Search Results

Search found 93816 results on 3753 pages for 'nexus one'.

Page 129/3753 | < Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >

  • Treeview does not refresh to show childnode moved from one parent node to another

    - by mike
    I am using the Windows Forms TreeView class which contains a set of TreeNodes. The TreeNodes can have child nodes. I have a root node with 2 sub nodes (Node1 and Node2) Node1 has 2 subnodes (child1 and child2) I have a function that will allow a user to select any node and move it to another node: TreeNode SelectNode = this.TreeView1.SelectedNode; TreeNode DestNode = SelectedNewNode(); //function to select a new node SelectedNode.Remove(); DestNode.Nodes.Add(SelectedNode); this.TreeView1.Refresh(); When this executes, the current selected node (child2) is removed from its current parent (Node1) and added to Node2. However, the Refresh() method of the TreeView control does not show that child2 is under Node2. If I debug it and look at the Nodes collection in the TreeView i do see that child2 is under Node2. Can anyone tell me why the Refresh() method does not redraw the new parent to child mapping? Is there a way to tell the TreeView to redraw with the new mappings?

    Read the article

  • WIX: COM unregistration when removing one of two programs

    - by madbadger
    Hello, I am relatively new to WiX. It is a great tool, but I still need some time to learn it better. I have encountered a problem with registration and unregistration of a COM component. I have created installers for two applications, lets call them A and B. Both are using the same COM component. I have used the heat tool, as recommended. When installing A or B, the component is registered without any problems. But when I install A and B, then remove A (with Add/Remove programs) the COM class gets unregistered and B cannot use it anymore. Is there a clean solution to prevent this from happening? I would like to unregister the COM when BOTH A and B are uninstalled. Any help would be appreciated, Best regards, madbadger

    Read the article

  • How do I select the max value from multiple tables in one column

    - by Derick
    I would like to get the last date of records modified. Here is a sample simple SELECT: SELECT t01.name, t01.last_upd date1, t02.last_upd date2, t03.last_upd date3, 'maxof123' maxdate FROM s_org_ext t01, s_org_ext_x t02, s_addr_org t03 WHERE t02.par_row_id(+)= t01.row_id and t03.row_id(+)= t01.pr_addr_id and t01.int_org_flg = 'n'; How can I get column maxdate to display the max of the three dates? Note: no UNION or sub SELECT statements ;)

    Read the article

  • prepend to a file one liner shell?

    - by elmarco
    This is probably a complex solution. I am looking for a simple operator like "", but for prepending. I am afraid it does not exist. I'll have to do something like mv $F tmp cat header tmp $F Anything smarter? (I am not fond of tmp files)

    Read the article

  • One-Click Application Moving from WinForms to WPF

    - by Tyler
    I have a WinForms app that I recently re-wrote in WPF and I need to release to my end users. I'd like to be able to have the users go to the ClickOnce install point for the WPF application and have their WinForm application removed so they don't have both on their machine What's the best way (read: easiest for users) of accomplishing this? I have thought about creating an prereq command line app to detect the old version and uninstall, but would like to avoid having to write an something like that where it only get's run once.

    Read the article

  • Many RewriteBase in one .htaccess file?

    - by Martti Laine
    Hello I have a domain and a wordpress-blog on same server. Now I have a problem (surprise). The wordpress is located on /httpdocs/blog/ and domain is pointing to /httpdocs/ and I'm trying to redirect it to /httpdocs/domain/. But, obvisiously, I have permalinks in Wordpress. Here's my current .htaccess: RewriteEngine On RewriteBase /blog/ RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule . /blog/index.php [L] RewriteBase / RewriteCond %{HTTP_HOST} domain.com RewriteCond %{REQUEST_URI} !^/domain RewriteCond %{REQUEST_URI} !^/cgi-bin RewriteRule ^(.*)$ domain/$1 [L] But as you already propably assumed, this doesn't work. Wordpress' permalinks affects to /domain/ also, so my images and other urls go wrong. Any advice? Is it possible to use RewriteBase like this? Martti Laine

    Read the article

  • Merging two XML files into one XML file using Java

    - by dmurali
    I am stuck with how to proceed with combining two different XML files(which has the same structure). When I was doing some research on it, people say that XML parsers like DOM or StAX will have to be used. But cant I do it with the regular IOStream? I am currently trying to do with the help of IOStream but this is not solving my purpose, its being more complex. For example, What I have tried is; public class GUI { public static void main(String[] args) throws Exception { // Creates file to write to Writer output = null; output = new BufferedWriter(new FileWriter("C:\\merged.xml")); String newline = System.getProperty("line.separator"); output.write(""); // Read in xml file 1 FileInputStream in = new FileInputStream("C:\\1.xml"); BufferedReader br = new BufferedReader(new InputStreamReader(in)); String strLine; while ((strLine = br.readLine()) != null) { if (strLine.contains("<MemoryDump>")){ strLine = strLine.replace("<MemoryDump>", "xmlns:xsi"); } if (strLine.contains("</MemoryDump>")){ strLine = strLine.replace("</MemoryDump>", "xmlns:xsd"); } output.write(newline); output.write(strLine); System.out.println(strLine); } // Read in xml file 2 FileInputStream in = new FileInputStream("C:\\2.xml"); BufferedReader br1 = new BufferedReader(new InputStreamReader(in)); String strLine1; while ((strLine1 = br1.readLine()) != null) { if (strLine1.contains("<MemoryDump>")){ strLine1 = strLine1.replace("<MemoryDump>", ""); } if (strLine1.contains("</MemoryDump>")){ strLine1 = strLine1.replace("</MemoryDump>", ""); } output.write(newline); output.write(strLine1); I request you to kindly let me know how do I proceed with merging two XML files by adding additional content as well. It would be great if you could provide me some example links as well..! Thank You in Advance..! System.out.println(strLine1); } }

    Read the article

  • How to move child element from one parent to another using jQuery

    - by Kapslok
    I am using the jQuery DataTables plugin. I would like to move the search box (.dataTables_filter) and number of records to display dropdown (.dataTables_length) from their parent element (.dataTables_wrapper) to another div on my page without losing any registered javascript behavior. For instance the search box has a function attached to the 'keyup' event and I want to keep that intact. The DOM looks like this: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> This is what I would like the DOM to look like after the move: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> I've been looking at the .append(), .appendTo(), .prepend() and .prependTo() functions but haven't had any luck with these in practice. I've also looked at the .parent() and .parents() functions, but can't seem to code a workable solution. I have also considered changing the CSS so that the elements are absolutely positioned - but to be frank the page is setup with fluid elements all over, and I really want these elements to be floated in their new parents. Any help with this is much appreciated.

    Read the article

  • HTML: Place an image on top of another one

    - by Dimitris Baltas
    Inside a div, there is a picture that should have 10px margin in all directions from the DIV's border. On the left bottom corner of the picture there is an about-image. The picture is only displayed when its loaded in the DOM through jquery. The problem is that the existence of the about-image dislocates the picture downwards as many pixels as the height of the about-image. I am looking for the cleanest possible alternative to keep the picture inside the DIV and still display the about-image on top of it. Setting the picture as background will not work since i need the picture to load at once. Any improvement on the #about css would be greatly appreciated. Below is a full html page that reproduces the issue <html> <head> <title>Troubleshooting :: align the main picture inside the DIV</title> <style type="text/css"> html, body { background-color: #000000; } #about { z-index:2; position:relative; top:82%; left:3%; } #pic { width:100%; height:96%; } #main-content-image { height:100%; margin-right:10px; margin-left:10px; margin-top:10px; margin-bottom:10px; } #main-content { height:490px; border-width: 1px; border-style: solid; border-color: #777777; } #main-content-image.loading { background: url(http://farros.gr/images/ajax-loader2.gif) no-repeat center center; } a { text-decoration: none; text-decoration: none; color: #868686; outline:none; } .hide { display:none; } </style> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script> <script type="text/javascript"> <!-- $(document).ready(function(){ $(function () { var img = new Image(); $(img).load(function () { $(this).hide(); $(this).width('100%'); $(this).height('96%'); $('#main-content-image').removeClass('loading').append(this); $(this).fadeIn(); }).error(function () { // notify the user that the image could not be loaded }).attr('src', 'http://farros.gr/images/bg.jpg'); }); }); </script> </head> <body> <div id="main-content"> <div id="main-content-image" class="loading"> <a href="#"><img id="about" src='http://farros.gr/images/about.png' alt='Haris Farros'/></a> </div> </div> </body> </html>

    Read the article

  • MySQL: select words as rows even som are "new line" separated in one field

    - by Tillebeck
    Hi I have a table with a field where words are written separated with new lines. So a select on this single field from to rows will output 3 lines for first row and 2 lines for second row: Row1 designationer nye kolonier mindre byer Row2 udsteder bopladser I would like to do a select that select all these lines as if they had been rows in the table like: SELECT do_the_split(field) FROM table so the result would be more like: Row1 designationer Row2 nye kolonier Row3 mindre byer Row4 udsteder Row5 bopladser is there any way to do this in MySQL? BR. Anders

    Read the article

  • More than one location provider at same time

    - by Rabarama
    I have some problems with location systems. I have a service that implements locationlistener. I want to get the best location using network when possible, gps if network is not enough accurate (accuracy greater than 300mt). The problem is this. I need location (accurate if possible, inaccuarte otherways) every 5 minutes. I start with a : LocationManager lm=(LocationManager)getApplicationContext().getSystemService(LOCATION_SERVICE); Criteria criteria = new Criteria(); criteria.setAccuracy(Criteria.ACCURACY_COARSE); criteria.setAltitudeRequired(false); criteria.setBearingRequired(false); String provider=lm.getBestProvider(criteria, true); if(provider!=null){ lm.requestLocationUpdates( provider,5*60*1000,0,this); In "onLocationChanged" i listen to locations and when i get a location with accuracy greater than 300mt, i want to change to gps location system. If I remove allupdates and then request for gps updates, like this: lm.removeUpdates((android.location.LocationListener) this); Criteria criteria = new Criteria(); criteria.setAccuracy(Criteria.ACCURACY_FINE); criteria.setAltitudeRequired(false); criteria.setBearingRequired(false); String provider=lm.getBestProvider(criteria, true); if(provider!=null){ lm.requestLocationUpdates( provider,5*60*1000,0,this); } system stops waiting for gpsupdate, and if i'm in a close room it can stay without location updates for hours, ignoring timeupdate indications. Is there a way to tell locationprovider to switch to network if gps is not giving a location in "x" seconds? or how to understand when gps is not localizing? or if i requestlocationupdates from 2 providers at same time (network and gps), can be a problem? Any suggestion?

    Read the article

  • javascript regex: match altered version of first match with only one expression

    - by theseion
    Hi there I'm writing a brush for Alex Gorbatchev's Syntax Highlighter to get highlighting for Smalltalk code. Now, consider the following Smalltalk code: aCollection do: [ :each | each shout ] I want to find the block argument ":each" and then match "each" every time it occurrs afterwards (for simplicity, let's say every occurrence an not just inside the brackets). Note that the argument can have any name, e.g. ":myArg". My attempt to match ":each": \:([\d\w]+) This seems to work. The problem is for me to match the occurrences of "each". I thought something like this could work: \:([\d\w]+)|\1 but the right hand side of the alternation seems to be treated as an independent expression, so backreferencing doesn't work. So my question is: is it even possible to accomplish what I want in a single expression? Or would I have to use the backreference within a second expression (via another function call)? Cheers.

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • Which one is more popular?

    - by atch
    Which of IDE's I'm more likely to meet in an office? Borland or Visual Studio? I wouldn't ask this question here (I could use google and type which is better) only for a reason that in my previous cariere as an engineer I worked (and most of my friends) all the time on AutoCAD not on Microstation even though Microstation had always been better software (stability, conforming to standards, ease of use etc.). Thanks for answers.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • In listview,Viewstub cannot be found after the previous one is inflate

    - by user2958132
    I am using some list item layout and in the item layout, there is a Viewstub where I want to put some image in.I don't have the source of list item layout and just know there are some TextViews and ViewStubs in it. My purpose is to find the ViewStub first and set my personal layout and play with it. However, some of the ViewStub cannot be found. public class TJAdapter extends CursorAdapter { .... public void bindView(View view, Context context, Cursor cursor) { ViewStub contentstub = (ViewStub)item.findViewById(R.id.content_stub); if (contentstub == null){ LOG.error("TJ,contentstub is null"); } else { LOG.error("TJ,contentstub is not null"); contentstub.setLayoutResource(R.layout.icon_image); View iconImage = contentstub.inflate(); } .... } public View newView(Context context, Cursor cursor, ViewGroup parent) { final View view = mInflater.inflate(R.layout.list_item, parent, false); bindView(view, context, cursor); } And the log output is like this: TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null I spent a lot of time on it and have no idea why this happens. Can some body help?

    Read the article

  • Microsecond (or one ms) time resolution on an embedded device (Linux Kernel)

    - by ChrisDiRulli
    Hey guys, I have a kernel module I've built that requires at least 1 ms time resolution. I currently use do_gettimeofday() but I'm concerned that this won't work once I move my module to an embedded device. The device has a 180 Mz processor (MIPS) and the default HZ value in the kernel is 100. Thus using jiffies will only give me at best 10 ms resolution. That won't cut it. What I'd like to know is if do_gettimeofday() is based on the timer interrupt (HZ). Can it be guaranteed to provide at least 1 ms of resolution? Thanks!

    Read the article

  • Amazon EC2 EBS automatic backup one-liner works manually but not from cron

    - by dan
    I am trying to implement an automatic backup system for my EBS on Amazon AWS. When I run this command as ec2-user: /opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** everything works fine. But if I add this line into /etc/crontab and restart the crond service: 15 12 * * * ec2-user /opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** that doesn't work. I checked var/log/cron and there is this line, therefore the command gets executed: Dec 13 12:15:01 ip-10-204-111-94 CROND[4201]: (ec2-user) CMD (/opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** ) Can you please help me to troubleshoot the problem? I guess is some environment problem - maybe the lack of some variable. If that's the case I don't know what to do about it. Thanks.

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

< Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >