Search Results

Search found 21885 results on 876 pages for 'radix point'.

Page 99/876 | < Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • Multiple marker icons, how to add to google mashup

    - by user351189
    I have created a Google maps mashup, where with a bit of input, I have managed to have a sidebar that links to a video icon/marker that then opens up an info window showing virtual tours. I would, however, like to put different coloured marker icons on the map depending on the category that the video is in. This would be easy enough to do, but my page is made up of a mixture of J-Query and JavaScript all calling to the individual flash files. Could someone help me with the code for adding extra marker icons for different categories? Here is the code: So, after the intial 'var camera;' point, there comes this: function addMarker(point, title, video, details) { var marker = new GMarker(point, {title: title, icon:camera}); GEvent.addListener(marker, "click", function() { if (details) { marker.openInfoWindowTabsHtml([new GInfoWindowTab("Video", video), new GInfoWindowTab("More", details)]); } else { marker.openInfoWindowHtml(video); } }); Then further down, is the code for calling the individual marker image. I would like to add another image to this list - would I start out by calling the new object 'camera-red.image' or something similar? function initialize() { if (GBrowserIsCompatible()) { map = new GMap2(document.getElementById("mapDiv")); map.setCenter(new GLatLng(51.52484592590448, -0.13345599174499512), 17); map.setUIToDefault(); var uclvtSatMapType = createUclVTSatMapType() map.addMapType(uclvtSatMapType); map.setMapType(uclvtSatMapType); camera = new GIcon(G_DEFAULT_ICON); camera.image = "ucl-video.png"; camera.iconSize = new GSize(32,37); camera.iconAnchor = new GPoint(16,35); camera.infoWindowAnchor = new GPoint(16,2); addMarkersToMap(); } The actual map can be found here: link text Thanks.

    Read the article

  • Silverlight horizontal stretch and get position issue

    - by David
    I have a Grid (container) wich in turn has several grids(subContainers) arranged by rows. Each one of those "subContainers" has diferent columns and controls. And each of those "subContainers" has the horizontal alignment set to stretch, and it has to stay that way, since the layout this viewer depends on it. I use the "container" to set each control on it's adequate position. So far so good. Now comes my headache... I want to remove the control from the grid and put it in a canvas, at the same exact position, only, the position it returns is as if the control is set to the beggining of the grid and not it's true position. For testing purposes, I've set the "subContainters" horizontal alignment to center and (despite the layout is totally wrong) every control is in it's right position when sent to a canvas, wich it doesn't happen when HA = stretch. Here's the code I'm using to get position: GeneralTransform gt = nc.TransformToVisual(gridZoom); Point offset = gt.Transform(new Point()); So you can understand, for example, my first control should be somewhere like (80, 1090), but the point that I get is (3,3). Can anyone help me? Thanks

    Read the article

  • RPC command to initiate a software install

    - by ericmayo
    I was recently working with a product from Symantech called Norton EndPoint protection. It consists of a server console application and a deployment application and I would like to incorporate their deployment method into a future version of one of my products. The deployment application allows you to select computer workstations running Win2K, WinXP, or Win7. The selection of workstations is provided from either AD (Active Directory) or NT Domain (WINs/DNS NetBIOS lookup). From the list, one can click and choose which workstations to deploy the end point software which is Symantech's virus & spyware protection suite. Then, after selecting which workstations should receive the package, the software copies the setup.exe program to each workstation (presumable over the administrative share \pcname\c$) and then commands the workstation to execute setup.exe resulting in the workstation installing the software. I really like how their product works but not sure what they are doing to accomplish all the steps. I've not done any deep investigations into this such as sniffing the network, etc... and wanted to check here to see if anyone is familiar with what I'm talking about and if you know how it's accomplished or have ideas how it could be accomplished. My thinking is that they are using the admin share to copy the software to the selected workstations and then issuing an RPC call to command the workstation to do the install. What's interesting is that the workstations do this without any of the logged in users knowing what's going on until the very end where a reboot is necessary. At which point, the user gets a pop-up asking to reboot now or later, etc... My hunch is that the setup.exe program is popping this message. To the point: I'm looking to find out the mechanism by which one Windows based machine can tell another to do some action or run some program. My programming language is C/C++ Any thoughts/suggestions appreciated.

    Read the article

  • Turn image in google maps V3?

    - by Ilrodri
    Hi, I need help with JavaScript in google map v3 I have an image and I need to be able to turn it. That works, but the real problem it's that I cant afect an marker cause I don't know how to call it and modify this marker. I show you a part of the code: Marker: sURL = 'http://www.sl2o.com/tc/picture/Fleche.PNG'; iWidth = 97; iHeight = 100; mImage = new google.maps.MarkerImage(sURL, new google.maps.Size(iWidth,iHeight), new google.maps.Point(0,0), new google.maps.Point(Math.round(iWidth/2),Math.round(iHeight/2))); var oMarker = new google.maps.Marker({ 'position': new google.maps.LatLng(iStartLat,iStartLon), 'map': map, 'title': 'mon point', 'icon': mImage }); Then I have this : onload=function(){ rotate.call(document.getElementById('im'),50); } </script> <img id="im" src="http://www.sl2o.com/tc/picture/Fleche.PNG" width="97" height="100" /> So here is it. As you can see, I'm afecting this image and I in fact I need to afect the marker. How can I do it ? Please I need this I'been working in it since hours and hours. Thank you !!

    Read the article

  • Optimize a views drawing code

    - by xon1c
    Hi, in a simple drawing application I have a model which has a NSMutableArray curvedPaths holding all the lines the user has drawn. A line itself is also a NSMutableArray, containing the point objects. As I draw curved NSBezier paths, my point array has the following structure: linePoint, controlPoint, controlPoint, linePoint, controlPoint, controlPoint, etc... I thought having one array holding all the points plus control points would be more efficient than dealing with 2 or 3 different arrays. Obviously my view draws the paths it gets from the model, which leads to the actual question: Is there a way to optimize the following code (inside the view's drawRect method) in terms of speed? int lineCount = [[model curvedPaths] count]; // Go through paths for (int i=0; i < lineCount; i++) { // Get the Color NSColor *theColor = [model getColorOfPath:[[model curvedPaths] objectAtIndex:i]]; // Get the points NSArray *thePoints = [model getPointsOfPath:[[model curvedPaths] objectAtIndex:i]]; // Create a new path for performance reasons NSBezierPath *path = [[NSBezierPath alloc] init]; // Set the color [theColor set]; // Move to first point without drawing [path moveToPoint:[[thePoints objectAtIndex:0] myNSPoint]]; int pointCount = [thePoints count] - 3; // Go through points for (int j=0; j < pointCount; j+=3) { [path curveToPoint:[[thePoints objectAtIndex:j+3] myNSPoint] controlPoint1:[[thePoints objectAtIndex:j+1] myNSPoint] controlPoint2:[[thePoints objectAtIndex:j+2] myNSPoint]]; } // Draw the path [path stroke]; // Bye stuff [path release]; [theColor release]; } Thanks, xonic

    Read the article

  • Undefined javascript function?

    - by user74283
    Working on a google maps project and stuck on what seems to be a minor issue. When i call displayMarkers function firebug returns: ReferenceError: displayMarkers is not defined [Break On This Error] displayMarkers(1); <script type="text/javascript"> function initialize() { var center = new google.maps.LatLng(25.7889689, -80.2264393); var map = new google.maps.Map(document.getElementById('map'), { zoom: 10, center: center, mapTypeId: google.maps.MapTypeId.ROADMAP }); //var data = [[25.924292, -80.124314], [26.140795, -80.3204049], [25.7662857, -80.194692]] var data = {"crs": {"type": "link", "properties": {"href": "http://spatialreference.org/ref/epsg/4326/", "type": "proj4"}}, "type": "FeatureCollection", "features": [{"geometry": {"type": "Point", "coordinates": [25.924292, -80.124314]}, "type": "Feature", "properties": {"industry": [2], "description": "hosp", "title": "shaytac hosp2"}, "id": 35}, {"geometry": {"type": "Point", "coordinates": [26.140795, -80.3204049]}, "type": "Feature", "properties": {"industry": [1, 2], "description": "retail", "title": "shaytac retail"}, "id": 48}, {"geometry": {"type": "Point", "coordinates": [25.7662857, -80.194692]}, "type": "Feature", "properties": {"industry": [2], "description": "hosp2", "title": "shaytac hosp3"}, "id": 36}]} var markers = []; for (var i = 0; i < data.features.length; i++) { var latLng = new google.maps.LatLng(data.features[i].geometry.coordinates[0], data.features[i].geometry.coordinates[1]); var marker = new google.maps.Marker({ position: latLng, title: console.log(data.features[i].properties.industry[0]), map: map }); marker.category = data.features[i].properties.industry[0]; marker.setVisible(true); markers.push(marker); } function displayMarkers(category) { var i; for (i = 0; i < markers.length; i++) { if (markers[i].category === category) { markers[i].setVisible(true); } else { markers[i].setVisible(false); } } } } google.maps.event.addDomListener(window, 'load', initialize); </script> <div id="map-container"> <div id="map"></div> </div> <input type="button" value="Retail" onclick="displayMarkers(1);">

    Read the article

  • How to define 2-bit numbers in C, if possible?

    - by Eddy
    For my university process I'm simulating a process called random sequential adsorption. One of the things I have to do involves randomly depositing squares (which cannot overlap) onto a lattice until there is no more room left, repeating the process several times in order to find the average 'jamming' coverage %. Basically I'm performing operations on a large array of integers, of which 3 possible values exist: 0, 1 and 2. The sites marked with '0' are empty, the sites marked with '1' are full. Initially the array is defined like this: int i, j; int n = 1000000000; int array[n][n]; for(j = 0; j < n; j++) { for(i = 0; i < n; i++) { array[i][j] = 0; } } Say I want to deposit 5*5 squares randomly on the array (that cannot overlap), so that the squares are represented by '1's. This would be done by choosing the x and y coordinates randomly and then creating a 5*5 square of '1's with the topleft point of the square starting at that point. I would then mark sites near the square as '2's. These represent the sites that are unavailable since depositing a square at those sites would cause it to overlap an existing square. This process would continue until there is no more room left to deposit squares on the array (basically, no more '0's left on the array) Anyway, to the point. I would like to make this process as efficient as possible, by using bitwise operations. This would be easy if I didn't have to mark sites near the squares. I was wondering whether creating a 2-bit number would be possible, so that I can account for the sites marked with '2'. Sorry if this sounds really complicated, I just wanted to explain why I want to do this.

    Read the article

  • Determine if a Range contains a value

    - by Brad Dwyer
    I'm trying to figure out a way to determine if a value falls within a Range in Swift. Basically what I'm trying to do is adapt one of the examples switch statement examples to do something like this: let point = (1, -1) switch point { case let (x, y) where (0..5).contains(x): println("(\(x), \(y)) has an x val between 0 and 5.") default: println("This point has an x val outside 0 and 5.") } As far as I can tell, there isn't any built in way to do what my imaginary .contains method above does. So I tried to extend the Range class. I ended up running into issues with generics though. I can't extend Range<Int> so I had to try to extend Range itself. The closest I got was this but it doesn't work since >= and <= aren't defined for ForwardIndex extension Range { func contains(val:ForwardIndex) -> Bool { return val >= self.startIndex && val <= self.endIndex } } How would I go about adding a .contains method to Range? Or is there a better way to determine whether a value falls within a range? Edit2: This seems to work to extend Range extension Range { func contains(val:T) -> Bool { for x in self { if(x == val) { return true } } return false } } var a = 0..5 a.contains(3) // true a.contains(6) // false a.contains(-5) // false I am very interested in the ~= operator mentioned below though; looking into that now.

    Read the article

  • Is this feasbile with GIS?

    - by Gnu Engineer
    I'm just getting myself to familiarize with GIS but i like to know before hand if the following is feasible with current GIS apps/tools... I get the point for an address by geocoding. Easy part. Now if the point falls within a boundary (may be a city/county/state) then i need to get the data (any id/flag) associated with the boundary. Based on the id/flag i then apply some business logic. My question is... How do i define the boundary? What tools should i use for it? How can i store the boundary definition in database in order to check if the point falls within it? This has to be done in the back end and not in visual maps as we don't intend to show/use maps. How do i associate my custom data (id/flag) with the above boundary definition? Hope i'm having right assumption on capabilities of GIS. Most of examples what i see is around people trying to show maps with data which is exactly not what i'm looking for. Also please suggest me some tools/books on this.

    Read the article

  • Evaluate an expression tree

    - by Phronima
    Hi, This project that I'm working on requires that an expression tree be constructed from a string of single digit operands and operators both represented as type char. I did the implmentation and the program up to that point works fine. I'm able to print out the inorder, preorder and postorder traversals in the correct way. The last part calls for evaulating the expression tree. The parameters are an expression tree "t" and its root "root". The expression tree is ((3+2)+(6+2)) which is equal to 13. Instead I get 11 as the answer. Clearly I'm missing something here and I've done everything short of bashing my head against the desk. I would greatly appreciate it if someone can point me in the right direction. (Note that at this point I'm only testing addition and will add in the other operators when I get this method working.) public int evalExpression( LinkedBinaryTree t, BTNode root ) { if( t.isInternal( root ) ) { int x = 0, y = 0, value = 0; char operator = root.element(); if( root.getLeft() != null ) x = evalExpression(t, t.left( root ) ); if( root.getRight() != null ) y = evalExpression(t, t.right( root ) ); if( operator == '+' ) { value = value + Character.getNumericValue(x) + Character.getNumericValue(y); } return value; } else { return root.element(); } }

    Read the article

  • Google maps and J-Query: Individual markers?

    - by user351189
    Hi there, I have created a Google maps mashup, where with a bit of input, I have managed to have a sidebar that links to a video icon/marker that then opens up an info window showing virtual tours. I would, however, like to put different coloured marker icons on the map depending on the category that the video is in. This would be easy enough to do, but my page is made up of a mixture of J-Query and JavaScript all calling to the individual flash files. Could someone help me with the code for adding extra marker icons for different categories? Here is the code: So, after the intial 'var camera;' point, there comes this: function addMarker(point, title, video, details) { var marker = new GMarker(point, {title: title, icon:camera}); GEvent.addListener(marker, "click", function() { if (details) { marker.openInfoWindowTabsHtml([new GInfoWindowTab("Video", video), new GInfoWindowTab("More", details)]); } else { marker.openInfoWindowHtml(video); } }); Then further down, is the code for calling the individual marker image. I would like to add another image to this list - would I start out by calling the new object 'camera-red.image' or something similar? function initialize() { if (GBrowserIsCompatible()) { map = new GMap2(document.getElementById("mapDiv")); map.setCenter(new GLatLng(51.52484592590448, -0.13345599174499512), 17); map.setUIToDefault(); var uclvtSatMapType = createUclVTSatMapType() map.addMapType(uclvtSatMapType); map.setMapType(uclvtSatMapType); camera = new GIcon(G_DEFAULT_ICON); camera.image = "ucl-video.png"; camera.iconSize = new GSize(32,37); camera.iconAnchor = new GPoint(16,35); camera.infoWindowAnchor = new GPoint(16,2); addMarkersToMap(); } The actual map can be found here: link text Thanks. Gray

    Read the article

  • On counting pairs of words that differ by one letter

    - by Quintofron
    Let us consider n words, each of length k. Those words consist of letters over an alphabet (whose cardinality is n) with defined order. The task is to derive an O(nk) algorithm to count the number of pairs of words that differ by one position (no matter which one exactly, as long as it's only a single position). For instance, in the following set of words (n = 5, k = 4): abcd, abdd, adcb, adcd, aecd there are 5 such pairs: (abcd, abdd), (abcd, adcd), (abcd, aecd), (adcb, adcd), (adcd, aecd). So far I've managed to find an algorithm that solves a slightly easier problem: counting the number of pairs of words that differ by one GIVEN position (i-th). In order to do this I swap the letter at the ith position with the last letter within each word, perform a Radix sort (ignoring the last position in each word - formerly the ith position), linearly detect words whose letters at the first 1 to k-1 positions are the same, eventually count the number of occurrences of each letter at the last (originally ith) position within each set of duplicates and calculate the desired pairs (the last part is simple). However, the algorithm above doesn't seem to be applicable to the main problem (under the O(nk) constraint) - at least not without some modifications. Any idea how to solve this?

    Read the article

  • Vertical line on HxW canvas of pixels

    - by bobby williams
    I searched and found nothing. I'm trying to draw lines (simple y=mx+b ones) on a canvas of black pixels. It works fine, but no line occurs when it is vertical. I'm not sure why. My first if statement checks if the denominator is zero, therefore m is undefined and no need for a line equation. My second and third if statement check how steep it is and based on that, calculate the points in between. I don't think there is a need for other classes, since I think there is a bug in my code or I'm just not translating the mathematics into code properly. If more is needed, I'll be happy to post more. /** * Returns an collection of points that connects p1 and p2 */ public ArrayList getPoints() { ArrayList points = new ArrayList(); // checks to see if denominator in m is zero. if zero, undefined. if ((p2.getX() - p1.getX()) == 0) { for (int y = p1.getY(); y<p2.getY(); y++) { points.add(new Point(p1.getX(), y, getColor())); } } double m = (double)(p2.getY()-p1.getY())/(double)(p2.getX()-p1.getX()); int b = (int)(p1.getY() - (m * p1.getX())); // checks to see if slope is steep. if (m > -1 || m < 1) { for (int x = p1.getX(); x<p2.getX(); x++) { int y = (int) ((m*x)+b); points.add(new Point(x, y, getColor())); } } // checks to see if slope is not steep. if (m <= -1 || m >= 1) { for (int y = p1.getY(); y<p2.getY(); y++) { int x = (int) ((y-b)/m); points.add(new Point(x, y, getColor())); } } return points; }

    Read the article

  • Custom layout in Android: scrollable graphic with selectable elements over top

    - by Martyn
    Hi, I'm fairly new to the Android platform and was wondering if I could get some advice for my current head scratcher: I'm making an app which in one view will need an image, which can be scrolled on one axis, with a load of selectable points over the top of it. Each point needs to be positionable on the x and y (unlikely to change once the app is running, but I'll need to fine tune the positions whilst I'm developing it). I'd like to be able to let the user select each point and have a graphic drawn on the point the user has selected or just draw a graphic on one/more points without user intervention. I though for the selectable points I could extend the checkbox with a custom image for the selected state - does that sounds right, or is there a better way of doing this? Is there any thing I can read up on doing this, I can't seem to find anything on the net about replacing the default images? I was going to use the absolute layout, but see that it's been depreciated and I can't find anything to replace it. Can anyone give me some code or advice on where to read up on what I need to do? Thank you in advance

    Read the article

  • Jquery (non-gem) plugin won't work in my rails 3.2 app

    - by jfdimark
    I'm trying to equalize columns in my rails 3.2 app, and while there may be a better way to do it then my current attempt, after hours of trying to make it work I'd like to see if anyone can point out specifically why this jQuery plugin (which isn't a gem) is not working. I'm not getting any errors in the developer console, so it's hard to pin point. Here's the relevant code: The index view, where I've followed the plugin's instructions: div id="column-group"> <div class="equalize span5 offset1 UserProfile"> <% if user_signed_in? %> <h3>Hello <%= current_user.name %>!</h3> </div> <div class="equalize span5 MemberDisplay"> My application.js file, where I've also included the specific js code, so it would definitely be picked up by the application: //= require jquery //= require jquery_ujs //= require bootstrap //= require equalize_column_heights //= require_tree . $(document).ready(function() { $("#column-group").equalize_column_heights("equalize"); }); The jQuery plugin code, which is saved in my vendor/assets/javascripts folder: (function ($) { $.fn.equalize_column_heights = function (equalize_class) { var tallest_column=0; parent_id = "column-group" + $(this).attr("id") + " ." + equalize_class; $(parent_id).each(function(index, value) { if (tallest_column < $(this).height()){ tallest_column = $(this).height(); } }); $(parent_id).each(function(index, value) { $(this).css({'min-height': tallest_column}); }); } }(jQuery)); I've read all the rails guides documentation on the asset pipeline and all the relevant jQuery-rails3 questions on SO, but after several hours, I just can't seem to figure this one out. If anyone can point to other tutorials on how to get non-gem jQuery plugins to work in a Rails 3.2 app then I'd be glad to take a look!

    Read the article

  • Failed to load url in Dom Document?

    - by Lakhan
    im trying to get latitude and longtitude from google map by giving address. But its giving error.when i directly copy url to browser url bar.its giving correct result.If anybody know the answer .Plz reply. Thanx in advance Here is my code. <?php $key = '[AIzaSyAoPgQlfKsBKQcBGB01cl8KmiPee3SmpU0]'; $opt = array ( 'address' => urlencode('Kolkata,India, ON') , 'output' => 'xml' ); $url = 'http://maps.google.com/maps/geo?q='.$opt['address'].'&output='.$opt['output'].'&oe=utf8&key='.$key; $dom = new DOMDocument(); $dom->load($url); $xpath = new DomXPath($dom); $xpath->registerNamespace('ge', 'http://earth.google.com/kml/2.0'); $statusCode = $xpath->query('//ge:Status/ge:code'); if ($statusCode->item(0)->nodeValue == '200') { $pointStr = $xpath->query('//ge:coordinates'); $point = explode(",", $pointStr->item(0)->nodeValue); $lat = $point[1]; $lon = $point[0]; echo '<pre>'; echo 'Lat: '.$lat.', Lon: '.$lon; echo '</pre>'; } ?> Following error has occured: Warning: DOMDocument::load(http://maps.google.com/maps/geo? q=Kolkata%252CIndia%252C%2BON&output=xml&oe=utf8&key=%5BAIzaSyAoPgQlfKsBKQcBGB01cl8KmiPee3SmpU0%5D) [domdocument.load]: failed to open stream: HTTP request failed! HTTP/1.0 400 Bad Request in C:\xampp\htdocs\draw\draw.php on line 19 Warning: DOMDocument::load() [domdocument.load]: I/O warning : failed to load external entity "http://maps.google.com/maps/geo?q=Kolkata%252CIndia%252C%2BON&output=xml&oe=utf8&key=%5BAIzaSyAoPgQlfKsBKQcBGB01cl8KmiPee3SmpU0%5D" in C:\xampp\htdocs\draw\draw.php on line 19 Notice: Trying to get property of non-object in C:\xampp\htdocs\draw\draw.php on line 26

    Read the article

  • WinForms Dynamic Label

    - by tolga
    I am creating dynamic labels and letting users change attributes of the labes like backcolor and so by sending unicode. However I don't know how to check if the label exists therefore I can't manipulate the dynamicly created label. below is my code: if ((InputBox.Text.StartsWith("p")) && (InputBox.Text.EndsWith("}")))// only process if the message starts with p and ends with } { string Message = InputBox.Text; InputBox.Text = "";// Clear the box when done. // Butt1 message line if (Message.StartsWith("plabelt1")) { if (Message.StartsWith("plabelt1_BackColor")) { Message = Message.Substring(19); //labelt1.BackColor = System.Drawing.Color.FromName(Message.Replace("}", "")); } } private void ImageBox_DragDrop(object sender, DragEventArgs e) { //Graphics g = ImageBox.CreateGraphics(); //g.DrawImage((Image)e.Data.GetData(DataFormats.Bitmap), //new Point(e.X - this.Left, e.Y - this.Top - 150)); Point p2 = PointToClient(Cursor.Position); Label buttlbl_ = new Label(); labelCount++; buttlbl_.Name = "labelt" + labelCount.ToString(); buttlbl_.Location = new Point(p2.X, p2.Y); buttlbl_.Size = new System.Drawing.Size(37, 37); buttlbl_.BackColor = System.Drawing.Color.DarkGray; this.Controls.Add(buttlbl_); buttlbl_.BringToFront(); ImageBox.Invalidate(); } } Any suggestions?

    Read the article

  • C++ reinterpret cast ?

    - by Ian
    I would like to cast one object of the class PointsList to another object Points3DList (and vice versa) where: template <class T> class PointsList { protected: std::vector <Point <T> *> points; //Only illustration, not possible with templaes }; and template <class T> class Points3DList { protected: std::vector <Point3D<T> *> points; //Only illustration, not possible with templaes }; Between Point and Point3D there is no relationship (inheritance nor composition)... template <class T> class Point { protected: T x; T y; }; template <class T> class Point3D { protected: T x; T y; T z; }; What do you think about conversion Points3DList <T> *pl3D = new Points3DList <T> (); ... PointsList <T> *pl = reinterpret_cast < PointList <T> * > ( pl3D ); where pl3D represents pointer to Points3DList object.. Can reinterpret_cast be used in this case or it is better to create a conversion function? Data model in this case can not be changed...

    Read the article

< Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >