Search Results

Search found 25503 results on 1021 pages for 'browser security'.

Page 970/1021 | < Previous Page | 966 967 968 969 970 971 972 973 974 975 976 977  | Next Page >

• Mac Safari randomly recreating cookie when I refresh my login screen. Very bizarre

  - by mcintyre321

  We have found an issue in our app where Safari on the Mac randomly recreates a login cookie from a logged off session. I have a fiddler archive with this behaviour here. Note that some stuff has been removed from this to make it easier to get, but nothing which sets a cookie or anything has been taken out - only repetitions of requests 3-8. I'll talk you through the running order Request 1: user logs out via call to /logout.aspx - Set-Cookie returned setting cookie expiry date to 1999 Requests 2-8: user refreshes login page sending calls to root or /res/en-US/s.js - no cookie is sent to server or received back, and access is denied. I have cut out a lot of requests of this nature from the log as they are boring Request 9: request for /res/en-US/s.js - Hv3 authentication cookie has mysteriously reappeared! Wat. There was NO set-cookie! WTFF! Request 10+ : now the cookie has reappeared, the site logs the user in AGAIN The cookie, when examined in Safari looks like <dict> <key>Created</key> <real>259603523.26834899</real> <key>Domain</key> <string>.mysite.dev</string> <key>Expires</key> <date>2010-03-24T16:05:22Z</date> <key>HttpOnly</key> <string>TRUE</string> <key>Name</key> <string>.Hv3</string> <key>Path</key> <string>/</string> </dict> One thing to note is that in Safari, the cookie domain is .mysite.dev not mysite.dev (which is the cookie domain specified in web.config) - however, given that access is denied in requests 2-8, it looks like the cookie has expired OK. If you look in the list of cookies in the browser during 2-8, the .Hv3 cookie is not there. Is this our bug or Safari's? What can I do to stop it happening?

  Read the article

• Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

  - by gWiz

  I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

  Read the article

• Problems with creating and using of delegate-protocols

  - by Flocked

  Hello, I have the problem that I have created a delegate protocol, but the necessary methods are not executed, although I have implemented the protocol in my header file. Here are the detailed explanation: I created an instance of my ViewController (TimeLineViewController), which will be displayed. This ViewController contains a UITableView, which in turn receives the individual Cells / Rows from one instance of my TableViewCell. So the ViewController creates an instance of TableCellView. The TableViewCell contains a UITextView, which contains web links. Now I want, that not safari opens the links, but my own built-in browser. Unfortunately TableViewCell can not open a new ViewController with a WebView, so I decided to create a delegate protocol. The whole thing looks like this: WebViewTableCellDelegate.h: @protocol WebViewTableCellDelegate -(void)loadWeb; @end Then I created a instance WebViewDelegate in the TableViewCell: id <WebViewTableCellDelegate> _delegate; In the .m of the TableViewCell: @interface UITextView (Override) @end @class WebView, WebFrame; @protocol WebPolicyDecisionListener; @implementation UITextView (Override) - (void)webView:(WebView *)webView decidePolicyForNavigationAction:(NSDictionary *)actionInformation request:(NSURLRequest *)request frame:(WebFrame *)frame decisionListener:(id < WebPolicyDecisionListener >)listener { NSLog(@"request: %@", request); [_delegate loadWeb]; } @end - (void)setDelegate:(id <WebViewTableCellDelegate>)delegate{ _delegate = delegate;} And in my TimeLineViewController I implemented the protocol with < and the loadWeb-metode: - (void)loadWeb{ WebViewController *web = [[WebViewController alloc] initWithNibName:nil bundle:nil]; web.modalTransitionStyle = UIModalTransitionStyleFlipHorizontal; [self presentModalViewController: web animated:YES]; [web release]; } And when the instance of the TableViewCell will be created in the TimelineViewController: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *MyIdentifier = @"MyIdentifier"; MyIdentifier = @"tableCell"; TableViewCell *cell = (TableViewCell *)[tableView dequeueReusableCellWithIdentifier:MyIdentifier]; if(cell == nil) { [[NSBundle mainBundle] loadNibNamed:@"TableViewCell" owner:self options:nil]; cell = tableCell;} [cell setDelegate:self]; //… } It is the first time I created a own delegate-protocol, so maybe there are stupid mistakes. Also I´m learnung Objective-C and programming generally only for 4 weeks. Thanks for your help! EDIT: I think i found the problem, but I dont know how to resolve it. I try to use [_delegate loadWeb]; in the subclass of the UITextView (because that is the only way i can react on the weblinks) and the subclass can´t use [_delegate loadWeb];. I tried this in a other methode and it worked.

  Read the article

• Intent filter for browsing XML (specifically rss) in android

  - by Leif Andersen

  I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

  Read the article

• Ideas on implementing threads and cross process communication. - C

  - by Jamie Keeling

  Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occured. I have already implemented a thread on the first process which currently creates the data to send to the second process and makes it available to the second process. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Rolling the dice and sending the data: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'd like to think I am at least on the right lines, although for some reason when the application finishes creating the thread it hits the return DefWindowProc(hMainWindow, message, wParam, lParam); it crashes saying there's no more source code for the current location. I know there are certain ways to implement things but as I've mentioned I'm not sure if i'm doing this the right way, has anybody else tried to do the same thing? Thanks!

  Read the article

• Makefile issue with compiling a C++ program

  - by Steve

  I recently got MySQL compiled and working on Cygwin, and got a simple test example from online to verify that it worked. The test example compiled and ran successfully. However, when incorporating MySQL in a hobby project of mine it isn't compiling which I believe is due to how the Makefile is setup, I have no experience with Makefiles and after reading tutorials about them, I have a better grasp but still can't get it working correctly. When I try and compile my hobby project I recieve errors such as: Obj/Database.o:Database.cpp:(.text+0x492): undefined reference to `_mysql_insert_id' Obj/Database.o:Database.cpp:(.text+0x4c1): undefined reference to `_mysql_affected_rows' collect2: ld returned 1 exit status make[1]: *** [build] Error 1 make: *** [all] Error 2 Here is my Makefile, it worked with compiling and building the source before I attempted to put in MySQL support into the project. The LIBMYSQL paths are correct, verified by 'mysql_config'. COMPILER = g++ WARNING1 = -Wall -Werror -Wformat-security -Winline -Wshadow -Wpointer-arith WARNING2 = -Wcast-align -Wcast-qual -Wredundant-decls LIBMYSQL = -I/usr/local/include/mysql -L/usr/local/lib/mysql -lmysqlclient DEBUGGER = -g3 OPTIMISE = -O C_FLAGS = $(OPTIMISE) $(DEBUGGER) $(WARNING1) $(WARNING2) -export-dynamic $(LIBMYSQL) L_FLAGS = -lz -lm -lpthread -lcrypt $(LIBMYSQL) OBJ_DIR = Obj/ SRC_DIR = Source/ MUD_EXE = project MUD_DIR = TestP/ LOG_DIR = $(MUD_DIR)Files/Logs/ ECHOCMD = echo -e L_GREEN = \e[1;32m L_WHITE = \e[1;37m L_BLUE = \e[1;34m L_RED = \e[1;31m L_NRM = \e[0;00m DATE = `date +%d-%m-%Y` FILES = $(wildcard $(SRC_DIR)*.cpp) C_FILES = $(sort $(FILES)) O_FILES = $(patsubst $(SRC_DIR)%.cpp, $(OBJ_DIR)%.o, $(C_FILES)) all: @$(ECHOCMD) " Compiling $(L_RED)$(MUD_EXE)$(L_NRM)."; @$(MAKE) -s build build: $(O_FILES) @rm -f $(MUD_EXE) $(COMPILER) -o $(MUD_EXE) $(L_FLAGS) $(O_FILES) @echo " Finished Compiling $(MUD_EXE)."; @chmod g+w $(MUD_EXE) @chmod a+x $(MUD_EXE) @chmod g+w $(O_FILES) $(OBJ_DIR)%.o: $(SRC_DIR)%.cpp @echo " Compiling $@"; $(COMPILER) -c $(C_FLAGS) $< -o $@ .cpp.o: $(COMPILER) -c $(C_FLAGS) $< clean: @echo " Complete compile on $(MUD_EXE)."; @rm -f $(OBJ_DIR)*.o $(MUD_EXE) @$(MAKE) -s build I like the functionality of the Makefile, instead of spitting out all the arguments etc, it just spits out the "Compiling [Filename]" etc. If I add -c to the L_FLAGS then it compiles (I think) but instead spits out stuff like: g++: Obj/Database.o: linker input file unused because linking not done After a full day of trying and research on google, I'm no closer to solving my problem, so I come to you guys to see if you can explain to me why all this is happening and if possible, steps to solve. Regards, Steve

  Read the article

• Just a small problem regarding javscript BOM question

  - by caramel1991

  The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

  Read the article

• Using events in threads between processes - C

  - by Jamie Keeling

  Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Create thread: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'm trying to find out how I would integrate an event with the threaded code to signify to the other process that something has happened, I've seen an MSDN article on using events but it's just confused me if anything, I'm coming up on empty whilst searching on the internet too. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

  Read the article

• How do I pass the value of the previous form element into an "onchange" javascript function?

  - by Jen

  Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

  Read the article

• Simple RSA encryption (Java)

  - by jake blue

  This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

  Read the article

• How should I handle the case in which a username is already in use?

  - by idealmachine

  I'm a JavaScript programmer and new to PHP and MySQL (want to get into server-side coding). Because I'm trying to learn PHP by building a simple online game (more specifically, correspondence chess), I'm starting by implementing a simple user accounts system. Of course, user registration comes first. What are the best practices for: How I should handle the (likely) possibility that when a user tries to register, the username he has chosen is already in use, particularly when it comes to function return values?($result === true is rather ugly, and I'm not sure whether checking the MySQL error code is the best way to do it either) How to cleanly handle varying page titles?($gPageTitle = '...'; require_once 'bgsheader.php'; is also rather ugly) Anything else I'm doing wrong? In some ways, PHP is rather different from JavaScript... Here is a (rather large) excerpt of the code I have written so far. Note that this is a work in progress and is missing security checks that I will add as my next step. function addUser( $username, $password ) { global $gDB, $gPasswordSalt; $stmt = $gDB->prepare( 'INSERT INTO user(user_name, user_password, user_registration) VALUES(?, ?, NOW())' ); $stmt || trigger_error( 'Failed to prepare statement: ' . htmlspecialchars( $gDB->error ) ); $hashedPassword = hash_hmac( 'sha256', $password, $gPasswordSalt, true ); $stmt->bind_param( 'ss', $username, $hashedPassword ); if( $stmt->execute() ) { return true; } elseif( $stmt->errno == 1062) { return 'exists'; } else { trigger_error( 'Failed to execute statement: ' . htmlspecialchars( $stmt->error ) ); } } $username = $_REQUEST['username']; $password = $_REQUEST['password']; $result = addUser( $username, $password ); if( $result === true ) { $gPageTitle = 'Registration successful'; require_once 'bgsheader.php'; echo '<p>You have successfully registered as ' . htmlspecialchars( $username ) . ' on this site.</p>'; } elseif( $result == 'exists' ) { $gPageTitle = 'Username already taken'; require_once 'bgsheader.php'; echo '<p>Someone is already using the username you have chosen. Please try using another one instead.'; } else { trigger_error('This should never happen'); } require_once 'bgsfooter.php';

  Read the article

• Simple html page using Bootstrap

  - by Athashri

  I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

  Read the article

• JQuery $.ajax doesn't return anything, but only in Google Chrome!?

  - by Shawson

  Hi All, I'm hoping someone can help me with this as I'm at a loss. I'm trying to simply load a plain text file into a page at runtime using jquery- everything works fine in IE8 (8.0.7600.16385), Firefox 3.6.3, however in Google Chrome 5.0.375.55 the "data" comes back as nothing- i get an empty alert box. This is the code i'm using; <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>Animation Test</title> <script type="text/javascript" language="javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript" language="javascript"> $(document).ready(function () { $.ajax({ url: 'level1.txt', success: function (data) { alert(data); }, async: true, type: 'GET' }); }); </script> </head> <body> <canvas id="canvas" width="640" height="480"> Unsupported Browser </canvas> </body> </html> The file I'm loading in is a plain text file containing this; Central Cavern 100 O.........1.C....C...........1.O O................1.............O O..............................O O..............................O O......................B1..B...O O=============~~~~=~~~~========O O.............................1O O===...........................O O............A..OOO.B..........O O====...<<<<<<<<<<<<<<<<<<<<...O O............................==O O..............................O O..........B........OOO.....===O O....===============...........O O%............................XO O==============================O (Yes- it's the first level from Manic Miner! I'm making a javascript version using the html5 canvas to get my head around using it.) I'm at a total loss- it can't be the code because it runs in the other 2 browsers- is there an issue with jquery and this version of Chrome? Thanks for reading!! Shaw.

  Read the article

• session management: problem displaying username in the header

  - by aeonsleo

  hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

  Read the article

• FILE_NOT_FOUND when trying to open COM port C++

  - by Moutabreath

  I am trying to open a com port for reading and writing using C++ but I can't seem to pass the first stage of actually opening it. I get an INVALID_HANDLE_VALUE on the handle with GetLastError FILE_NOT_FOUND. I have searched around the web for a couple of days I'm fresh out of ideas. I have searched through all the questions regarding COM on this website too. I have scanned through the existing ports (or so I believe) to get the name of the port right. I also tried combinations of _T("COM1") with the slashes, without the slashes, with colon, without colon and without the _T I'm using windows 7 on 64 bit machine. this is the code i got I'll be glad for any input on this void SendToCom(char* data, int len) { DWORD cbNeeded = 0; DWORD dwPorts = 0; EnumPorts(NULL, 1, NULL, 0, &cbNeeded, &dwPorts); //What will be the return value BOOL bSuccess = FALSE; LPCSTR COM1 ; BYTE* pPorts = static_cast<BYTE*>(malloc(cbNeeded)); bSuccess = EnumPorts(NULL, 1, pPorts, cbNeeded, &cbNeeded, &dwPorts); if (bSuccess){ PORT_INFO_1* pPortInfo = reinterpret_cast<PORT_INFO_1*>(pPorts); for (DWORD i=0; i<dwPorts; i++) { //If it looks like "COMX" then size_t nLen = _tcslen(pPortInfo->pName); if (nLen > 3) { if ((_tcsnicmp(pPortInfo->pName, _T("COM"), 3) == 0) ){ COM1 =pPortInfo->pName; //COM1 ="\\\\.\\COM1"; HANDLE m_hCommPort = CreateFile( COM1 , GENERIC_READ|GENERIC_WRITE, // access ( read and write) 0, // (share) 0:cannot share the COM port NULL, // security (None) OPEN_EXISTING, // creation : open_existing FILE_FLAG_OVERLAPPED, // we want overlapped operation NULL // no templates file for COM port... ); if (m_hCommPort==INVALID_HANDLE_VALUE) { DWORD err = GetLastError(); if (err == ERROR_FILE_NOT_FOUND) { MessageBox(hWnd,"ERROR_FILE_NOT_FOUND",NULL,MB_ABORTRETRYIGNORE); } else if(err == ERROR_INVALID_NAME) { MessageBox(hWnd,"ERROR_INVALID_NAME",NULL,MB_ABORTRETRYIGNORE); } else { MessageBox(hWnd,"unkown error",NULL,MB_ABORTRETRYIGNORE); } } else{ WriteAndReadPort(m_hCommPort,data); } } pPortInfo++; } } } }

  Read the article

• jQuery UI dialog + WebKit + HTML response with script

  - by Anthony Koval'

  Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• error with redirect using listener JSF 2.0

  - by Ray

  I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

  Read the article

• Rails 3 Atom Feed

  - by scud bomb

  Trying to create an atom feed in Rails 3. When i refresh my browser i see basic XML, not the Atom feed im looking for. class PostsController < ApplicationController # GET /posts # GET /posts.xml def index @posts = Post.all respond_to do |format| format.html # index.html.erb format.xml { render :xml => @posts } format.atom end end index.atom.builder atom_feed do |feed| feed.title "twoconsortium feed" @posts.each do |post| feed.entry(post) do |entry| entry.title post.title entry.content post.text end end end localhost:3000/posts.atom looks like this: <?xml version="1.0" encoding="UTF-8"?> <feed xml:lang="en-US" xmlns="http://www.w3.org/2005/Atom"> <id>tag:localhost,2005:/posts</id> <link rel="alternate" type="text/html" href="http://localhost:3000"/> <link rel="self" type="application/atom+xml" href="http://localhost:3000/posts.atom"/> <title>my feed</title> <entry> <id>tag:localhost,2005:Post/1</id> <published>2012-03-27T18:26:13Z</published> <updated>2012-03-27T18:26:13Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/1"/> <title>First post</title> <content>good stuff</content> </entry> <entry> <id>tag:localhost,2005:Post/2</id> <published>2012-03-27T19:51:18Z</published> <updated>2012-03-27T19:51:18Z</updated> <link rel="alternate" type="text/html" href="http://localhost:3000/posts/2"/> <title>Second post</title> <content>its that second post type stuff</content> </entry> </feed>

  Read the article

• WebServices does not interact with App

  - by daemonfire300

  I got a Silverlight App with-in a Web Project Web Silverlight The web contains a service: [WebService(Namespace = "svChat")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. //[System.Web.Script.Services.ScriptService] public class GetIPService : System.Web.Services.WebService { public GetIPService () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string GetIp() { return HttpContext.Current.Request.ServerVariables["HTTP_X_FORWARDED_FOR"]; } } And I got a class in my Silverlight App using the Service: public class Client { private string ip; private string created; #region Properties public string Ip { get { return ip; } set { ip = value; } } public string Created { get { return created; } set { created = value; } } #endregion public Client() { } public void SetIp() { ServiceReference1.GetIPServiceSoapClient scIpClient = new svChat.ServiceReference1.GetIPServiceSoapClient(); scIpClient.GetIpCompleted += new EventHandler<svChat.ServiceReference1.GetIpCompletedEventArgs>(IpService_Completed); scIpClient.GetIpAsync(); } private void IpService_Completed(object sender, ServiceReference1.GetIpCompletedEventArgs e) { this.ip = e.Result; } } After Client is created, SetIp() is called, and Client.Ip is added to a text box. Nothing happens. Ip = null. Service itselfs works, tested it. Getting Ip by the above code works. Gettings Ip via service through Silverlight App does not work. <configuration> <system.serviceModel> <bindings> <basicHttpBinding> <binding name="GetIPServiceSoap" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <security mode="None" /> </binding> </basicHttpBinding> </bindings> <client> <endpoint address="http://localhost:2090/svChat.Web/GetIPService.asmx" binding="basicHttpBinding" bindingConfiguration="GetIPServiceSoap" contract="ServiceReference1.GetIPServiceSoap" name="GetIPServiceSoap" /> </client> </system.serviceModel> </configuration> Any ideas? regards,

  Read the article

• How to Fix my jQuery code in IE?? Works in Firefox..

  - by scott jarvis

  I am using jQuery to show/hide a div container (#pluginOptionsContainer), and load a page (./plugin_options.php) inside it with the required POST vars sent. What POST data is sent is based on the value of a select list (#pluginDD) and the click of a button (#pluginOptionsBtn)... It works fine in Firefox, but doesn't work in IE.. The '$("#pluginOptionsContainer").load()' request never seems to finish in IE - I only see the loading message forever... bind(), empty() and append() all seem to work fine in IE.. But not load().. Here is my code: // wait for the DOM to be loaded $(document).ready(function() { // hide the plugin options $('#pluginOptionsContainer').hide(); // This is the hack for IE if ($.browser.msie) { $("#pluginDD").click(function() { this.blur(); this.focus(); }); } // set the main function $(function() { // the button shows hides the plugin options page (and its container) $("#pluginOptionsBtn") .click(function() { // show the container of the plugin options page $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); $('#pluginOptionsContainer').toggle(); }); // set the loading message if user changes selection with either the dropdown or button $("#pluginDD,#pluginOptionsBtn").bind('change', function() { $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); }); // then update the page when the plugin is changed when EITHER the plugin button or dropdown or clicked or changed $("#pluginDD,#pluginOptionsBtn").bind('change click', function() { // set form fields as vars in js var pid = <?=$pid;?>; var cid = <?=$contentid;?>; var pDD = $("#pluginDD").val(); // add post vars (must use JSON) to be sent into the js var 'dataString' var dataString = {plugin_options: true, pageid: pid, contentid: cid, pluginDD: pDD }; // include the plugin option page inside the container, with the required values already added into the query string $("#pluginOptionsContainer").load("/admin/inc/edit/content/plugin_options.php#pluginTop", dataString); // add this to stop page refresh return false; }); // end submit function }); // end main function }); // on DOM load Any help would be GREATLY appreciated! I hate IE!

  Read the article

• JSON datetime to SQL Server database via WCF

  - by moikey

  I have noticed a problem over the past couple of days where my dates submitted to an sql server database are wrong. I have a webpage, where users can book facilities. This webpage takes a name, a date, a start time and an end time(BookingID is required for transactions but generated by database), which I format as a JSON string as follows: {"BookingEnd":"\/Date(2012-26-03 09:00:00.000)\/","BookingID":1,"BookingName":"client test 1","BookingStart":"\/Date(2012-26-03 10:00:00.000)\/","RoomID":4} This is then passed to a WCF service, which handles the database insert as follows: [WebInvoke(Method = "POST", RequestFormat = WebMessageFormat.Json, UriTemplate = "createbooking")] void CreateBooking(Booking booking); [DataContract] public class Booking { [DataMember] public int BookingID { get; set; } [DataMember] public string BookingName { get; set; } [DataMember] public DateTime BookingStart { get; set; } [DataMember] public DateTime BookingEnd { get; set; } [DataMember] public int RoomID { get; set; } } Booking.svc public void CreateBooking(Booking booking) { BookingEntity bookingEntity = new BookingEntity() { BookingName = booking.BookingName, BookingStart = booking.BookingStart, BookingEnd = booking.BookingEnd, RoomID = booking.RoomID }; BookingsModel model = new BookingsModel(); model.CreateBooking(bookingEntity); } Booking Model: public void CreateBooking(BookingEntity booking) { using (var conn = new SqlConnection("Data Source=cpm;Initial Catalog=BookingDB;Integrated Security=True")) using (var cmd = conn.CreateCommand()) { conn.Open(); cmd.CommandText = @"IF NOT EXISTS ( SELECT * FROM Bookings WHERE BookingStart = @BookingStart AND BookingEnd = @BookingEnd AND RoomID= @RoomID ) INSERT INTO Bookings ( BookingName, BookingStart, BookingEnd, RoomID ) VALUES ( @BookingName, @BookingStart, @BookingEnd, @RoomID )"; cmd.Parameters.AddWithValue("@BookingName", booking.BookingName); cmd.Parameters.AddWithValue("@BookingStart", booking.BookingStart); cmd.Parameters.AddWithValue("@BookingEnd", booking.BookingEnd); cmd.Parameters.AddWithValue("@RoomID", booking.RoomID); cmd.ExecuteNonQuery(); conn.Close(); } } This updates the database but the time ends up "1970-01-01 00:00:02.013" each time I submit the date in the above json format. However, when I do a query in SQL server management studio with the above date format ("YYYY-MM-DD HH:MM:SS.mmm"), it inserts the correct values. Also, if I submit a millisecond datetime to the wcf, the correct date is being inserted. The problem seems to be with the format I am submitting. I am a little lost with this problem. I don't really see why it is doing this. Any help would be greatly appreciated. Thanks.

  Read the article

• How to download file into string with progress callback?

  - by Kaminari

  I would like to use the WebClient (or there is another better option?) but there is a problem. I understand that opening up the stream takes some time and this can not be avoided. However, reading it takes a strangely much more amount of time compared to read it entirely immediately. Is there a best way to do this? I mean two ways, to string and to file. Progress is my own delegate and it's working good. FIFTH UPDATE: Finally, I managed to do it. In the meantime I checked out some solutions what made me realize that the problem lies elsewhere. I've tested custom WebResponse and WebRequest objects, library libCURL.NET and even Sockets. The difference in time was gzip compression. Compressed stream lenght was simply half the normal stream lenght and thus download time was less than 3 seconds with the browser. I put some code if someone will want to know how i solved this: (some headers are not needed) public static string DownloadString(string URL) { WebClient client = new WebClient(); client.Headers["User-Agent"] = "Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US) AppleWebKit/532.5 (KHTML, like Gecko) Chrome/4.1.249.1045 Safari/532.5"; client.Headers["Accept"] = "application/xml,application/xhtml+xml,text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; client.Headers["Accept-Encoding"] = "gzip,deflate,sdch"; client.Headers["Accept-Charset"] = "ISO-8859-2,utf-8;q=0.7,*;q=0.3"; Stream inputStream = client.OpenRead(new Uri(URL)); MemoryStream memoryStream = new MemoryStream(); const int size = 32 * 4096; byte[] buffer = new byte[size]; if (client.ResponseHeaders["Content-Encoding"] == "gzip") { inputStream = new GZipStream(inputStream, CompressionMode.Decompress); } int count = 0; do { count = inputStream.Read(buffer, 0, size); if (count > 0) { memoryStream.Write(buffer, 0, count); } } while (count > 0); string result = Encoding.Default.GetString(memoryStream.ToArray()); memoryStream.Close(); inputStream.Close(); return result; } I think that asyncro functions will be almost the same. But i will simply use another thread to fire this function. I dont need percise progress indication.

  Read the article

• WPF ClickOnce Bootstrap Dection Failure on One Machine

  - by Dexter Morgan

  Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

  Read the article

• Trouble passing a string as a SQLite ExecSQL command

  - by Hackbrew

  I keep getting the ERROR: near "PassWord": syntax error when trying to execute the ExecSQL() statement. The command looks good in the output of the text file. In fact, I copied & pasted the command directly into SQLite Database Browser and the commend executed properly. Here's the code that's producing the error: procedure TForm1.Button1Click(Sender: TObject); var i, iFieldSize: integer; sFieldName, sFieldType, sFieldList, sExecSQL: String; names: TStringList; f1: Textfile; begin //Open Source table - Table1 has 8 fields but has only two different field types ftString and Boolean Table1.TableName:= 'PWFile'; Table1.Open; //FDConnection1.ExecSQL('drop table PWFile'); sFieldList := ''; names := TStringList.Create; for i := 0 to Table1.FieldCount - 1 do begin sFieldName := Table1.FieldDefList.FieldDefs[i].Name; sFieldType := GetEnumName(TypeInfo(TFieldType),ord(Table1.FieldDefList.FieldDefs[i].DataType)); iFieldSize := Table1.FieldDefList.FieldDefs[i].Size; if sFieldType = 'ftString' then sFieldType := 'NVARCHAR' + '(' + IntToStr(iFieldSize) + ')'; if sFieldType = 'ftBoolean' then sFieldType := 'INTEGER'; names.Add(sFieldName + ' ' + sFieldType); if sFieldList = '' then sFieldList := sFieldName + ' ' + sFieldType else sFieldList := sFieldList + ', ' + sFieldName + ' ' + sFieldType; end; ListBox1.Items.Add(sFieldList); sExecSQL := 'create table IF NOT EXISTS PWFile (' + sFieldList + ')'; // 08/18/2014 - Entered this to log the SQLite FDConnection1.ExecSQL Command to a file AssignFile(f1, 'C:\Users\Test User\Documents\SQLite_Command.txt'); Rewrite(f1); Writeln(f1, sExecSQL); { insert code here that would require a Flush before closing the file } Flush(f1); { ensures that the text was actually written to file } CloseFile(f1); FDConnection1.ExecSQL(sFieldList); Table1.Close; end; Here's the actual command that gets executed: create table IF NOT EXISTS PWFile (PassWord NVARCHAR(10), PassName NVARCHAR(10), Dept NVARCHAR(10), Active NVARCHAR(1), Admin INTEGER, Shred INTEGER, Reports INTEGER, Maintain INTEGER)

  Read the article

< Previous Page | 966 967 968 969 970 971 972 973 974 975 976 977  | Next Page >