Search Results

Search found 28559 results on 1143 pages for 'upgrade issue'.

Page 954/1143 | < Previous Page | 950 951 952 953 954 955 956 957 958 959 960 961  | Next Page >

  • Getting error: "This webpage is not available" for my chrome app's options page

    - by Don Rhummy
    My CRX had the proper html page options.html in it, the manifest declares it properly (it shows up as a link on the chrome://extensions page) but when I click that link, Chrome gives the error: This webpage is not available The webpage at chrome-extension://invalid/ might be temporarily down or it may have moved permanently to a new web address. It says "invalid" but the app runs perfectly well (all the content scripts run, the background created a database and saved to it). Why would it show as invalid? Why doesn't it have the extensions' id? Here's the manifest: { "manifest_version": 2, "name": "MyAPP", "description": "My App", "version": "0.0.0.32", "minimum_chrome_version": "27", "offline_enabled": true, "options_page": "options.html", "icons": { "16": "images/icon16.png", "48": "images/icon48.png", "128": "images/icon128.png" }, "app": { "background": { "scripts": [ "scripts/background.js" ] } }, "permissions": [ "unlimitedStorage", "fullscreen", { "fileSystem": [ "write" ] }, "background", "<all_urls>", "tabs" ] } Does it need to be declared in "web_accessible_resources"? Any idea what's wrong? Update Adding to "web_accessible_resources" does not fix the issue. I added everything on that page too. update 2 It looks like it might be a Chrome bug for packaged apps. When I remove the "app" section in the manifest, it works! This is a bug since the Chrome app documentation states that apps can have options pages: https://developer.chrome.com/apps/options.html

    Read the article

  • destroy cfwindow in javascript 'is not a function'

    - by Ryan French
    Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

    Read the article

  • segmentation fault on Unix - possible stack corruption

    - by bob
    hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

    Read the article

  • Scheme Infix to Postfix

    - by Cody
    Let me establish that this is part of a class assignment, so I'm definitely not looking for a complete code answer. Essentially we need to write a converter in Scheme that takes a list representing a mathematical equation in infix format and then output a list with the equation in postfix format. We've been provided with the algorithm to do so, simple enough. The issue is that there is a restriction against using any of the available imperative language features. I can't figure out how to do this in a purely functional manner. This is our fist introduction to functional programming in my program. I know I'm going to be using recursion to iterate over the list of items in the infix expression like such. (define (itp ifExpr) ( ; do some processing using cond statement (itp (cdr ifExpr)) )) I have all of the processing implemented (at least as best I can without knowing how to do the rest) but the algorithm I'm using to implement this requires that operators be pushed onto a stack and used later. My question is how do I implement a stack in this function that is available to all of the recursive calls as well?

    Read the article

  • Application get crash while using NSAutoreleasepool inside MKMapview regionDidChangeAnimated method

    - by Ram
    Hi, i am working on a map application, in that i like to drop the pins (as in Zillow apps) when ever user change the map view. I am using following code code. i am try to load the xml data from server using NSAutoreleasepool to do the xml parsing in the background thread. (void)mapView:(MKMapView *)mapView regionDidChangeAnimated:(BOOL)animated{ NSLog(@"inside region did changed "); urlString =[NSString stringWithFormat: @"http://asdfasdasdf.com/asdfasdf/mapxml.php]; [stories1 release]; [mapview removeAnnotations:eventPoints1]; eventPoints1 = [[NSMutableArray array] retain]; [self performSelectorInBackground:@selector(callParsing) withObject:nil]; } -(void)callParsing{ NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; [self parseXMLFileAtURL:urlString]; [self performSelectorOnMainThread:@selector(droppingPin) withObject:nil waitUntilDone:YES]; [pool drain]; } The above code is working fine, but once i changed the mapview, the appllication get crashed. Anyone can help me to fix the issue? thanks in advance.

    Read the article

  • My button background seems stretched.

