Search Results

Search found 8886 results on 356 pages for 'parse tree'.

Page 110/356 | < Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • B-trees, databases, sequential inputs, and speed.

    - by IanC
    I know from experience that b-trees have awful performance when data is added to them sequentially (regardless of the direction). However, when data is added randomly, best performance is obtained. This is easy to demonstrate with the likes of an RB-Tree. Sequential writes cause a maximum number of tree balances to be performed. I know very few databases use binary trees, but rather used n-order balanced trees. I logically assume they suffer a similar fate to binary trees when it comes to sequential inputs. This sparked my curiosity. If this is so, then one could deduce that writing sequential IDs (such as in IDENTITY(1,1)) would cause multiple re-balances of the tree to occur. I have seen many posts argue against GUIDs as "these will cause random writes". I never use GUIDs, but it struck me that this "bad" point was in fact a good point. So I decided to test it. Here is my code: SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[T1]( [ID] [int] NOT NULL CONSTRAINT [T1_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO CREATE TABLE [dbo].[T2]( [ID] [uniqueidentifier] NOT NULL CONSTRAINT [T2_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO declare @i int, @t1 datetime, @t2 datetime, @t3 datetime, @c char(300) set @t1 = GETDATE() set @i = 1 while @i < 2000 begin insert into T2 values (NEWID(), @c) set @i = @i + 1 end set @t2 = GETDATE() WAITFOR delay '0:0:10' set @t3 = GETDATE() set @i = 1 while @i < 2000 begin insert into T1 values (@i, @c) set @i = @i + 1 end select DATEDIFF(ms, @t1, @t2) AS [Int], DATEDIFF(ms, @t3, getdate()) AS [GUID] drop table T1 drop table T2 Note that I am not subtracting any time for the creation of the GUID nor for the considerably extra size of the row. The results on my machine were as follows: Int: 17,340 ms GUID: 6,746 ms This means that in this test, random inserts of 16 bytes was almost 3 times faster than sequential inserts of 4 bytes. Would anyone like to comment on this? Ps. I get that this isn't a question. It's an invite to discussion, and that is relevant to learning optimum programming.

    Read the article

  • Freezable DataContext

    - by grid-wpf-architect
    Hi, I have a customControl like ListView and I need to bind the sub property of my Custom Control to the visual tree element like below, <StackPanel> <TextBlock Text="Test" x:Name="txtBlock" /> <local:MyControl> <local:MyControl.Items> <local:MyControlItem Value ="{Binding ElementName=txtBlock, Path=Text}" /> </local:MyControl.Items> </local:MyControl> </StackPanel> I can access the object using Freezable object as the resource, but i want to inherit Freezable in my MyControlItem and access the Visual Tree.

    Read the article

  • dijit.form.FilteringSelectinitial initial value always null.

    - by jiggs
    I'm using QueryReadStore as data and displaying the widget using the declarative way. My store looks like this: <div style="display:none" jsId="role_store" url="some/url/here" requestMethod="post" dojoType="dojox.data.QueryReadStore"></div> My widget is like this: <input dojoType="dijit.form.FilteringSelect" id="role_id" name="role_name" required="false" store="role_store" value="100" searchAttr="description"> Scenario: store is declared inside the HTML page. widget is loaded using parse.parse in the javascript. Issue: At first click no displayed value on the widget. But at the second click, values are displayed right.

    Read the article

  • [PHP] Using cURL to download large XML files

    - by ndg
    I'm working with PHP and need to parse a number of fairly large XML files (50-75MB uncompressed). The issue, however, is that these XML files are stored remotely and will need to be downloaded before I can parse them. Having thought about the issue, I think using a system() call in PHP in order to initiate a cURL transfer is probably the best way to avoid timeouts and PHP memory limits. Has anyone done anything like this before? Specifically, what should I pass to cURL to download the remote file and ensure it's saved to a local folder of my choice?

    Read the article

  • Why is this variable declared as private and also readonly?

    - by Sergio Tapia
    In the following code: public class MovieRepository : IMovieRepository { private readonly IHtmlDownloader _downloader; public MovieRepository(IHtmlDownloader downloader) { _downloader = downloader; } public Movie FindMovieById(string id) { var idUri = ...build URI...; var html = _downloader.DownloadHtml(idUri); return ...parse ID HTML...; } public Movie FindMovieByTitle(string title) { var titleUri = ...build URI...; var html = _downloader.DownloadHtml(titleUri); return ...parse title HTML...; } } I asked for something to review my code, and someone suggested this approach. My question is why is the IHtmlDownloader variable readonly?

    Read the article

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • DOM: how to import nodes and give them different namespace prefix

    - by thomasrutter
    I'm familiar with the DOMDocument::importNode method for importing a tree of nodes from some other document element. However, what I was wondering is if I can automatically change the namespace prefix on a tree of nodes as I import them, that is, specify a new prefix for all nodes of that namespace. Say the nodes, in their existing document, all have names like "name", "identity", and so on. When importing them into my new document they will be alongside other namespaces, so I'd like them to appear as "nicnames:name", "nicnames:identity" and so on. I'd like to be able to change this prefix programmatically so that in another context I may be able to import them as, for instance, "myprefix:name", "myprefix:identity" depending on the document they're imported into. Can anyone help me understand how to do this? Thanks

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • Read binary data from a MDB-file running under LAMP

    - by BusterX
    I need to be able to connect to an MDB-file in a LAMP-environment (running on Linux) and ultimately insert converted data into a Mysql db. The data I need to access is stored as a BLOB (Long Binary Data according to Access) in the MDB file. I have not yet been able to actually have a look at the data but I have been told that the BLOB consists of byte strings. Something along the lines of: 0x1c 0x10 0x27 0x00 0x00 I need to parse the byte strings and convert these to a format that is human readable. I do have access to the documentation that explains the various byte strings. So this is really two questions: How do a get access to the MDB file via PHP* (running under LAMP) and read the BLOB (I do not have access to a Windows-platform)? What would be the best way to parse the binary data (in PHP*) once I am able to connect to the MDB-file? *Or are there other methods/languages that are more appropriate?

    Read the article

  • Reverse Bredth First Search in C#

    - by Ngu Soon Hui
    Anyone has a ready implementation of the Reverse Bredth First Search algorithm in C#? By Reverse Bredth First Search, I mean instead of searching a tree starting from a common node, I want to search the tree from the bottom and gradually converged to a common node. Let's see the below figure, this is the output of a Bredth First Search: In my reverse bredth first search, 9,10,11 and 12 will be the first few nodes found ( the order of them are not important as they are all first order). 5, 6, 7 and 8 are the second few nodes found, and so on. 1 would be the last node found. Any ideas or pointers?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • GQL, Aggregation and Order By

    - by Koran
    Hi, How can GQL support ORDER BY when it does not support aggregation? The question is - if say the result of the query is more than 1000, does ORDER BY return fully ordered list or only the first 1000 items which is then ordered? To explain the question more: is conceptually MIN() same as query.orderby('asc').fetch(1)? If it is properly ordering the list, then how can it not provide COUNT(), since to properly order the list, GQL possibly has to parse through the whole list - in which case, COUNT() is not an issue at all? Or is item indexed and kept in some type of tree so that it does not need to parse it all the time?

    Read the article

  • What's the performance penalty of weak_ptr?

    - by Kornel Kisielewicz
    I'm currently designing a object structure for a game, and the most natural organization in my case became a tree. Being a great fan of smart pointers I use shared_ptr's exclusively. However, in this case, the children in the tree will need access to it's parent (example -- beings on map need to be able to access map data -- ergo the data of their parents. The direction of owning is of course that a map owns it's beings, so holds shared pointers to them. To access the map data from within a being we however need a pointer to the parent -- the smart pointer way is to use a reference, ergo a weak_ptr. However, I once read that locking a weak_ptr is a expensive operation -- maybe that's not true anymore -- but considering that the weak_ptr will be locked very often, I'm concerned that this design is doomed with poor performance. Hence the question: What is the performance penalty of locking a weak_ptr? How significant is it?

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

  • transferring subversion changes between linux and windows

    - by andreas buykx
    Hi all, What is the best way to transfer changes that include new and deleted directories and/or new and deleted (actually moved) files in those directories from a subversion repository on linux to windows? I do my developments on linux using a subversion repository, but I have to test my changes on windows as well. My windows machine has a tortoisesvn repository which I tried to patch with a svn diff output. This failed miserably since my patch contains a renamed (i.e. deleted and added under a different name) directory, a new directory and the files in there. Do I do things wrong by just applying the svn diff output as a patch in tortoisesvn? For now I think that my best option is to have the windows tree on the same svn version as the linux tree and just copy the entire changed directory over the existing directory. Would that work?

    Read the article

  • .NET TreeView causes application to crash when trying to check Parent node

    - by alexD
    I have a TreeView with check boxes, and when a user checks a child node, I want to go up the tree and check each parent. However, for some reason my application blows up whenever I touch the parent node. For the nodes in my tree, I've extended TreeNode to create my own objects with some data that I need to store in them, but I still reference them as TreeNodes when checking/unchecking. My code looks like this: //checkBox checked event handler if (node.Parent != null) { checkAllParents(node.Parent); } // private void checkAllParents(TreeNode node) { node.Checked = true; if (node.Parent != null) { checkAllParents(node.Parent); } }

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • How to print an Objectified Element?

    - by BeeBand
    I have xml of the format: <channel> <games> <game slot='1'> <id>Bric A Bloc</id> <title-text>BricABloc Hoorah</title-text> <link>Fruit Splat</link> </game> </games> </channel> I've parsed this xml using lxml.objectify, via: tree = objectify.parse(file) There will potentially be a number of <game>s underneath <games>. I understand that I can generate a list of <game> objects via: [ tree.games[0].game[0:4] ] My question is, what class are those objects and is there a function to print any object of whatever class these objects belong to?

    Read the article

  • RegEx (or other) parsing of script

    - by jpmyob
    RegEx is powerful - it is tru but I have a little - query for you I want to parse out the FUNCTIONS from some old code in JS...however - I am RegEx handicapped (mentally deficient in grasping the subtleties).. the issue that makes me NOT EVEN TRY - is two fold - 1) myVar = function(x){ yadda yadda } AND function myVar(x) { yadda yadda } are found throuout - COLD I write a parser for each? sure - but that seems inefficient... 2) MANY things may reside INSIDE the {} including OTHER sets of {} or other Functions(){} block of text... HELP - does anyone have, or know of some code parsing snippets or examples that will parse out the info I want to collect? Thanks

    Read the article

  • Reverse Breath First Search in C#

    - by Ngu Soon Hui
    Anyone has a ready implementation of the Reverse Breath First Search algorithm in C#? By Reverse Breath First Search, I mean instead of searching a tree starting from a common node, I want to search the tree from the bottom and gradually converged to a common node. Let's see the below figure, this is the output of a Breath First Search: In my reverse breath first search, 9,10,11 and 12 will be the first few nodes found ( the order of them are not important as they are all first order). 5, 6, 7 and 8 are the second few nodes found, and so on. 1 would be the last node found. Any ideas or pointers?

    Read the article

  • Parallel Processing Simulation in Javascript

    - by le_havre
    Hello, I'm new to JavaScript so forgive me for being a n00b. When there's intensive calculation required, it more than likely involves loops that are recursive or otherwise. Sometimes this may mean having am recursive loop that runs four functions and maybe each of those functions walks the entire DOM tree, read positions and do some math for collision detection or whatever. While the first function is walking the DOM tree, the next one will have to wait its for the first one to finish, and so forth. Instead of doing this, why not launch those loops-within-loops separately, outside the programs, and act on their calculations in another loop that runs slower because it isn't doing those calculations itself? Retarded or clever? Thanks in advance!

    Read the article

  • Java simple data format british time

    - by DD
    Hi, I am using simple date format to allow users to specify which time zone they are sending data in: DateFormat df = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss,z"); This works fine: e.g. df.parse("2009-05-16 11:07:41,GMT"); However, if someone is always sending time in London time (i.e. taking into account daylight savings), what would be the approriate time zone String to add? e.g. this doesnt work: df.parse("2009-05-16 11:07:41,Europe/London"); Thanks.

    Read the article

< Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >