Search Results

Search found 38817 results on 1553 pages for 'inline function'.

Page 956/1553 | < Previous Page | 952 953 954 955 956 957 958 959 960 961 962 963  | Next Page >

  • Greasemonkey is getting an empty document.body on select Google pages.

    - by Brock Adams
    Hi, I have a Greasemonkey script that processes Google search results. But it's failing in a few instances, when xpath searches (and document body) appear to be empty. Running the code in Firebug's console works every time. It only fails in a Greasemonkey script. Greasemonkey sees an empty document.body. I've boiled the problem down to a test, greasemonkey script, below. I'm using Firefox 3.5.9 and Greasemonkey 0.8.20100408.6 (but earlier versions had the same problem). Problem: Greasemonkey sees an empty document.body. Recipe to Duplicate: Install the Greasemonkey script. Open a new tab or window. Navigate to Google.com (http://www.google.com/). Search on a simple term like "cats". Check Firefox's Error console (Ctrl-shift-J) or Firebug's console. The script will report that document body is empty. Hit refresh. The script will show a good result (document body found). Note that the failure only reliably appears on Google results obtained this way, and on a new tab/window. Turn javascript off globally (javascript.enabled set to false in about:config). Repeat steps 2 thru 5. Only now the Greasemonkey script will work. It seems that Google javascript is killing the DOM tree for greasemonkey, somehow. I've tried a time-delayed retest and even a programmatic refresh; the script still fails to see the document body. Test Script: // // ==UserScript== // @name TROUBLESHOOTING 2 snippets // @namespace http://www.google.com/ // @description For code that has funky misfires and defies standard debugging. // @include http://*/* // ==/UserScript== // function LocalMain (sTitle) { var sUserMessage = ''; //var sRawHtml = unsafeWindow.document.body.innerHTML; //-- unsafeWindow makes no difference. var sRawHtml = document.body.innerHTML; if (sRawHtml) { sRawHtml = sRawHtml.replace (/^\s\s*/, ''). substr (0, 60); sUserMessage = sTitle + ', Doc body = ' + sRawHtml + ' ...'; } else { sUserMessage = sTitle + ', Document body seems empty!'; } if (typeof (console) != "undefined") { console.log (sUserMessage); } else { if (typeof (GM_log) != "undefined") GM_log (sUserMessage); else if (!sRawHtml) alert (sUserMessage); } } LocalMain ('Preload'); window.addEventListener ("load", function() {LocalMain ('After load');}, false);

    Read the article

  • stop execution of process for miliseconds.

    - by Viral
    hi friends, I m creating a Tic tac toe game, in that after click made by user automatically the cpu will respond. I want the cpu response after 0.50 seconds, the sleep() function takes too many time, i don't want that much time, is there any other way to do so???

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • css coding on Myspace - Problem

    - by Frederik Wessberg
    Hey Folks. I've read what I could, and I'm certainly no master, but I'm fixing up a colleagues profile on myspace.com, and im working with 2 divs in each side of the screen, and I want them to align so that they are next to each other. I've tried float: left; and float: right;, and I've tried margin: right; on div 1 and such. Could you help? Here's the site: http://www.myspace.com/jonasjohansen This is info for div1: <div class="textBox" align="left" style="width: 290px; word-wrap:break-word"> <span class="orangetext15"> BANDS </span> <b>MOVE</b><br /> Fredrik ....balbalbalbla </div> <style> .textBox { position: relative; left:-320px; top:0px; width: 290px; height: 350px; overflow-y: visible; overflow-x: visible; top: YYYpx; z-index: 3; background-color: transparent; border:none; } </style> This is info for div2: <style>.i {display:none;}{!-eliminate bio header!-}table table td.text table td.text {display:none;}{!-recover in shows and friends-!}table table td.text div table td.text,table table td.text table.friendSpace td.text {display:inline;}{! move up our custom section. You may change px value !}div.myDivR {position:relative; top:0px; margin-bottom:-300px; }{! you can apply style to the custom div !}div.myDivR {background-color:white; border:2px solid; border-color:darkgreen; float: right;}</style></td></tr></table></td></tr></table><span class="off">Re-Open Bio Table give it our own Class </span><table class="myBio" style="width:435px;"><tr><i class="i"></i><td class="myBioHead" valign="center" align="left" width="auto" bgcolor="ffcc99" height="17"> &nbsp;&nbsp;<span class="orangetext15"> ABOUT JONAS JOHANSEN</span> </td></tr><tr><td><table class="myBioI"><tr><td><span class="off"></span> blalbalbalbalbla <span class="off">END Bio Content </span>

    Read the article

  • Is there any way to achieve multiple inheritance in php?

    - by Starx
    Lets say I have a parent class class parent { } ..... This parent has three sub class class child1 { } class child2 { } class child3 { } and these child classes have further smaller parts like class child1subpar1 { } class child1subpar2 { public function foo() { echo "hi"; } } class child2subpar1 { } class child2subpar2 { } Now, how to sum this whole up like class child1 extends child1subpar1, child1subpar2 { } class child2 extends child2subpar1, childsubpar1 { } class parent extends child1,child2,child3 { } I need to execute the methods in its inherited classes and do something like this $objparent = new parent; $objparent - foo();

    Read the article

  • jQuery Dynamic Button Click Handler

    - by Neb
    I have a code the change the html of a div to make a button. When I make a click handler for the dynamic button, nothing happens $('#signinup').html("<button id=\"login_submit\">Sign In</button>"); And the handler: $('#login_submit').click(function() { alert("Works!"); });

    Read the article

  • open source twitter?

    - by George2
    Hello everyone, I want to add twitter like function to my site, like t.mysite.com. Any open source, stable and easy to setup/use twitter software? thanks in advance, George

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • PHP Force Apache error

    - by Rolf
    Hi dear stackers :P Thanks to this forum, I learnt PHP header function does not actually send header to Apache server but only to the client. What I wanna do is to generate an error 500, and let Apache displays its corresponding page. Is there a way to force it ? Thanks in advance ! (and allez les bleus !)

    Read the article

  • PHP 'Years' array

    - by J M 4
    I am trying to create an array for years which i will use in the DOB year piece of a form I am building. Currently, I know there are two ways to handle the issue but I don't really care for either: 1) Range: I know I can create a year array using the following <?php $year = range(1910,date("Y")); $_SESSION['years_arr'] = $year; ?> the problem with Point 1 is two fold: a) my function call shows the first year as 'selected' instead of "Year" as I have as option="0", and b) I want the years reversed so 2010 is the first in the least and shown decreasing. My function call is: PHP <?php function showOptionsDrop($array, $active, $echo=true){ $string = ''; foreach($array as $k => $v){ $s = ($active == $k)? ' selected="selected"' : ''; $string .= '<option value="'.$k.'"'.$s.'>'.$v.'</option>'."\n"; } if($echo) echo $string; else return $string; } ?> HTML <table> <tr> <td>State:</td> <td><select name="F1State"><option value="0">Choose a year</option><?php showOptionsDrop($_SESSION['years_arr'], null, true); ?></select> </td> </tr> </table> 2) Long Array I know i can physically create an array with years listed out but this takes up a lot of space and time if I ever want to go back and modify. ex: PHP $years = array('1900'=>"1900", '1901'=>"1901", '1902'=>"1902", '1903'=>"1903", '1904'=>"1904", '1905'=>"1905", '1906'=>"1906", '1907'=>"1907", '1908'=>"1908", '1909'=>"1909", '1910'=>"1910", '1911'=>"1911", '1912'=>"1912", '1913'=>"1913", '1914'=>"1914", '1915'=>"1915", '1916'=>"1916", '1917'=>"1917", '1918'=>"1918", '1919'=>"1919", '1920'=>"1920", '1921'=>"1921", '1922'=>"1922", '1923'=>"1923", '1924'=>"1924", '1925'=>"1925", '1926'=>"1926", '1927'=>"1927", '1928'=>"1928", '1929'=>"1929", '1930'=>"1930", '1931'=>"1931", '1932'=>"1932", '1933'=>"1933", '1934'=>"1934", '1935'=>"1935", '1936'=>"1936", '1937'=>"1937", '1938'=>"1938", '1939'=>"1939", '1940'=>"1940", '1941'=>"1941", '1942'=>"1942", '1943'=>"1943", '1944'=>"1944", '1945'=>"1945", '1946'=>"1946", '1947'=>"1947", '1948'=>"1948", '1949'=>"1949", '1950'=>"1950", '1951'=>"1951", '1952'=>"1952", '1953'=>"1953", '1954'=>"1954", '1955'=>"1955", '1956'=>"1956", '1957'=>"1957", '1958'=>"1958", '1959'=>"1959", '1960'=>"1960", '1961'=>"1961", '1962'=>"1962", '1963'=>"1963", '1964'=>"1964", '1965'=>"1965", '1966'=>"1966", '1967'=>"1967", '1968'=>"1968", '1969'=>"1969", '1970'=>"1970", '1971'=>"1971", '1972'=>"1972", '1973'=>"1973", '1974'=>"1974", '1975'=>"1975", '1976'=>"1976", '1977'=>"1977", '1978'=>"1978", '1979'=>"1979", '1980'=>"1980", '1981'=>"1981", '1982'=>"1982", '1983'=>"1983", '1984'=>"1984", '1985'=>"1985", '1986'=>"1986", '1987'=>"1987", '1988'=>"1988", '1989'=>"1989", '1990'=>"1990", '1991'=>"1991", '1992'=>"1992", '1993'=>"1993", '1994'=>"1994", '1995'=>"1995", '1996'=>"1996", '1997'=>"1997", '1998'=>"1998", '1999'=>"1999", '2000'=>"2000", '2001'=>"2001", '2002'=>"2002", '2003'=>"2003", '2004'=>"2004", '2005'=>"2005", '2006'=>"2006", '2007'=>"2007", '2008'=>"2008", '2009'=>"2009", '2010'=>"2010"); $_SESSION['years_arr'] = $years_arr; Does anybody have a recommended idea how to work - or just how to simply modify my existing code? Thank you!

    Read the article

  • Javascript Cookie

    - by Ajith
    How can i create a cookie by using javascript just for end of the browser session(ie,upto closing of current browser).My script is like follows; function setCookie(c_name,c_value,c_expiredays) { var exdate=new Date(); exdate.setDate(exdate.getDate()+c_expiredays); document.cookie=c_name+ "=" +escape(c_value)+ ((c_expiredays==null) ? "" : ";expires="+exdate.toGMTString()); } setCookie('gs_cookie','firstme',1600000);` How much value i need to pass instead of 1600000. Please help....

    Read the article

  • Write a few things to a session in cakephp

    - by kwokwai
    Hi all, I am learning Session function in CakePhp, and see some examples like this on cakePHP cookBook web site: For example: write($mysession1, 'testing') I am not sure if a session can only hold up a particular thing in it. Is it possible to write an array to a session like: mysession[0] = 'Testing0'; mysession[1] = 'Testing1'; mysession[2] = 'Testing2';

    Read the article

  • How to write (simple) macro?

    - by krzysz00
    I need to write a macro (with-hooks (monster method who what) &body body) for a game I'm writing. Monster is a CLOS object, method and who are strings and what is a function (#' notation). The macroexpansion would be something to the effect of (add-hook monster method who what) ,@body (remove-hook monster method who) I have absolutely no idea how to write such a macro, and I would appreciate some help.

    Read the article

  • Actionscript - Adding EventListener to multiple buttons on stage

    - by Chev
    I have a little problem with adding EventListener to multiple objects on stage. I have above 40 buttons on stage named "Button01","Button02" .. "Button40", and i'm looking for easiest way to add EventListener to all of them. Creating something like Button01.addEventListener(MouseEvent.CLICK, doSomething) Button02.addEventListener(MouseEvent.CLICK, doSomething) .. Button40.addEventListener(MouseEvent.Click, doSomething) (Notice the same function). isn't solution i'm looking for :(. Thanks in advice.

    Read the article

  • jQuery Validation Custom Message Before Listing Errors

    - by Michael
    I am looking to add a custom message before listing my errors for a login page: "Oops, you forgot to enter the following:" + "Username", "Password" (if both not entered) or "Oops, you forgot to enter the following:" + "Username" (if just username not entered) $(document).ready(function(){ $("#loginForm").validate({ errorLabelContainer: $('#RegisterErrors'), messages: { username: "Username", password: "Password" } }); }); With this in my HTML <div id="RegisterErrors">

    Read the article

  • Multiple click events

    - by Le_Coeur
    I have some popup dialogs on my webpage, in each of this dialogs i have defined some click event with jquery : $(".links_view").click(function(e){ //code }); But the problem is when i activate one this click event, it will be executed in each dialog...

    Read the article

  • Should a g_object_new have a matching g_object_unref?

    - by legends2k
    I'm using libnotify to show desktop notifications in my application; notify_notification_new() returns a NotifyNotification*, which should be passed as the first param to further function calls of the notification library. There is no notify_notification_free() which frees the pointer it returns. I looked up the source of notify_notification_new() and internally it does a g_object_new(), gets a GObject* and returns it as a NotfiyNotification*, so when my application does the clean up, should I call a g_object_unref() on the pointer returned by notify_notification_new()?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 952 953 954 955 956 957 958 959 960 961 962 963  | Next Page >