Search Results

Search found 5919 results on 237 pages for 'regex matching'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 130/237 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • actionscript find and convert text to url

    - by gravesit
    I have this script that grabs a twitter feed and displays in a little widget. What I want to do is look at the text for a url and convert that url to a link. public class Main extends MovieClip { private var twitterXML:XML; // This holds the xml data public function Main() { // This is Untold Entertainment's Twitter id. Did you grab yours? var myTwitterID= "username"; // Fire the loadTwitterXML method, passing it the url to your Twitter info: loadTwitterXML("http://twitter.com/statuses/user_timeline/" + myTwitterID + ".xml"); } private function loadTwitterXML(URL:String):void { var urlLoader:URLLoader = new URLLoader(); // When all the junk has been pulled in from the url, we'll fire finishedLoadingXML: urlLoader.addEventListener(Event.COMPLETE, finishLoadingXML); urlLoader.load(new URLRequest(URL)); } private function finishLoadingXML(e:Event = null):void { // All the junk has been pulled in from the xml! Hooray! // Remove the eventListener as a bit of housecleaning: e.target.removeEventListener(Event.COMPLETE, finishLoadingXML); // Populate the xml object with the xml data: twitterXML = new XML(e.target.data); showTwitterStatus(); } private function addTextToField(text:String,field:TextField):void{ /*Regular expressions for replacement, g: replace all, i: no lower/upper case difference Finds all strings starting with "http://", followed by any number of characters niether space nor new line.*/ var reg:RegExp=/(\b(https?|ftp|file):\/\/[-A-Z0-9+&@#\/%?=~_|!:,.;]*[-A-Z0-9+&@#\/%=~_|])/ig; //Replaces Note: "$&" stands for the replaced string. text.replace(reg,"<a href=\"$&\">$&</a>"); field.htmlText=text; } private function showTwitterStatus():void { // Uncomment this line if you want to see all the fun stuff Twitter sends you: //trace(twitterXML); // Prep the text field to hold our latest Twitter update: twitter_txt.wordWrap = true; twitter_txt.autoSize = TextFieldAutoSize.LEFT; // Populate the text field with the first element in the status.text nodes: addTextToField(twitterXML.status.text[0], twitter_txt); }

    Read the article

  • How to move many files in multiple different directories (on Linux)

    - by user1335982
    My problem is that I have too many files in single directory. I cannot "ls" the directory, cos is too large. I need to move all files in better directory structure. I'm using the last 3 digits from ID as folders in reverse way. For example ID 2018972 will gotta go in /2/7/9/img_2018972.jpg. I've created the directories, but now I need help with bash script. I know the IDs, there are in range 1,300,000 - 2,000,000. But I can't handle regular expressions. I wan't to move all files like this: /images/folder/img_2018972.jpg -> /images/2/7/9/img_2018972.jpg I will appreciate any help on this subject. Thanks!

    Read the article

  • PHP: Return string between two characters

    - by Nic Hubbard
    I am wanting to use "keywords" within a large string. These keywords start and end using *my_keyword* and are user defined. How, within a large string, can I search and find what is between the two * characters and return each instance? The reason it might change it, that parts of the keywords can be user defined, such as *page_date_Y* which might show the year in which the page was created. So, again, I just need to do a search and return what is between those * characters. Is this possible, or is there a better way of doing this if I don't know the "keyword" length or what i might be?

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • Regular expression - starting and ending with a letter, accepting only letters, numbers and _

    - by jreid9001
    I'm trying to write a regular expression which specifies that text should start with a letter, every character should be a letter, number or underscore, there should not be 2 underscores in a row and it should end with a letter or number. At the moment, the only thing I have is ^[a-zA-Z]\w[a-zA-Z1-9_] but this doesn't seem to work properly since it only ever matches 3 characters, and allows repeated underscores. I also don't know how to specify requirements for the last character.

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • [Qt] Check octal number

    - by sterh
    Hello, I write simple application in C++/Qt. And i have a text and some octal number in it. My app splits this text by spaces. And i need to check octal numbers from text. How can i select octal numbers from this text with regular expressions? Thank you.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Some pro regular expressions help needed here

    - by Camran
    I need a special regular expression, have no experience in them whatsoever so I am turning to you guys on this one: I need to validate a classifieds title field so it doesn't have any special characters in it, almost. Only letters and numbers should be allowed, and also the swedish three letters å, ä, ö, and also not case sensitive. Besides the above, these should also be allowed: The "&" sign. Parenthesis sign "()" Mathematical signs "-", "+", "%", "/", "*" Dollar and Euro signs Accent sign or whatever it's called, for example in "coupé" the apostrophe above the "e". Double quote and singel quote signs. The comma "," and point "." signs Thanks

    Read the article

  • Need some help setting up subdomains for my site

    - by KarimSaNet
    I'm setting up my website and want to have it so all subdomain requests are rewritten to the appropriate subdirectory. For example http://projects.karimsa.net/ -> http://karimsa.net/projects/ But I want to use the Apache rewrite mod to do this so that the URL in the browser stays the same. Here is what my config looks like at the moment: ## rewrite subdomains RewriteEngine On RewriteCond %{HTTP_HOST} ^(.*).karimsa.net RewriteCond %{HTTP_HOST} !^www.karimsa.net [NC] RewriteRule ^(.*)$ http://karimsa.net/%1/$1 [R=301,L] And my CNAME records on 'projects.karimsa.net': Domain TTL Data Type projects.karimsa.net 14400 karimsa.net CNAME Theoretically, I feel this should work. But when I go to the URL, it gives me a server misconfiguration error, my provider's default webpage. What I should see is the index.php under /projects/. What am I doing wrong? Any help would be appreciated, thanks for reading. Addition: I realized I forgot to mention some of the problem. The domain 'karimsa.net' is parked at 'karimsa.x10.mx'. If I set up the same configuration on 'projects.karimsa.x10.mx', the rewrite and CNAME work. But on the parked domain I still get the default webpage.

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • Find multiple patterns with a single preg_match_all in PHP

    - by Mark
    Using PHP and preg_match_all I'm trying to get all the HTML content between the following tags (and the tags also): <p>paragraph text</p> don't take this <ul><li>item 1</li><li>item 2</li></ul> don't take this <table><tr><td>table content</td></tr></table> I can get one of them just fine: preg_match_all("(<p>(.*)</p>)siU", $content, $matches, PREG_SET_ORDER); Is there a way to get all the <p></p> <ul></ul> <table></table> content with a single preg_match_all? I need them to come out in the order they were found so I can echo the content and it will make sense. So if I did a preg_match_all on the above content then iterated through the $matches array it would echo: <p>paragraph text</p> <ul><li>item 1</li><li>item 2</li></ul> <table><tr><td>table content</td></tr></table>

    Read the article

  • regular expression - function body extracting

    - by Altariste
    Hi, In Python script,for every method definition in some C++ code of the form: return_value ClassName::MethodName(args) {MehodBody} ,I need to extract three parts: the class name, the method name and the method body for further processing. Finding and extracting the ClassName and MethodName is easy, but is there any simple way to extract the body of the method? With all possible '{' and '}' inside it? Or are regexes unsuitable for such task?

    Read the article

  • dropping characters from regular expression groups

    - by tcurdt
    The goal: I want to convert a number from the format "10.234,56" to "10234.56" Using this simple approach almost gets us there /([\d\.]+),(\d\d)/ => '\1.\2' The problem is that the first group of the match (of course) still contains the '.' character. So questions are: Is it possible to exclude a character from the group somehow? How would you solve this with a single regexp (I know this is a trivial problem when not using a single regexp)

    Read the article

  • Need to add specific characters to regular expression

    - by lordryan
    i'm using the following regular expression to form a basic email validation. var emailRegEx = /^([a-zA-Z0-9])(([a-zA-Z0-9])*([\._\+-])*([a-zA-Z0-9]))*@(([a-zA-Z0-9\-])+(\.))+([a-zA-Z]{2,4})+$/; this works pretty well for what i need but i also need to exclude these specific characters for reasons i won't go into. !,#,$,%,^,&,*,(,),-,+,|,{,},[,],:,>,<,?,/,\,= - (the characters between the "," if that isn't clear) could someone help me with adding the second group to the first? I know the pro's and cons of using javascript to validate email addresses - i have to do it this way. thanks.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >