable a constant. The expression $obj instanceof $this->type works just fine (if $type is declared as a variable, of course). I'm hoping that there's a way to avoid that, as I'd like to define the value as a constant to avoid any possible change in the variable later. Any thoughts on how I can achieve this, or have I take PHP to it's limit in this regard? Is there a way of "escaping" or encapsulating self::this so that PHP won't die when processing it?

    Read the article

  • Javascript regex returning true.. then false.. then true.. etc

    - by betamax
    I have a strange problem with the validation I am writing on a form. It is a 'Check Username' button next to an input. The input default value is the username for example 'betamax'. When I press 'Check Username' it passes the regex and sends the username to the server. The server behaves as expected and returns '2' to tell the javascript that they are submitting their own username. Then, when I click the button again, the regex fails. Nothing is sent to the server obviously because the regex has failed. If I press the button again, the regex passes and then the username is sent to the server. I literally cannot figure out what would be making it do this! It makes no sense to me! This is my code: $j("#username-search").click(checkUserName); function checkUserName() { var userName = $j("#username").val(); var invalidUserMsg = 'Invalid username (a-zA-Z0-9 _ - and not - or _ at beginning or end of string)'; var filter = /^[^-_]([a-z0-9-_]{4,20})[^-_]$/gi; if (filter.test(userName)) { console.log("Pass") $j.post( "/account/profile/username_check/", { q: userName }, function(data){ if(data == 0) { $j("#username-search-results").html("Error searching for username. Try again?"); } else if(data == 5) { $j("#username-search-results").html(invalidUserMsg); } else if(data == 4) { $j("#username-search-results").html("Username too short or too long."); } else if(data == 2) { $j("#username-search-results").html("This is already your username."); } else if(data == 3) { $j("#username-search-results").html("This username is taken."); } else if(data == 1){ $j("#username-search-results").html("This username is available!"); } }); } else { console.log("fail") $j("#username-search-results").html(invalidUserMsg); } return false; } The HTML: <input name="username" id="username" value="{{ user.username }}" /> <input type="button" value="Is it taken?" id="username-search"> <span id="username-search-results"></span>

    Read the article

  • How do I handle the Maybe result of at in Control.Lens.Indexed without a Monoid instance

    - by Matthias Hörmann
    I recently discovered the lens package on Hackage and have been trying to make use of it now in a small test project that might turn into a MUD/MUSH server one very distant day if I keep working on it. Here is a minimized version of my code illustrating the problem I am facing right now with the at lenses used to access Key/Value containers (Data.Map.Strict in my case) {-# LANGUAGE OverloadedStrings, GeneralizedNewtypeDeriving, TemplateHaskell #-} module World where import Control.Applicative ((<$>),(<*>), pure) import Control.Lens import Data.Map.Strict (Map) import qualified Data.Map.Strict as DM import Data.Maybe import Data.UUID import Data.Text (Text) import qualified Data.Text as T import System.Random (Random, randomIO) newtype RoomId = RoomId UUID deriving (Eq, Ord, Show, Read, Random) newtype PlayerId = PlayerId UUID deriving (Eq, Ord, Show, Read, Random) data Room = Room { _roomId :: RoomId , _roomName :: Text , _roomDescription :: Text , _roomPlayers :: [PlayerId] } deriving (Eq, Ord, Show, Read) makeLenses ''Room data Player = Player { _playerId :: PlayerId , _playerDisplayName :: Text , _playerLocation :: RoomId } deriving (Eq, Ord, Show, Read) makeLenses ''Player data World = World { _worldRooms :: Map RoomId Room , _worldPlayers :: Map PlayerId Player } deriving (Eq, Ord, Show, Read) makeLenses ''World mkWorld :: IO World mkWorld = do r1 <- Room <$> randomIO <*> (pure "The Singularity") <*> (pure "You are standing in the only place in the whole world") <*> (pure []) p1 <- Player <$> randomIO <*> (pure "testplayer1") <*> (pure $ r1^.roomId) let rooms = at (r1^.roomId) ?~ (set roomPlayers [p1^.playerId] r1) $ DM.empty players = at (p1^.playerId) ?~ p1 $ DM.empty in do return $ World rooms players viewPlayerLocation :: World -> PlayerId -> RoomId viewPlayerLocation world playerId= view (worldPlayers.at playerId.traverse.playerLocation) world Since rooms, players and similar objects are referenced all over the code I store them in my World state type as maps of Ids (newtyped UUIDs) to their data objects. To retrieve those with lenses I need to handle the Maybe returned by the at lens (in case the key is not in the map this is Nothing) somehow. In my last line I tried to do this via traverse which does typecheck as long as the final result is an instance of Monoid but this is not generally the case. Right here it is not because playerLocation returns a RoomId which has no Monoid instance. No instance for (Data.Monoid.Monoid RoomId) arising from a use of `traverse' Possible fix: add an instance declaration for (Data.Monoid.Monoid RoomId) In the first argument of `(.)', namely `traverse' In the second argument of `(.)', namely `traverse . playerLocation' In the second argument of `(.)', namely `at playerId . traverse . playerLocation' Since the Monoid is required by traverse only because traverse generalizes to containers of sizes greater than one I was now wondering if there is a better way to handle this that does not require semantically nonsensical Monoid instances on all types possibly contained in one my objects I want to store in the map. Or maybe I misunderstood the issue here completely and I need to use a completely different bit of the rather large lens package?

    Read the article

  • Cannot Call WordPress Plugin Files Under wp-content

    - by Volomike
    I have a client who has many blog customers. Each of these WordPress blogs calls a plugin that provides a product link. The way that link is composed looks like this: {website}/wp-content/plugins/prodx/product?id=432320 This works fine on all blogs except two. On those two, when you try to call the URL, you get a 404. So, I disabled all plugins except prodx and reverted the theme to default (Kubrick), thinking perhaps a plugin intercept with add_action() API was doing this, such as intercepting URLs and redirecting them. However, this did not help. So, I upgraded the WordPress to the latest version. Again, didn't fix. So, I checked permissions, comparing with a blog that worked just fine. Again, didn't fix. So I replaced the .htaccess, using one from a working blog. Again, didn't fix. So I replaced all the files using some from a working blog that was identical to this one, and then restored the wp-config.php file back so that it talked to the right blog database. Again, didn't fix. Again I checked permissions meticulously, comparing to a perfectly working blog. Again, didn't fix. So, I created a test.php that looks like so: <?php print_r($_GET); echo "hello world"; I then copied it into another plugin folder and used my browser to get to it -- again, 404. So I copied it into the root of wp-content/plugins and tried to call it there -- again, 404. So I copied it into wp-content -- again, 404. Last, I copied it into the root of the WordPress blog website, and this time, it worked! Doesn't make sense. I started to think that perhaps something was going on with /etc/httpd/conf/httpd.conf for this customer, but the only thing I saw different in their for this customer was the IP address was different than the customer's blog that worked. Each customer gets their own IP in this environment my client has built. My client sysop is baffled too. What do you think is going on? Is there something wrong in the WP database for this customer? Is there something wrong in httpd.conf?

    Read the article

  • Can mono produce valid xhtml?

    - by z-boss
    I installed Mono and MonoDevelop 2.2 on my Windows PC. Created a default C# ASP.NET Web Application project. Here's the Default.aspx it created: <%@ Page Language="C#" Inherits="test.Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html> <head runat="server"> <title>Default</title> </head> <body> <form id="form1" runat="server"> <asp:Button id="button1" runat="server" Text="Click me!" OnClick="button1Clicked" /> </form> </body> </html> When I run it it feeds this html to the browser: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html> <head><title> Default </title></head> <body> <form name="form1" method="post" action="Default.aspx" id="form1"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKMTQ2OTkzNDMyMWRkjWseIg+2HCgaNiY+XHmVKEq/CFg=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWAgLB5qLABwKs34rGBvJAYc3UJn3AcjSPjq8DVpMxclAk" /> </div> <input type="submit" name="button1" value="Click me!" id="button1" /> </form> </body> </html> XHTML validation fails with 3 errors: 1. Line 3, Column 1: Missing xmlns attribute for element html. The value should be: http://www.w3.org/1999/xhtml 2. Line 8, Column 13: there is no attribute "name" 3. Line 17, Column 71: document type does not allow element "input" here; missing one of "p", "h1", "h2", "h3", "h4", "h5", "h6", "div", "pre", "address", "fieldset", "ins", "del" start-tag Is there some setting I'm missing?

    Read the article

  • Java Swing: JWindow appears behind all other process windows, and will not disappear

    - by Kim Jong Woo
    I am using JWindow to display my splash screen during the application start up. however it will not appear in front of all windows as it should, and it will not disappear as well. import java.awt.BorderLayout; import java.awt.Color; import java.awt.Dimension; import java.awt.Font; import java.awt.Toolkit; import javax.swing.BorderFactory; import javax.swing.ImageIcon; import javax.swing.JLabel; import javax.swing.JPanel; import javax.swing.JWindow; public class MySplash { public static MySplash INSTANCE; private static JWindow jw; public MySplash(){ createSplash(); } private void createSplash() { jw = new JWindow(); JPanel content = (JPanel) jw.getContentPane(); content.setBackground(Color.white); // Set the window's bounds, centering the window int width = 328; int height = 131; Dimension screen = Toolkit.getDefaultToolkit().getScreenSize(); int x = (screen.width - width) / 2; int y = (screen.height - height) / 2; jw.setBounds(x, y, width, height); // Build the splash screen JLabel label = new JLabel(new ImageIcon("splash.jpg")); JLabel copyrt = new JLabel("SplashScreen Test", JLabel.CENTER); copyrt.setFont(new Font("Sans-Serif", Font.BOLD, 12)); content.add(label, BorderLayout.CENTER); content.add(copyrt, BorderLayout.SOUTH); Color oraRed = new Color(156, 20, 20, 255); content.setBorder(BorderFactory.createLineBorder(oraRed, 0)); } public synchronized static MySplash getInstance(){ if(INSTANCE==null){ INSTANCE = new MySplash(); } return INSTANCE; } public void showSplash(){ jw.setAlwaysOnTop(true); jw.toFront(); jw.setVisible(true); return; } public void hideSplash(){ jw.setAlwaysOnTop(false); jw.toBack(); jw.setVisible(false); return; } } So in my main class which extends JFrame, I call my splash screen by SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { MySplash.getInstance().showSplash(); } }); However, the JWindow appears behind the all open instances of windows on my computer. Hiding the JWindow also doesn't work. SwingUtilities.invokeLater(new Runnable(){ @Override public void run() { MySplash.getInstance().hideSplash(); } });

    Read the article

  • Xpath expression to retrieve oldest/earliest node

    - by gkrogers
    I have an XML snippet, so: <STATES> <STATE> <NAME>Alabama</NAME> <ABBREVIATION>AL</ABBREVIATION> <CAPITAL>Montgomery</CAPITAL> <POPULATION>4661900</POPULATION> <AREA>52419</AREA> <DATEOFSTATEHOOD>14 December 1819</DATEOFSTATEHOOD> </STATE> <STATE> <NAME>Alaska</NAME> <ABBREVIATION>AK</ABBREVIATION> <CAPITAL>Juneau</CAPITAL> <POPULATION>698473</POPULATION> <AREA>663268</AREA> <DATEOFSTATEHOOD>1 January 1959</DATEOFSTATEHOOD> </STATE> <STATE> <NAME>Delaware</NAME> <ABBREVIATION>DE</ABBREVIATION> <CAPITAL>Dover</CAPITAL> <POPULATION>885122</POPULATION> <AREA>2490</AREA> <DATEOFSTATEHOOD>7 December 1787</DATEOFSTATEHOOD> </STATE> </STATES> <etc, etc.> I want to retrieve (for example) the capital of the oldest state (i.e. "Dover"). I have managed to get this far: //STATES/STATE[DATEOFSTATEHOOD='7 December 1787']/CAPITAL/text() but can't figure out how to say 'DATEOFSTATEHOOD={the earliest DATEOFSTATEHOOD}'. Can anybody point me in the right direction, please? SOLUTION: Matt's solution is more or less spot on. I had to reformat the dates (I used YYYYMMDDD) because, as was pointed out, Xpath 1.0 doesn't support the date format I was using. Also, Microsoft's XML library (4.0 and 6.0) returned the whole node list with Matt's expression. Reversing the test fixed that problem, making it return just the earliest node. So: //STATES/STATE[(DATEOFSTATEHOOD < //STATES/STATE/DATEOFSTATEHOOD)]/CAPITAL/text()

    Read the article

  • Jboss logging issue - pl check this

    - by balaji
    I’m Working as deployer and server administrator. We use Jboss 4.0x AS to deploy our applications. The issue I'm facing is, Whenever we redeploy/restart the server, server.log is getting created but after sometime the logging goes off. Yes it is not at all updating the server.log file. Due to this, we could not trace the other critical issues we have. Actually we have two separate nodes and we do deploy/restarting the server separately on two nodes. We are facing the issue in both of our test and production environment. I could not trace out where exactly the issue is. Could you please help me in resolving the issue? If we have any other issues, we can check the log files. If log itself is not getting updated/logged, how can we move further in analyzing the issues without the recent/updated logs? Below are the logs found in the stdout.log: 18:55:50,303 INFO [Server] Core system initialized 18:55:52,296 INFO [WebService] Using RMI server codebase: http://kl121tez.is.klmcorp.net:8083/ 18:55:52,313 INFO [Log4jService$URLWatchTimerTask] Configuring from URL: resource:log4j.xml 18:55:52,860 ERROR [STDERR] LOG0026E The Log Manager cannot create the object AmasRBPFTraceLogger without a class name. 18:55:52,860 ERROR [STDERR] LOG0026E The Log Manager cannot create the object AmasRBPFMessageLogger without a class name. 18:55:54,273 ERROR [STDERR] LOG0026E The Log Manager cannot create the object AmasCacheTraceLogger without a class name. 18:55:54,274 ERROR [STDERR] LOG0026E The Log Manager cannot create the object AmasCacheMessageLogger without a class name. 18:55:54,334 ERROR [STDERR] LOG0026E The Log Manager cannot create the object JACCTraceLogger without a class name. 18:55:54,334 ERROR [STDERR] LOG0026E The Log Manager cannot create the object JACCMessageLogger without a class name. 18:55:56,059 INFO [ServiceEndpointManager] WebServices: jbossws-1.0.3.SP1 (date=200609291417) 18:55:56,635 INFO [Embedded] Catalina naming disabled 18:55:56,671 INFO [ClusterRuleSetFactory] Unable to find a cluster rule set in the classpath. Will load the default rule set. 18:55:56,672 INFO [ClusterRuleSetFactory] Unable to find a cluster rule set in the classpath. Will load the default rule set. 18:55:56,843 INFO [Http11BaseProtocol] Initializing Coyote HTTP/1.1 on http-0.0.0.0-8180 18:55:56,844 INFO [Catalina] Initialization processed in 172 ms 18:55:56,844 INFO [StandardService] Starting service jboss.web Please help..

    Read the article

  • linq to sql with nservicebus table lock issue

    - by IGoor
    I am building a system using NServiceBus and my DataLayer is using Linq 2 SQL. The system is made up of 2 services. Service1 receives messages from NSB. It will query Table1 in my database and inserts a record into Table1 If a certain condition is met a new NSB message is sent to the 2nd service Service2 will update records also in Table1 when it receives messages from Service1 and it does some other non database related work. Service2 is a long running process. The problem I am having is the moment Service2 updates a record in Table1, the table is locked. The lock seems to be in place until Service2 has completed all it is processing. i.e. The lock is not released after my datacontext is disposed. This causes the query in Service1 to timeout. Once Service2 completes processing, Service1 resumes processing again without problem. So for example Service1 code may look like: int x =0; using (DataContext db = new DataContext()) { x = (from dp in db.Table1 select dp).Count(); // this line will timeout while service2 is processing Table1 t = new Table1(); t.Data = "test"; db.Table1.InsertOnSubmit(t); db.SubmitChanges(); } if(x % 50 == 0) CallService2(); The code in service2 may look like: using (DataContext db = new DataContext()) { Table1 t = db.Table1.Where(t => t.id == myId); t.Data = "updated"; db.SubmitChanges(); } // I would have expected the lock to have been released at this point, but this is not the case. DoSomeLongRunningTasks(); // lock will be released once service2 exits I don't understand why the lock is not released when the datacontext is disposed in Service2. To get around the problem I have been calling: db.ExecuteCommand("SET TRANSACTION ISOLATION LEVEL READ UNCOMMITTED"); and this works, but I am not happy using it. I want to solve this problem properly. Has any one experienced this sort of problem before and does any one know how to solve it? Why is the lock not released after the datacontext has been disposed? Thanks in advance. p.s. sorry for the extremely long post.

    Read the article

  • log4bash: Cannot find a way to add MaxBackupIndex to this logger implementation

    - by Syffys
    I have been trying to modify this log4bash implementation but I cannot manage to make it work. Here's a sample: #!/bin/bash TRUE=1 FALSE=0 ############### Added for testing log4bash_LOG_ENABLED=$TRUE log4bash_rootLogger=$TRACE,f,s log4bash_appender_f=file log4bash_appender_f_dir=$(pwd) log4bash_appender_f_file=test.log log4bash_appender_f_roll_format=%Y%m log4bash_appender_f_roll=$TRUE log4bash_appender_f_maxBackupIndex=10 #################################### log4bash_abs(){ if [ "${1:0:1}" == "." ]; then builtin echo ${rootDir}/${1} else builtin echo ${1} fi } log4bash_check_app_dir(){ if [ "$log4bash_LOG_ENABLED" -eq $TRUE ]; then dir=$(log4bash_abs $1) if [ ! -d ${dir} ]; then #log a seperation line mkdir $dir fi fi } # Delete old log files # $1 Log directory # $2 Log filename # $3 Log filename suffix # $4 Max backup index log4bash_delete_old_files(){ ##### Added for testing builtin echo "Running log4bash_delete_old_files $@" &2 ##### if [ "$log4bash_LOG_ENABLED" -eq $TRUE ] && [ -n "$3" ] && [ "$4" -gt 0 ]; then local directory=$(log4bash_abs $1) local filename=$2 local maxBackupIndex=$4 local suffix=$(echo "${3}" | sed -re 's/[^.]/?/g') local logFileList=$(find "${directory}" -mindepth 1 -maxdepth 1 -name "${filename}${suffix}" -type f | xargs ls -1rt) local fileCnt=$(builtin echo -e "${logFileList}" | wc -l) local fileToDeleteCnt=$(($fileCnt-$maxBackupIndex)) local fileToDelete=($(builtin echo -e "${logFileList}" | head -n "${fileToDeleteCnt}" | sed ':a;N;$!ba;s/\n/ /g')) ##### Added for testing builtin echo "log4bash_delete_old_files About to start deletion ${fileToDelete[@]}" &2 ##### if [ ${fileToDeleteCnt} -gt 0 ]; then for f in "${fileToDelete[@]}"; do #### Added for testing builtin echo "Removing file ${f}" &2 #### builtin eval rm -f ${f} done fi fi } #Appender # $1 Log directory # $2 Log file # $3 Log file roll ? # $4 Appender Name log4bash_filename(){ builtin echo "Running log4bash_filename $@" &2 local format local filename log4bash_check_app_dir "${1}" if [ ${3} -eq 1 ];then local formatProp=${4}_roll_format format=${!formatProp} if [ -z ${format} ]; then format=$log4bash_appender_file_format fi local suffix=.`date "+${format}"` filename=${1}/${2}${suffix} # Old log files deletion local previousFilenameVar=int_${4}_file_previous local maxBackupIndexVar=${4}_maxBackupIndex if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then builtin eval export $previousFilenameVar=$filename log4bash_delete_old_files "${1}" "${2}" "${suffix}" "${!maxBackupIndexVar}" else builtin echo "log4bash_filename $previousFilenameVar = ${!previousFilenameVar}" fi else filename=${1}/${2} fi builtin echo $filename } ######################## Added for testing filename_caller(){ builtin echo "filename_caller Call $1" output=$(log4bash_abs $(log4bash_filename "${log4bash_appender_f_dir}" "${log4bash_appender_f_file}" "1" "log4bash_appender_f" )) builtin echo ${output} } #### Previous logs generation for i in {1101..1120}; do file="${log4bash_appender_f_file}.2012${i:2:3}" builtin echo "${file} $i" touch -m -t "2012${i}0000" ${log4bash_appender_f_dir}/$file done for i in {1..4}; do filename_caller $i done I expect log4bash_filename function to step into the following if only when the calculated log filename is different from the previous one: if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then For this scenario to apply, I'd need ${!previousFilenameVar} to be correctly set, but it's not the case, so log4bash_filename steps into this if all the time which is really not necessary... It looks like the issue is due to the following line not working properly: builtin eval export $previousFilenameVar=$filename I have a some theories to explain why: in the original code, functions are declared and exported as readonly which makes them unable to modify global variable. I removed readonly declarations in the above sample, but probleme persists. Function calls are performed in $() which should make them run into seperated shell instances so variable modified are not exported to the main shell But I cannot manage to find a workaround to this issue... Any help is appreciated, thanks in advance!

    Read the article

  • Detecting abuse for post rating system

    - by Steven smethurst
    I am using a wordpress plugin called "GD Star Rating" to allow my users to vote on stories that I post to one of my websites. http://everydayfiction.com/ Recently we have been having a lot of abuse of the system. Stories that have obviously been voted up artificially. "GD Star Rating" creates some detailed logs when a user votes on a story. Including; IP, Time of vote, and user_adgent, ect.. For example this story has 181 votes with an average of 5.7 http://www.everydayfiction.com/snowman-by-shaun-simon/ Most other stories only get around ~40 votes each day. At first I thought that the story got on to a social bookmarking site Digg, Stumbleupon ect... but after checking the logs I found that this story is getting the same amount of traffic that a normal story gets ~2k-3k. I checked if all the votes for this perpendicular story where coming from a the same IP address. I could see this happening if a user was at a school's computer lab using all their lab computers to vote up this story. Not one duplicate IP address in the log for this story. SELECT ip, COUNT(*) as count FROM wp_gdsr_votes_log WHERE id=3932 GROUP BY (ip ) ORDER BY count DESC Next I thought that a use might be using a proxy to vote up a story. I checked this by grouping all the browser user_agent together to see if there a single browser voting in a perpendicular way. At most 7 users where using a similar browser but voted sporadically (1-5), no evidence of wrong doing. SELECT user_agent, COUNT(*) as count FROM wp_gdsr_votes_log WHERE id=3932 GROUP BY ( user_agent) ORDER BY count DESC I check was to see if all the votes came in at a once. Maybe someone has a really interesting bot that can change the user_adgent and uses proxies, ect... At most 5 votes came with in 2 mins of each other. It doesn't seem to be any regularity on how people vote (IE a 5 vote does not come in once a min) SELECT * FROM wp_gdsr_votes_log WHERE id =3932 AND vote=5 ORDER BY wp_gdsr_votes_log.voted DESC The obvious solution to this problem is to force people to login before they are allowed to vote. But I would prefer to not have to go down that route unless it is absolutely necessary. I'm looking for suggestions on things to test for to detect the abuse.

    Read the article

  • Remove links with Javascript

    - by Arlen Beiler
    How do I remove links from a webpage with Javascript. I am using Google Chrome. The code I tried is: function removehyperlinks() { try { alert(document.anchors.length); alert(document.getElementsByTagName('a')); for(i=0;i=document.anchors.length;i++) { var a = document.anchors[i]; a.outerHTML = a.innerHTML; var b = document.getElementsByTagName('a'); b[i].outerHTML = b[i].innerHTML; } } catch(e) { alert (e);} alert('done'); } Of course, this is test code, which is why I have the alerts and 2 things trying at the same time. The first alert returns "0" the second [Object NodeList] and the third returns "done". My html body looks like this: <body onload="removehyperlinks()"> <ol style="text-align:left;" class="messagelist"> <li class="accesscode"><a href="#">General information, Updates, &amp; Meetings<span class="extnumber">141133#</span></a> <ol> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li start="77"><a href="#"">...</a></li> <li start="88"><a href="#">...</a></li> <li start="99"><a href="#">...</a></li> </ol> </li> </ol> </body>

    Read the article

  • c++ class member functions instatiated by traits

    - by Jive Dadson
    I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

    Read the article

  • android error NoSuchElementException

    - by Alexander
    I have returned a cursor string but it contains a delimiter. The delimiter is . I have the string quest.setText(String.valueOf(c.getString(1)));I want to turn the into a new line. What is the best method to achieve this task in android. I understand there is a way to get the delimeter. I want this to achieved for each record. I can itterate through record like so. Cursor c = db.getContact(2); I tried using a string tokenizer but it doesnt seem to work. Here is the code for the tokenizer. I tested it in just plain java and it works without errors. String question = c.getString(1); // quest.setText(String.valueOf(c.getString(1))); //quest.setText(String.valueOf(question)); StringTokenizer st = new StringTokenizer(question,"<ENTER>"); //DisplayContact(c); // StringTokenizer st = new StringTokenizer(question, "=<ENTER>"); while(st.hasMoreTokens()) { String key = st.nextToken(); String val = st.nextToken(); System.out.println(key + "\n" + val); } I then tried running it in android. Here is the error log 06-06 22:31:55.251: E/AndroidRuntime(537): FATAL EXCEPTION: main 06-06 22:31:55.251: E/AndroidRuntime(537): java.util.NoSuchElementException 06-06 22:31:55.251: E/AndroidRuntime(537): at java.util.StringTokenizer.nextToken(StringTokenizer.java:208) 06-06 22:31:55.251: E/AndroidRuntime(537): at alex.android.test.database.quiz.TestdatabasequizActivity$1.onClick(TestdatabasequizActivity.java:95) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.view.View.performClick(View.java:3511) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.view.View$PerformClick.run(View.java:14105) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Handler.handleCallback(Handler.java:605) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Handler.dispatchMessage(Handler.java:92) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Looper.loop(Looper.java:137) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.app.ActivityThread.main(ActivityThread.java:4424) 06-06 22:31:55.251: E/AndroidRuntime(537): at java.lang.reflect.Method.invokeNative(Native Method) 06-06 22:31:55.251: E/AndroidRuntime(537): at java.lang.reflect.Method.invoke(Method.java:511) 06-06 22:31:55.251: E/AndroidRuntime(537): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:784) 06-06 22:31:55.251: E/AndroidRuntime(537): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:551) 06-06 22:31:55.251: E/AndroidRuntime(537): at dalvik.system.NativeStart.main(Native Method) This is the database query public Cursor getContact(long rowId) throws SQLException { Cursor mCursor = db.query(true, DATABASE_TABLE, new String[] {KEY_ROWID, question, possibleAnsOne,possibleAnsTwo, possibleAnsThree,realQuestion,UR}, KEY_ROWID + "=" + rowId, null, null, null, null, null); if (mCursor != null) { mCursor.moveToFirst(); }

    Read the article

  • AJAX XML reply node value iteration

    - by XpiritO
    Hi there, guys. I would really appreciate to get your help on this, as I can't seem to detect and solve the problem I'm having with an AJAX functionality on a site that I'm currently developing. I have a webform that makes an asynchronous call to a handler (.ashx) that delivers a XML response that is later processed by a Javascript client-side function that places it's contents into the user-interface. I'm attaching an example of the response generated by my handler, and what I would like to know is how can I get all the <body> element innerHTML (with the text and child nodes) contents to append it to a <span> element on the user-interface. Can anyone help me out with this? XML Response returned by the handler (checked via Firebug): <message> <content> <messageId>2</messageId> <from>Barack Obama</from> <fromMail>[email protected]</fromMail> <subject>Yes, we can... get World Peace</subject> <body>Hello, dear citizen. I'm sending you this message to invite you to join us! <a href="http://www.whitehouse.gov">Test link</a> Thank you for your time.</body> </content> </message> Client-side Javascript function to affect the user-interface innerHTML property with the data returned via AJAX: function GetMessageContentsCallback(args, resp) { //XML Parser try { //Internet Explorer xmlDoc = new ActiveXObject("Microsoft.XMLDOM"); xmlDoc.async = "false"; xmlDoc.loadXML(resp); } catch (e) { parser = new DOMParser(); xmlDoc = parser.parseFromString(resp, "text/xml"); } var msgReply = xmlDoc.getElementsByTagName('message')[0]; var ajaxRespondeBodyInnerHTML = msgReply.getElementsByTagName(body)[0].firstChild.nodeValue; //this currently only delivers inner text content, without the <a href... bit and subsequent text document.getElementById("bodySpan").innerHTML = ajaxRespondeBodyInnerHTML; }

    Read the article

  • How to list all duplicated rows which may include NULL columns?

    - by Yousui
    Hi guys, I have a problem of listing duplicated rows that include NULL columns. Lemme show my problem first. USE [tempdb]; GO IF OBJECT_ID(N'dbo.t') IS NOT NULL BEGIN DROP TABLE dbo.t END GO CREATE TABLE dbo.t ( a NVARCHAR(8), b NVARCHAR(8) ); GO INSERT t VALUES ('a', 'b'); INSERT t VALUES ('a', 'b'); INSERT t VALUES ('a', 'b'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('e', NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); GO Now I want to show all rows that have other rows duplicated with them, I use the following query. SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 which will give us the result: a b -------- -------- NULL NULL a b c d Now if I want to list all rows that make contribution to duplication, I use this query: WITH duplicate (a, b) AS ( SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 ) SELECT dbo.t.a, dbo.t.b FROM dbo.t INNER JOIN duplicate ON (dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b) Which will give me the result: a b -------- -------- a b a b a b c d c d c d c d As you can see, all rows include NULLs are filtered. The reason I thought is that I use equal sign to test the condition(dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b), and NULLs cannot be compared use equal sign. So, in order to include rows that include NULLs in it in the last result, I have change the aforementioned query to WITH duplicate (a, b) AS ( SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 ) SELECT dbo.t.a, dbo.t.b FROM dbo.t INNER JOIN duplicate ON (dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b) OR (dbo.t.a IS NULL AND duplicate.a IS NULL AND dbo.t.b = duplicate.b) OR (dbo.t.b IS NULL AND duplicate.b IS NULL AND dbo.t.a = duplicate.a) OR (dbo.t.a IS NULL AND duplicate.a IS NULL AND dbo.t.b IS NULL AND duplicate.b IS NULL) And this query will give me the answer as I wanted: a b -------- -------- NULL NULL NULL NULL NULL NULL NULL NULL a b a b a b c d c d c d c d Now my question is, as you can see, this query just include two columns, in order to include NULLs in the last result, you have to use many condition testing statements in the query. As the column number increasing, the condition testing statements you need in your query is increasing astonishingly. How can I solve this problem? Great thanks.

    Read the article

  • How to perform add/update of a model object that contains EntitySet

    - by David Liddle
    I have a similar concept to the SO questions/tags scenario however am trying to decide the best way of implementation. Tables Questions, QuestionTags and Tags Questions QuestionTags Tags --------- ------------ ---- QID QID TID QName TID TName When adding/updating a question I have 2 textboxes. The important part is a single textbox that allows users to enter in multiple Tags separated by spaces. I am using Linq2Sql so the Questions model has an EntitySet of QuestionTags with then link to Tags. My question is regarding the adding/updating of Questions (part 1), and also how to best show QuestionTags for a Question (part 2). Part 1 Before performing an add/update, my service layer needs to deal with 3 scenarios before passing to their respective repositories. Insert Tags that do not already exist Insert/Update Question Insert QuestionTags - when updating need to remove existing QuestionTags Here is my code below however started to get into a bit of a muddle. I've created extension methods on my repositories to get Tags WithNames etc. public void Add(Question q, string tags) { var tagList = tags.Split(new string[] { " " }, StringSplitOptions.RemoveEmptyEntries).ToList(); using (DB.TransactionScope ts = new DB.TransactionScope()) { var existingTags = TagsRepository.Get() .WithName(tagList) .ToList(); var newTags = (from t in tagList select new Tag { TName = t }).Except(existingTags, new TagsComparer()).ToList(); TagsRepository.Add(newTags); //need to insert QuestionTags QuestionsRepository.Add(q); ts.Complete(); } } Part 2 My second question is, when displaying a list of Questions how is it best to show their QuestionTags? For example, I have an Index view that shows a list of Questions in a table. One of the columns shows an image and when the user hovers over it shows the list of Tags. My current implementation is to create a custom ViewModel and show a List of QuestionIndexViewModel in the View. QuestionIndexViewModel { Question Question { get; set; } string Tags { get; set; } } However, this seems a bit clumsy and quite a few DB calls. public ViewResult Index() { var model= new List<QuestionIndexViewModel>(); //make a call to get a list of questions //foreach question make a call to get their QuestionTags, //to be able to get their Tag names and then join them //to form a single string. return View(model); } Also, just for test purposes using SQL Profiler, I decided to iterate through the QuestionTags entity set of a Question in my ViewModel however nothing was picked up in Profiler? What would be the reason for this?

    Read the article

  • Problem passing variables in php form.

    - by Joshxtothe4
    I have the following php form. I am trying to make it so that when the form is loaded, the values will be assigned the appropriate check- variable. This variable will contain either "checked or "". If it contains checked, the way it is displayed with the html should cause the relevant checkbox to be checked. As it is, the variables do not seem to be being passed. When I echo out $deleted or $notice from within the submitinfo branch, they are blank. Furthermore, nothing is being inserted into the database, and I am not getting any database error. How can I check this? <?php if (isset($_GET["cmd"])) $cmd = $_GET["cmd"]; else if (isset($_POST["cmd"])) $cmd = $_POST["cmd"]; else die("Invalid URL"); if (isset($_GET["pk"])) { $pk = $_GET["pk"]; } if (isset($_POST["deleted"])) { $deleted = $_POST["deleted"]; } if (isset($_POST["notice"])) { $notice = $_POST["notice"]; } $con = mysqli_connect("localhost","user","password", "db"); if (!$con) { echo "Can't connect to MySQL Server. Errorcode: %s\n". mysqli_connect_error(); exit; } $con->set_charset("utf8"); $getformdata = $con->query("select * from STATUS where ARTICLE_NO = '$pk'"); $checkDeleted = ""; $checkNotice = ""; while ($row = mysqli_fetch_assoc($getformdata)) { $checkDeleted = $row['deleted']; $checkNotice = $row['notice']; } if($cmd=="submitinfo") { $statusQuery = "INSERT INTO STATUS VALUES (?, ?)"; if ($statusInfo = $con->prepare($statusQuery)) { $statusInfo->bind_param("ss", $deleted, $notice); $statusInfo->execute(); $statusInfo->close(); echo "true"; } else { echo "false"; } print_r($con->error); } if($cmd=="EditStatusData") { echo "<form name=\"statusForm\" action=\"test.php\" method=\"post\" enctype=\"multipart/form-data\"> <h1>Editing information for auction: ".$pk."</h1> Löschung Ebay: <input type=\"checkbox\" name=\"deleted\" value=\"checked\" ".$checkDeleted." /> <br /> Abmahnung: <input type=\"checkbox\" name=\"notice\" value=\"checked\" ".$checkNotice." /> <br /> <input type=\"hidden\" name=\"cmd\" value=\"submitinfo\" /> <input name=\"Submit\" type=\"submit\" value=\"submit\" /> </form>"; } else { print_r($con->error); }

    Read the article

  • ReadFile doesn't work asynchronously on Win7 and Win2k8

    - by f0b0s
    According to MSDN ReadFile can read data 2 different ways: synchronously and asynchronously. I need the second one. The folowing code demonstrates usage with OVERLAPPED struct: #include <windows.h> #include <stdio.h> #include <time.h> void Read() { HANDLE hFile = CreateFileA("c:\\1.avi", GENERIC_READ, 0, NULL, OPEN_EXISTING, FILE_FLAG_OVERLAPPED, NULL); if ( hFile == INVALID_HANDLE_VALUE ) { printf("Failed to open the file\n"); return; } int dataSize = 256 * 1024 * 1024; char* data = (char*)malloc(dataSize); memset(data, 0xFF, dataSize); OVERLAPPED overlapped; memset(&overlapped, 0, sizeof(overlapped)); printf("reading: %d\n", time(NULL)); BOOL result = ReadFile(hFile, data, dataSize, NULL, &overlapped); printf("sent: %d\n", time(NULL)); DWORD bytesRead; result = GetOverlappedResult(hFile, &overlapped, &bytesRead, TRUE); // wait until completion - returns immediately printf("done: %d\n", time(NULL)); CloseHandle(hFile); } int main() { Read(); } On Windows XP output is: reading: 1296651896 sent: 1296651896 done: 1296651899 It means that ReadFile didn't block and returned imediatly at the same second, whereas reading process continued for 3 seconds. It is normal async reading. But on windows 7 and windows 2008 I get following results: reading: 1296661205 sent: 1296661209 done: 1296661209. It is a behavior of sync reading. MSDN says that async ReadFile sometimes can behave as sync (when the file is compressed or encrypted for example). But the return value in this situation should be TRUE and GetLastError() == NO_ERROR. On Windows 7 I get FALSE and GetLastError() == ERROR_IO_PENDING. So WinApi tells me that it is an async call, but when I look at the test I see that it is not! I'm not the only one who found this "bug": read the comment on ReadFile MSDN page. So what's the solution? Does anybody know? It is been 14 months after Denis found this strange behavior.

    Read the article

  • Stuck in Infinite Loop while PostInvalidating

    - by Nicholas Roge
    I'm trying to test something, however, the loop I'm using keeps getting stuck while running. It's just a basic lock thread while doing something else before continuing kind of loop. I've double checked that I'm locking AND unlocking the variable I'm using, but regardless it's still stuck in the loop. Here are the segments of code I have that cause the problem: ActualGame.java: Thread thread=new Thread("Dialogue Thread"){ @Override public void run(){ Timer fireTimer=new Timer(); int arrowSequence=0; gameHandler.setOnTouchListener( new OnTouchListener(){ @Override public boolean onTouch(View v, MotionEvent me) { //Do something. if(!gameHandler.fireTimer.getActive()){ exitLoop=true; } return false; } } ); while(!exitLoop){ while(fireTimer.getActive()||!gameHandler.drawn); c.drawBitmap(SpriteSheet.createSingleBitmap(getResources(), R.drawable.dialogue_box,240,48),-48,0,null); c.drawBitmap(SpriteSheet.createSingleBitmap(getResources(),R.drawable.dialogue_continuearrow,32,16,8,16,arrowSequence,0),-16,8,null); gameHandler.drawn=false; gameHandler.postInvalidate(); if(arrowSequence+1==4){ arrowSequence=0; exitLoop=true; }else{ arrowSequence++; } fireTimer.startWait(100); } gameHandler.setOnTouchListener(gameHandler.defaultOnTouchListener); } }; thread.run(); And the onDraw method of GameHandler: canvas.scale(scale,scale); canvas.translate(((screenWidth/2)-((terrainWidth*scale)/2))/scale,((screenHeight/2)-((terrainHeight*scale)/2))/scale); canvas.drawColor(Color.BLACK); for(int layer=0;layer(less than)tiles.length;layer++){ if(layer==playerLayer){ canvas.drawBitmap(playerSprite.getCurrentSprite(), playerSprite.getPixelLocationX(), playerSprite.getPixelLocationY(), null); continue; } for(int y=0;y(less than)tiles[layer].length;y++){ for(int x=0;x(less than)tiles[layer][y].length;x++){ if(layer==0&&tiles[layer][y][x]==null){ tiles[layer][y][x]=nullTile; } if(tiles[layer][y][x]!=null){ runningFromTileEvent=false; canvas.drawBitmap(tiles[layer][y][x].associatedSprite.getCurrentSprite(),x*tiles[layer][y][x].associatedSprite.spriteWidth,y*tiles[layer][y][x].associatedSprite.spriteHeight,null); } } } } for(int i=0;i(less than)canvasEvents.size();i++){ if(canvasEvents.elementAt(i).condition(this)){ canvasEvents.elementAt(i).run(canvas,this); } } Log.e("JapaneseTutor","Got here.[1]"); drawn=true; Log.e("JapaneseTutor","Got here.[2]"); If you need to see the Timer class, or the full length of the GameHandler or ActualGame classes, just let me know.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

< Previous Page | 948 949 950 951 952 953 954 955 956 957 958 959  | Next Page >