    - by Kyle Sevenoaks
    Hi, I have a button as made for you to see here. Looks fine,right? Well on the live site, euroworker.no/shipping it seems stretched. Renders fine in Chrome, IE and Safari, I thought it might have been a FF issue, but loaded the fiddle into FF and seems fine. Quick ref CSS and html: #fortsett_btn { background-image: url(http://euroworker.no/public/upload/fortsett.png?1269434047); background-repeat:no-repeat; background-position:left; background-color:none; border:none; outline;none; visibility: visible; position: relative; z-index: 2; width: 106px; height: 25px; cursor:pointer; }? And HTML <button type="submit" class="submit" id="fortsett_btn" title="Fortsett" value="">&nbsp;</button>? I wonder what's up with it.

    Read the article

  • jquery ajax post canceled

    - by hsemu
    I want to track the mouse click events on a set of UI components on a set of pages. To do this, I am using the following jquery/ajax call(trimmed out u): 1.Ajax call which will add the click logging. myClickLogger = { endpoint: '/path/to/my/logging/endpoint.html', logClickEvent: function(clickCode) { $.ajax({ 'type': 'POST', 'url': this.endpoint, 'async': true, 'cache': false, 'global': false, 'data': { 'clickCode':clickCode }, 'error': function(xhr,status,err){ alert("DEBUG: status"+status+" \nError:"+err); }, 'success': function(data){ if(data.status!=200){ alert("Error occured!"); } } }); } }; 2.JQuery click event which will call the ajax logger(the clickCode is an identifier for which button/image was clicked): $(document).ready(function() { $(".myClickEvent[clickName]").click(function() { var clickCode = $(this).attr("clickName"); myClickLogger.logClickEvent(clickCode); }); }); The above ajax call(1.) is "canceled" by browser whenever the button click being tracked takes to a new page. If I change 'aysnc' to 'false', then the ajax call succeeds. Also, click events which do not take to a new page succeed. Only the click events taking to new page are being canceled. I do not want to make the call synchronous. Any ideas, what could be the issue? How can I guarantee that the asynchronous call before is finished when the click event takes to a new page?

    Read the article

  • Broken flash movie player! allowFullScreen does not work with anything other than a wmode value of "

    - by lhnz
    I have a flash player on a page which plays videos. I also have modal popups which need to be able to display over the top of the flash player when they are opened, etc... I can't change either of these requirements since they are part of the spec I have been given. Flash seems to ignore z-indexes I set on it with css, and the modal popups will therefore only appear above the video player if I set the video player's wmode to opaque or transparent. However, if I do this then the full screen functionality stops working correctly: when I un-fullscreen the video it stays zoomed in. In short If you open a popup on an item page or another page containing flash the popup should be displayed above this. Flash ignores z-index values. You can stop flash ignoring z-index values by setting wmode to opaque or transparent rather than the default: window. This stops full screen from working correctly. Has anybody else faced this issue before? What can I do to fix it? I was thinking of recreating the video player with wmode=opaque whenever I opened a modal popup and then switching it back to wmode=window when the modal popup is closed, since this would mean that the popup should display above it (as wmode=opaque) and the fullscreen should work correct (as wmode=window). However, this is not ideal at all: as well as being a hack it would also mean that the video would stop playing if somebody clicked a button which opened a popup. Cheers!

    Read the article

  • Daylight Savings Handling in DateDiff() in MS Access?

    - by PowerUser
    I am fully aware of DateDiff()'s inability to handle daylight savings issues. Since I often use it to compare the number of hours or days between 2 datetimes several months apart, I need to write up a solution to handle DST. This is what I came up with, a function that first subtracts 60 minutes from a datetime value if it falls within the date ranges specified in a local table (LU_DST). Thus, the usage would be: datediff("n",Conv_DST_to_Local([date1]),Conv_DST_to_Local([date2])) My question is: Is there a better way to handle this? I'm going to make a wild guess that I'm not the first person with this question. This seems like the kind of thing that should have been added to one of the core reference libraries. Is there a way for me to access my system clock to ask it if DST was in effect at a certain date & time? Function Conv_DST_to_Local(X As Date) As Date Dim rst As DAO.Recordset Set rst = CurrentDb.OpenRecordset("LU_DST") Conv_DST_to_Local = X While rst.EOF = False If X > rst.Fields(0) And X < rst.Fields(1) Then Conv_DST_to_Local = DateAdd("n", -60, X) rst.MoveNext Wend End Function Notes I have visited and imported the BAS file of http://www.cpearson.com/excel/TimeZoneAndDaylightTime.aspx. I spent at least an hour by now reading through it and, while it may do its job well, I can't figure out how to modify it to my needs. But if you have an answer using his data structures, I'll take a look. Timezones are not an issue since this is all local time.

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • WCF: How can I send data while gracefully closing a connection?

    - by mafutrct
    I've got a WCF service that offers a Login method. A client is required to call this method (due to it being the only IsInitiating=true). This method should return a string that describes the success of the call in any case. If the login failed, the connection should be closed. The issue is with the timing of the close. I'd like to send the return value, then immediately close the connection. string Login (string name, string pass) { if (name != pass) { OperationContext.Current.Channel.Close (); return "fail"; } else { return "yay"; } } The MSDN states that calling Close on the channel causes an ICommunicationObject to gracefully transition from the Opened state to the Closed state. The Close method allows any unfinished work to be completed before returning. For example, finish sending any buffered messages). This did not work for me (or my understanding is wrong), as the close is executed immediately - WCF does not wait for the Login method to finish executing and return a string but closes the connection earlier. Therefore I assume that calling Close does not wait for the running method to finish. Now, how can I still return a value, then close?

    Read the article

  • CSS absolute DIV causing other absolute DIV problems

    - by Tim
    Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

    Read the article

  • ColdFusion 8: Database Connection Reset Error

    - by Gavin
    I have been getting these intermittent ColdFusion Database connection reset errors and was wondering if anyone had experience with this and had a particular solution that worked? Here is the error: Error Executing Database Query.[Macromedia][SQLServer JDBC Driver]A problem occurred when attempting to contact the server (Server returned: Connection reset). Please ensure that the server parameters passed to the driver are correct and that the server is running. Also ensure that the maximum number of connections have not been exceeded for this server. This doesn't happen with any particular query, the code breaks in different queries every time, returning a SQLState error 08s01. These query's logic are fine, no logic errors etc. I checked the network logs and there were no database server connection refusals at the time of the error. Once the first error occurs, it keeps happening for no more than a minute or so at random times of the day, every few days. I've googled this thing and so far anyone that has had this issue was only on CF6 or 7, which the fixes coldFusion put out are only for CF6 or 7. Server configuration wise: The ColdFusion server is version 8 The database server is SQL Server 2005 Standard The database connections allowed setting is set to unlimited on both SQL Server and ColdFusion Any help would be greatly appreciated, Thanks!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Circle drawing with SVG's arc path

    - by ????
    The following SVG path can draw 99.99% of a circle: (try it on http://jsfiddle.net/DFhUF/46/ and see if you see 4 arcs or only 2, but note that if it is IE, it is rendered in VML, not SVG, but have the similar issue) M 100 100 a 50 50 0 1 0 0.00001 0 But when it is 99.99999999% of a circle, then nothing will show at all? M 100 800 a 50 50 0 1 0 0.00000001 0 And that's the same with 100% of a circle (it is still an arc, isn't it, just a very complete arc) M 100 800 a 50 50 0 1 0 0 0 How can that be fixed? The reason is I use a function to draw a percentage of an arc, and if I need to "special case" a 99.9999% or 100% arc to use the circle function, that'd be kind of silly. Again, a test case on jsfiddle using RaphaelJS is at http://jsfiddle.net/DFhUF/46/ (and if it is VML on IE 8, even the second circle won't show... you have to change it to 0.01) Update: This is because I am rendering an arc for a score in our system, so 3.3 points get 1/3 of a circle. 0.5 gets half a circle, and 9.9 points get 99% of a circle. But what if there are scores that are 9.99 in our system? Do I have to check whether it is close to 99.999% of a circle, and use an arc function or a circle function accordingly? Then what about a score of 9.9987? Which one to use? It is ridiculous to need to know what kind of scores will map to a "too complete circle" and switch to a circle function, and when it is "a certain 99.9%" of a circle or a 9.9987 score, then use the arc function.

    Read the article

  • problem getting info from a cookie with javascript

    - by Jason
    I am having an issue with my cookies and I can't figure it out. Basically I have it set up so it checks for the cookie to see if the user is logged in, and then displays either a welcome message or a login link. It works - except that instead of returning the persons name in the welcome message it just is blank where the name should be. The cookie is there, with all the appropriate info.. not sure what I am doing wrong. var itm = new Array(); itm[0] = findCookie("ui"); if (itm[0] == null) { document.write("<h2><a href='logreg.html'>Log In or Sign Up</a></h2>"); } else { var c1 = itm[0].indexOf(","); var c2 = itm[0].indexOf(",",c1); var c3 = itm[0].indexOf(",",c2); var gname = itm[0].substring(c2,c3); document.write("<h2>Welcome "+gname+"!</h2>"); } The findCookie function is.. function findCookie(val){ var cookie = null; var findVal = val + "="; var dc = document.cookie; if (dc.length > 0) { var start = dc.indexOf(findVal); if (start >= 0) { start += findVal.length; lastVal = dc.indexOf(";", start); if (lastVal == -1) { lastVal = dc.length; } cookie = (dc.substring(start, lastVal)); } else { return cookie; } } return cookie; }

    Read the article

  • python: how to design a container with elements that must reference their container

    - by Luke404
    (the title is admittedly not that great. Please forgive my English, this is the best I could think of) I'm writing a python script that will manage email domains and their accounts, and I'm also a newby at OOP design. My two (related?) issues are: the Domain class must do special work to add and remove accounts, like adding/removing them to the underlying implementation how to manage operations on accounts that must go through their container To solve the former issue I'd add a factory method to the Domain class that'll build an Account instance in that domain, and a 'remove' (anti-factory?) method to handle deletions. For the latter this seems to me "anti-oop" since what would logically be an operation on an Account (eg, change password) must always reference the containing Domain. Seems to me that I must add to the Account a reference back to the Domain and use that to get data (like the domain name) or call methods on the Domain class. Code example (element uses data from the container) that manages an underlying Vpopmail system: class Account: def __init__(self, name, password, domain): self.name = name self.password = password self.domain = domain def set_password(self, password): os.system('vpasswd %s@%s %s' % (self.name, self.domain.name, password) self.password = password class Domain: def __init__(self, domain_name): self.name = domain_name self.accounts = {} def create_account(self, name, password): os.system('vadduser %s@%s %s' % (name, self.name, password)) account = Account(name, password, self) self.accounts[name] = account def delete_account(self, name): os.system('vdeluser %s@%s' % (name, self.name)) del self.accounts[name] another option would be for Account.set_password to call a Domain method that would do the actual work - sounds equally ugly to me. Also note the duplication of data (account name also as dict key), it sounds logical (account names are "primary key" inside a domain) but accounts need to know their own name.

    Read the article

  • Writing to EEPROM on PIC

    - by JB
    Are there any PIC microcontroller programmers here? I'm learning some PIC microcontroller programming using a pickit2 and the 16F690 chip that came with it. I'm working through trying out the various facilities at the moment. I can sucessfully read a byte from the EEPROM in code if I set the EEPROM vaklue in MPLAB but I don't seem to be able to modify the value using the PIC itsself. Simply nothing happens and I don't read back the modified value, I always get the original which implies to me that the write isn't working? This is my code for that section, am I missing something? I know I'm doing a lot of unnecessary bank switches, I added most of them to ensure that being on the wrong bank wasn't the issue. ; ------------------------------------------------------ ; Now SET the EEPROM location ZERO to 0x08 ; ------------------------------------------------------ BANKSEL EEADR CLRF EEADR ; Set EE Address to zero BANKSEL EEDAT MOVLW 0x08 ; Store the value 0x08 in the EEPROM MOVWF EEDAT BANKSEL EECON1 BSF EECON1, WREN ; Enable writes to the EEPROM BANKSEL EECON2 MOVLW 0x55 ; Do the thing we have to do so MOVWF EECON2 ; that writes can work MOVLW 0xAA MOVWF EECON2 BANKSEL EECON1 BSF EECON1, WR ; And finally perform the write WAIT BTFSC EECON1, WR ; Wait for write to finish GOTO WAIT BANKSEL PORTC ; Just to make sure we are on the right bank

    Read the article

  • VPython in Eclipse - thinks it has the wrong architecture type.

    - by Duncan Tait
    Evening, So I've recently installed VPython on my MacBook (OS X, Snow Leopard) - and it works absolutely fine in IDLE and from the command line (interactive mode). However, eclipse has issues. Firstly it couldn't find it (which is a bit of an issue actually with all these 'easy install' python modules - when they don't tell you where they actually install to!) but I searched it out in the depths of Library\Frameworks... and added that to the System PYTHONPATH listbox in Eclipse. Now it can find it, but it says the following: Traceback (most recent call last): File "/Users/duncantait/dev/workspace/Network_Simulation/src/Basic/Net_Sim1.py", line 15, in <module> import visual File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/__init__.py", line 59, in <module> import cvisual ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so: mach-o, but wrong architecture I am guessing that VPython might not be built for a 64-bit architecture (Intel), but the fact remains that it works in both IDLE and command prompt... So there must be a way to configure Eclipse to run it right? (Wishful thinking). Thanks for any help! Duncan

    Read the article

  • Can't open Websphere Portal 7.0 Login Page after its integration with a custom user registry?

    - by jack_sparrow
    I am currently working on a project related to Websphere Portal 7.0 on Windows Server 2008 R2,64 bit. I am trying to integrate websphere portal with my custom user registry.I have completed all the steps required to implement custom user registry in portal as given in IBM documentation.I am adding my custom repository to the default federated repositories of Portal 7.0.I have made the required changes under VMM Federated CUR Properties section in wkplc.properties.I am using configengine.bat file to configure Portal with user registry. But even completing all the steps,when I am trying to open the Portal Login Page through http://ip-address:port_of_portal/wps/portal ,it is throwing an exception on the console: "Error 500: com.ibm.wps.resolver.data.exceptions.URIProcessingIOException: EJCBD0021E: The URI dav:fs-type1/themes/PageBuilder2/theme.html and parameters [['themeURI'=, 'mime-type'= could not be processed: [EJCBD0021E: The URI dav:fs-type1/themes/PageBuilder2/theme.html and parameters [['themeURI'=, 'mime-type'= could not be processed: EJPSG0002E: Requested Member does not exist.uid=portal,o=defaultWIMFileBasedRealm/null] " and in logs Systemout.log "EJPSB0005E: Exception occurred during creation of the principal with Name uid=portal,o=defaultWIMFileBasedRealm and Principal Type USER caused by com.ibm.portal.puma.MemberNotFoundException: EJPSG0002E: Requested Member does not exist.uid=portal,o=defaultWIMFileBasedRealm/null". Here,"portal" is administrative user in my custom user registry.I am able to access WAS using /ibm/console through user "portal".Please suggest some way to handle this issue.

    Read the article

  • Parse Text using scanner useDelimiter

    - by Brian
    Looking to parse the following text file: Sample text file: <2008-10-07text entered by user<2008-11-26additional text entered by user I would like to parse the above text so that I can have three variables: v1 = 2008-10-07 v2 = text entered by user v3 = Ted Parlor v1 = 2008-11-26 v2 = additional text entered by user v3 = Ted Parlor I attempted to use scanner and useDelimiter, however, I'm having issue on how to set this up to have the results as stated above. Here's my first attempt: enter code here import java.io.*; import java.util.Scanner; public class ScanNotes { public static void main(String[] args) throws IOException { Scanner s = null; try { //String regex = "(?<=\<)([^\*)(?=\)"; s = new Scanner(new BufferedReader(new FileReader("cur_notes.txt"))); s.useDelimiter("[<]+"); while (s.hasNext()) { String v1 = s.next(); String v2= s.next(); System.out.println("v1= " + v1 + " v2=" + v2); } } finally { if (s != null) { s.close(); } } } } The results is as follows: v1= 2008-10-07text entered by user v2=Ted Parlor What I desire is: v1= 2008-10-07 v2=text entered by user v3=Ted Parlor v1= 2008-11-26 v2=additional text entered by user v3=Ted Parlor Any help that would allow me to extract all three strings separately would be greatly appreciated.

    Read the article

  • iPhone SDK background thread image loading problem

    - by retailevolved
    I have created a grid view that displays six "cells" of content. In each cell, an image is loaded from the web. There are a multiple pages of this grid (the user moves through them by swiping up / down to see the next set of cells). Each cell has its own view controller. When these view controllers load, they use an ImageLoader class that I made to load and display an image. These view controllers implement an ImageLoaderDelegate that has a single method that gets called when the image is finished loading. ImageLoader does its work on a background thread and then simply notifies its delegate when it is done loading, passing the image to the delegate method. Trouble is that if the user moves on to the next page of grid content before the image has finished loading (releasing the GridCellViewControllers that use the ImageLoaders), the app crashes. I suspect that this is because along the line, an asynchronous method finishes and attempts to notify its delegate but can't because it's been released. Here's some code to give a better picture: GridCellViewController.m: - (void)viewDidLoad { [super viewDidLoad]; // ImageLoader _loader = [[ProductImageLoader alloc] init]; _loader.delegate = self; if(_boundObject) [_loader loadImageForProduct:_boundObject]; } //ImageLoaderDelegate method - (void) imageDidFinishLoading: (UIImage *)image { [_imgController setImage:image]; } ProductImageLoader.m - (void) loadImageForProduct: (Product *) product { // Get image on another thread [NSThread detachNewThreadSelector:@selector(getImageForProductInBackground:) toTarget:self withObject:product]; } - (void) getImageForProductInBackground: (Product *) product { NSAutoreleasePool *tempPool = [[NSAutoreleasePool alloc] init]; HttpRequestLoader *tempLoader = [[HttpRequestLoader alloc] init]; NSURL *tempUrl = [product getImageUrl]; NSData *imageData = tempUrl ? [tempLoader loadSynchronousDataFromAddress:[tempUrl absoluteString]] : nil; UIImage *image = [[UIImage alloc] initWithData:imageData]; [tempPool release]; if(delegate) [delegate imageDidFinishLoading:image]; } The app crashes with EXC_BAD_ACCESS. Disclaimer: The code has been slightly modified to focus on the issue at hand.

    Read the article

  • How to figure out what error my Java Eclipse project has?

    - by Greg Mattes
    I've created a Java project from existing source with an Ant build script in Eclipse. I cannot run my project because Eclipse tells me that there is at least one error in it. Now, I know that the project runs fine on the command line, so I suspect an Eclipse configuration error. As far as I can tell, the only feedback that I have from Eclipse is a little red X on my project in the Package Explorer window and dialog window when I try to run the project says there are errors in the project This is all wonderful, but what is the error? Is there a "show me the next error" button somewhere? In the past, on other Eclipse projects, I've notice other little red X's on folders containing source files with errors, the little red X's appear on the source files as well. I scanned (manually) through all of the source files and I haven't found any other red X's (again, where is the "next error" button?). If I select the "Proceed" button I am greeted with a java.lang.NoClassDefFoundError for my main class, which makes me suspect a classpath issue. I've checked the classpath, and I'm fairly certain that it's correct. Is there a way to see the exact jvm command line that Eclipse is invoking? I realize that it might be invoking the JVM programmatically, and not on a "real" command line. In any case, is there a way, other than the run configuration dialog, to see what is actually happening when I hit the "Proceed" button?

    Read the article

  • MSBuild "Wrapper" fails while VS2010 "Pure" compile succeeds for MFC application in CruiseControl.NE

    - by ee
    The Overview I am working on a Continuous Integration build of a MFC appliction via CruiseControl.net and VS2010. When building my .sln, a "Visual Studio" CCNet task (devenv) works, but a wrapper MSBuild script run via the CCNet MSBuild task fails with errors like: error RC1015: cannot open include file 'winres.h'.. error C1083: Cannot open include file: 'afxwin.h': No such file or directory error C1083: Cannot open include file: 'afx.h': No such file or directory The Question How can I adjust the build environment of my msbuild wrapper so that the application builds correctly? (Pretty clearly the MFC paths aren't right for the msbuild environment, but how do i fix it for MSBuild+VS2010+MFC+CCNet?) Background Details We have successfully upgraded an MFC application (.exe with some MFC extension .dlls) to Visual Studio 2010 and can compile the application without issue on developer machines. Now I am working on compiling the application on the CI server environment I did a full installation of VS2010 (Professional) on the build server. In this way, I knew everything I needed would be on the machine (one way or another) and that this would be consistent with developer machines. VS2010 is correctly installed on the CI server, and the devenv task works as expected I now have a wrapper MSBuild script that does some extended version processing and then builds the .sln for the application via an MSBuild task. This wrapper script is run via CCNet's MSBuild task and fails with the above mentioned errors My Assumptions This seems to be a missing/wrong configuration of include paths to standard header resources of the MFC persuasion I should be able to coerce the MSBuild environment to consider the relevant resource files from my VS2010 install and have this approach work. But how do I do that? Am I setting Environment variables? Registry settings? I can see how one can inject additional directories in some cases, but this seems to need a more systemic configuration at the compiler defaults level.

    Read the article

  • Amazon S3 and swfaddress

    - by justinbach
    I recently migrated a large AS3 site (lots of swfs, lots of flvs) to Amazon S3. Pretty much everything but HTML and JS files is being stored/served from Amazon, and it's working well. The only problem I'm having is that I built the site using SWFaddress (actually, via the Gaia framework which uses SWFaddress), and for some reason, SWFaddress is no longer updating the address bar correctly as users navigate from page to page. In other words, the URL persistently remains http://www.mysite.com, not http://www.mysite.com/#/section as would be the case were SWFaddress functioning correctly (and as it was functioning prior to the migration). Stranger yet, if I go to (e.g.) http://www.mysite.com/#/section directly, the deeplinking functions as you'd expect--I arrive directly at the correct section. However, navigating away from that section doesn't have any effect on the address bar, despite the fact that it should be dynamically updated. I've got a crossdomain.xml file set up on the site that allows access from all domains, so that's not the issue, and I don't know what else might be. Any ideas would be greatly appreciated! P.S. I integrated S3 by putting pretty much the entire site in an S3 bucket and then just changing the initial swfobject embed to point to the S3 instance of main.swf, passing in the S3 path as the "base" param to the embedded swf so that all dynamically loaded assets and swfs would also be sourced from s3. Dunno if that's related to the troubles I'm having.

    Read the article

< Previous Page | 950 951 952 953 954 955 956 957 958 959 960 961  | Next Page >