Search Results

Search found 8886 results on 356 pages for 'parse tree'.

Page 110/356 | < Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • "Compiling" content with short tags to var, without eval()

    - by Spot
    To start off, let me clear the air by saying we are aware of the dis/advantages to using short tag syntax in PHP. That is not what this question is about. Is there a way to "include" a file containing short tag code, into a variable, and have PHP actually parse the code? include/require obviously do not provide the data in a workable form, and output buffering does not parse the short tag code because it happens at runtime. Using eval() is simply not an option. Suggestions?

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • DOM: how to import nodes and give them different namespace prefix

    - by thomasrutter
    I'm familiar with the DOMDocument::importNode method for importing a tree of nodes from some other document element. However, what I was wondering is if I can automatically change the namespace prefix on a tree of nodes as I import them, that is, specify a new prefix for all nodes of that namespace. Say the nodes, in their existing document, all have names like "name", "identity", and so on. When importing them into my new document they will be alongside other namespaces, so I'd like them to appear as "nicnames:name", "nicnames:identity" and so on. I'd like to be able to change this prefix programmatically so that in another context I may be able to import them as, for instance, "myprefix:name", "myprefix:identity" depending on the document they're imported into. Can anyone help me understand how to do this? Thanks

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • Reverse Breadth First traversal in C#

    - by Ngu Soon Hui
    Anyone has a ready implementation of the Reverse Breadth First traversal algorithm in C#? By Reverse Breadth First traversal , I mean instead of searching a tree starting from a common node, I want to search the tree from the bottom and gradually converged to a common node. Let's see the below figure, this is the output of a Breadth First traversal : In my reverse breadth first traversal , 9,10,11 and 12 will be the first few nodes found ( the order of them are not important as they are all first order). 5, 6, 7 and 8 are the second few nodes found, and so on. 1 would be the last node found. Any ideas or pointers? Edit: Change "Breadth First Search" to "Breadth First traversal" to clarify the question

    Read the article

  • Read binary data from a MDB-file running under LAMP

    - by BusterX
    I need to be able to connect to an MDB-file in a LAMP-environment (running on Linux) and ultimately insert converted data into a Mysql db. The data I need to access is stored as a BLOB (Long Binary Data according to Access) in the MDB file. I have not yet been able to actually have a look at the data but I have been told that the BLOB consists of byte strings. Something along the lines of: 0x1c 0x10 0x27 0x00 0x00 I need to parse the byte strings and convert these to a format that is human readable. I do have access to the documentation that explains the various byte strings. So this is really two questions: How do a get access to the MDB file via PHP* (running under LAMP) and read the BLOB (I do not have access to a Windows-platform)? What would be the best way to parse the binary data (in PHP*) once I am able to connect to the MDB-file? *Or are there other methods/languages that are more appropriate?

    Read the article

  • dijit.form.FilteringSelectinitial initial value always null.

    - by jiggs
    I'm using QueryReadStore as data and displaying the widget using the declarative way. My store looks like this: <div style="display:none" jsId="role_store" url="some/url/here" requestMethod="post" dojoType="dojox.data.QueryReadStore"></div> My widget is like this: <input dojoType="dijit.form.FilteringSelect" id="role_id" name="role_name" required="false" store="role_store" value="100" searchAttr="description"> Scenario: store is declared inside the HTML page. widget is loaded using parse.parse in the javascript. Issue: At first click no displayed value on the widget. But at the second click, values are displayed right.

    Read the article

  • What's the performance penalty of weak_ptr?

    - by Kornel Kisielewicz
    I'm currently designing a object structure for a game, and the most natural organization in my case became a tree. Being a great fan of smart pointers I use shared_ptr's exclusively. However, in this case, the children in the tree will need access to it's parent (example -- beings on map need to be able to access map data -- ergo the data of their parents. The direction of owning is of course that a map owns it's beings, so holds shared pointers to them. To access the map data from within a being we however need a pointer to the parent -- the smart pointer way is to use a reference, ergo a weak_ptr. However, I once read that locking a weak_ptr is a expensive operation -- maybe that's not true anymore -- but considering that the weak_ptr will be locked very often, I'm concerned that this design is doomed with poor performance. Hence the question: What is the performance penalty of locking a weak_ptr? How significant is it?

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

  • RegEx (or other) parsing of script

    - by jpmyob
    RegEx is powerful - it is tru but I have a little - query for you I want to parse out the FUNCTIONS from some old code in JS...however - I am RegEx handicapped (mentally deficient in grasping the subtleties).. the issue that makes me NOT EVEN TRY - is two fold - 1) myVar = function(x){ yadda yadda } AND function myVar(x) { yadda yadda } are found throuout - COLD I write a parser for each? sure - but that seems inefficient... 2) MANY things may reside INSIDE the {} including OTHER sets of {} or other Functions(){} block of text... HELP - does anyone have, or know of some code parsing snippets or examples that will parse out the info I want to collect? Thanks

    Read the article

  • Reverse Bredth First Search in C#

    - by Ngu Soon Hui
    Anyone has a ready implementation of the Reverse Bredth First Search algorithm in C#? By Reverse Bredth First Search, I mean instead of searching a tree starting from a common node, I want to search the tree from the bottom and gradually converged to a common node. Let's see the below figure, this is the output of a Bredth First Search: In my reverse bredth first search, 9,10,11 and 12 will be the first few nodes found ( the order of them are not important as they are all first order). 5, 6, 7 and 8 are the second few nodes found, and so on. 1 would be the last node found. Any ideas or pointers?

    Read the article

  • Why is this variable declared as private and also readonly?

    - by Sergio Tapia
    In the following code: public class MovieRepository : IMovieRepository { private readonly IHtmlDownloader _downloader; public MovieRepository(IHtmlDownloader downloader) { _downloader = downloader; } public Movie FindMovieById(string id) { var idUri = ...build URI...; var html = _downloader.DownloadHtml(idUri); return ...parse ID HTML...; } public Movie FindMovieByTitle(string title) { var titleUri = ...build URI...; var html = _downloader.DownloadHtml(titleUri); return ...parse title HTML...; } } I asked for something to review my code, and someone suggested this approach. My question is why is the IHtmlDownloader variable readonly?

    Read the article

  • GQL, Aggregation and Order By

    - by Koran
    Hi, How can GQL support ORDER BY when it does not support aggregation? The question is - if say the result of the query is more than 1000, does ORDER BY return fully ordered list or only the first 1000 items which is then ordered? To explain the question more: is conceptually MIN() same as query.orderby('asc').fetch(1)? If it is properly ordering the list, then how can it not provide COUNT(), since to properly order the list, GQL possibly has to parse through the whole list - in which case, COUNT() is not an issue at all? Or is item indexed and kept in some type of tree so that it does not need to parse it all the time?

    Read the article

  • Error in Decompression?

    - by user595606
    I am writing a crawler for a website. Its response is gzip encoded. I am not able to parse correctly a particular field, though the decompression is successful. I am also using htmlagilitypack to parse it, the parsed value of the field is only a part of the original value as an example : I am getting only /wEWAwKc04vTCQKb86mzBwKln/PuCg== whereas the firebug shows the actual value as much longer: /wEWBgKj7IuJCgKb86mzBwKln/PuCgLT250qAtC0+8cMAvimiNYD what does the '==' at the end means? I am assuming it that its a error on decompressors behalf?

    Read the article

  • In BASH how can i find my system on active internet interface, what is the upload speed?

    - by YumYumYum
    I am trying to write an TUI bandwidth trace application which on query can instantly tell me, that my download and upload speed is XXXX. I have figured out that download i can use with wget and parse it using BASH, but how do i get the upload speed? Example of download parse method: 1) Remote download : wget http://x.x.com:7007/files/software/vnc.zip Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 573K/s in 2.7s 2012-03-24 11:35:22 (573 KB/s) - `vnc.zip' saved [1594344/1594344] 2) Local download tells Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 --.-K/s in 0.1s 2012-03-24 06:43:04 (11.4 MB/s) - `vnc.zip' saved [1594344/1594344]

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • transferring subversion changes between linux and windows

    - by andreas buykx
    Hi all, What is the best way to transfer changes that include new and deleted directories and/or new and deleted (actually moved) files in those directories from a subversion repository on linux to windows? I do my developments on linux using a subversion repository, but I have to test my changes on windows as well. My windows machine has a tortoisesvn repository which I tried to patch with a svn diff output. This failed miserably since my patch contains a renamed (i.e. deleted and added under a different name) directory, a new directory and the files in there. Do I do things wrong by just applying the svn diff output as a patch in tortoisesvn? For now I think that my best option is to have the windows tree on the same svn version as the linux tree and just copy the entire changed directory over the existing directory. Would that work?

    Read the article

  • Backbone.js - Getting JSON back from url

    - by Brian
    While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

    Read the article

  • Having trouble reading XML file from Windows server. Works on Linux

    - by DuFF14
    I'm parsing an XML file in an android app. My success varies depending upon where the file is hosted. After hosting the file on 4 different servers (2 Linux, 2 Windows), I discovered that when the xml is hosted on a Linux server, the app works. When it's hosted on a Windows server, I am unable to parse correctly. Instead of reading the expected xml tags, it reads HTML tags (, , , etc). I'm not sure why it doesn't work on Windows servers, or if that is even the issue and not just a coincidence. Any help is appreciated. Thanks. Here is my code: private void getXmlData() { HttpClient httpclient = new DefaultHttpClient(); String url = XML_URL; HttpPost httppost = new HttpPost(url); HttpResponse response = httpclient.execute(httppost); SaxParser saxParser = new SaxParser(response); parsedXML = saxParser.parse(); }

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • VitrtualStringTree. How to Drag'n'Drop to ROOT level?

    - by Alexandr
    A have a tree: ROOT - VirtualStringTree(You don't see it, TVirtualStringTree.RootNode) - My Root Node 1 - My Root Node 2 - - Second node 1 - - Second node 2 - - Second node 3 - My Root Node 3 I can Drag'n'Drop "My Root Node 3" to any visible node, but I can't return it to defaut position, to the root level of tree. I try that: //Part of code from OnDragDrop Event of VirtualStringTree if (Sender.DropTargetNode = Sender.RootNode) then begin for i := 0 to high(Nodes) do begin LinksTree.MoveTo(Nodes[i], Sender.DropTargetNode, Attachmode, False); end; end; I places mouse to nowhere, but nothing happens. In DragOver I accepted drop to root if DropTarget is VST.RootNode. Anybody knows, how to drop node to VST.RootNode if I drag mouse to empty space of component?

    Read the article

  • insert a date in mysql database

    - by kawtousse
    I use a jquery datepicker then i read it in my servlet like that: String dateimput=request.getParameter("datepicker");//1 then parse it like that: System.out.println("datepicker:" +dateimput); DateFormat df = new SimpleDateFormat("MM/dd/yyyy"); java.util.Date dt = null; try { dt = df.parse(dateimput); System.out.println("date imput parssé1 est:" +dt); System.out.println("date imput parsée2 est:" +df.format(dt)); } catch (ParseException e) { e.printStackTrace(); } and insert query like that: String query = "Insert into dailytimesheet(trackingDate,activity,projectCode) values ("+df.format(dt)+", \""+activity+"\" ,\""+projet+"\")"; it pass successfully untill now but if i check the record inserted i found the date: 01/01/0001 00:00:00 l've tried to fix it but it still a mess for me.

    Read the article

< Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >