Search Results

Search found 5919 results on 237 pages for 'regex matching'.

Page 130/237 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • Finding C#-style unescaped strings using regular expressions

    - by possan
    I'm trying to write a regular expression that finds C#-style unescaped strings, such as string x = @"hello world"; The problem I'm having is how to write a rule that handles double quotes within the string correctly, like in this example string x = @"before quote ""junk"" after quote"; This should be an easy one, right?

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • Finding a integer number after a beginning t=

    - by user2966696
    I have a string like this: 33 00 4b 46 ff ff 03 10 30 t=25562 I am only interested in the five digits at the very end after the t= How can I get this numbers with a regular expression out of it? I tried grep t=..... but I also got all characters including the t= in the beginning, which I would like to drop? After finding that five digit number, I would like to divide this by 1000. So in the above mentioned case the number 25.562. Is this possible with grep and regular expressions? Thanks for your help.

    Read the article

  • mine phrases (up to 3 words) from a given text

    - by DS_web_developer
    I asked before for a simple solution to my problem (using sphinx search service) but I got nowhere... someone has kindly provided me with this code <?php /** * $Project: GeoGraph $ * $Id$ * * GeoGraph geographic photo archive project * This file copyright (C) 2005 Barry Hunter ([email protected]) * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. */ /** * Provides the methods for updating the worknet tables * * @package Geograph * @author Barry Hunter <[email protected]> * @version $Revision$ */ function addTwoLetterPhrase($phrase) { global $w2; $w2[$phrase] = (isset($w2[$phrase]))?($w2[$phrase]+1):1; } function addThreeLetterPhrase($phrase) { global $w3; $w3[$phrase] = (isset($w3[$phrase]))?($w3[$phrase]+1):1; } function updateWordnet(&$db,$text,$field,$id) { global $w1,$w2,$w3; $alltext = strtolower(preg_replace('/\W+/',' ',str_replace("'",'',$text))); if (strlen($text)< 1) return; $words = preg_split('/ /',$alltext); $w1 = array(); $w2 = array(); $w3 = array(); //build a list of one word phrases foreach ($words as $word) { $w1[$word] = (isset($w1[$word]))?($w1[$word]+1):1; } //build a list of two word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+)/e','addTwoLetterPhrase("$1 $2")',$text); //build a list of three word phrases $text = $alltext; $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); $text = $alltext; $text = preg_replace('/(\w+) (\w+)/','',$text,1); $text = preg_replace('/(\w+) (\w+) (\w+)/e','addThreeLetterPhrase("$1 $2 $3")',$text); foreach ($w1 as $word=>$count) { $db->Execute("insert into wordnet1 set gid = $id,words = '$word',$field = $count");// ON DUPLICATE KEY UPDATE $field=$field+$count"); } foreach ($w2 as $word=>$count) { $db->Execute("insert into wordnet2 set gid = $id,words = '$word',$field = $count"); } foreach ($w3 as $word=>$count) { $db->Execute("insert into wordnet3 set gid = $id,words = '$word',$field = $count"); } } ?> It works fine and does almost exactly what I need....... except.... it is not utf8 friendly... I mean... it splits whole words into parts (on special chars) where it shouldn't! so my guess is I should use multibyte functions instead of regular preg_replace... I tried to replace preg_replace with mb_ereg_replace but it is not working as it should... at least not for 2 and 3 words phrases any ideas?

    Read the article

  • dropping characters from regular expression groups

    - by tcurdt
    The goal: I want to convert a number from the format "10.234,56" to "10234.56" Using this simple approach almost gets us there /([\d\.]+),(\d\d)/ => '\1.\2' The problem is that the first group of the match (of course) still contains the '.' character. So questions are: Is it possible to exclude a character from the group somehow? How would you solve this with a single regexp (I know this is a trivial problem when not using a single regexp)

    Read the article

  • Need some help setting up subdomains for my site

    - by KarimSaNet
    I'm setting up my website and want to have it so all subdomain requests are rewritten to the appropriate subdirectory. For example http://projects.karimsa.net/ -> http://karimsa.net/projects/ But I want to use the Apache rewrite mod to do this so that the URL in the browser stays the same. Here is what my config looks like at the moment: ## rewrite subdomains RewriteEngine On RewriteCond %{HTTP_HOST} ^(.*).karimsa.net RewriteCond %{HTTP_HOST} !^www.karimsa.net [NC] RewriteRule ^(.*)$ http://karimsa.net/%1/$1 [R=301,L] And my CNAME records on 'projects.karimsa.net': Domain TTL Data Type projects.karimsa.net 14400 karimsa.net CNAME Theoretically, I feel this should work. But when I go to the URL, it gives me a server misconfiguration error, my provider's default webpage. What I should see is the index.php under /projects/. What am I doing wrong? Any help would be appreciated, thanks for reading. Addition: I realized I forgot to mention some of the problem. The domain 'karimsa.net' is parked at 'karimsa.x10.mx'. If I set up the same configuration on 'projects.karimsa.x10.mx', the rewrite and CNAME work. But on the parked domain I still get the default webpage.

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • javascript regular expressions

    - by Zhasulan Berdybekov
    Help me with regular expressions. I need to check the text on the hour and minute. That is the first case, the text can be from 0 to 12. In the second case, the text can be from 1 to 60. this is my code: var hourRegEx = /^([0-9]{2})$/; //You can fix this line of code? $(document).ready( function(){ $('form.form').submit(function(){ if( $('input.hour').val().match(hourRegEx) ){ return true; } return false; }); }); In my case, the code says that, for example 52, too, the correct answer

    Read the article

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >