Search Results

Search found 6103 results on 245 pages for 'nhibernate expression'.

Page 134/245 | < Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • CodePlex Daily Summary for Sunday, November 20, 2011

    CodePlex Daily Summary for Sunday, November 20, 2011Popular ReleasesFree SharePoint 2010 Sites Templates: SharePoint Server 2010 Sites Templates: here is the list of sites templates to be downloadednopCommerce. Open source shopping cart (ASP.NET MVC): nopcommerce 2.30: Highlight features & improvements: • Performance optimization. • Back in stock notifications. • Product special price support. • Catalog mode (based on customer role) To see the full list of fixes and changes please visit the release notes page (http://www.nopCommerce.com/releasenotes.aspx).Cetacean Monitoring: Cetacean Monitoring Project Release V 0.1: This is a zip with a working executable for evaluation purposes.WPF Converters: WPF Converters V1.2.0.0: support for enumerations, value types, and reference types in the expression converter's equality operators the expression converter now handles DependencyProperty.UnsetValue as argument values correctly (#4062) StyleCop conformance (more or less)Json.NET: Json.NET 4.0 Release 4: Change - JsonTextReader.Culture is now CultureInfo.InvariantCulture by default Change - KeyValurPairConverter no longer cares about the order of the key and value properties Change - Time zone conversions now use new TimeZoneInfo instead of TimeZone Fix - Fixed boolean values sometimes being capitalized when converting to XML Fix - Fixed error when deserializing ConcurrentDictionary Fix - Fixed serializing some Uris returning the incorrect value Fix - Fixed occasional error when...Media Companion: MC 3.423b Weekly: Ensure .NET 4.0 Full Framework is installed. (Available from http://www.microsoft.com/download/en/details.aspx?id=17718) Ensure the NFO ID fix is applied when transitioning from versions prior to 3.416b. (Details here) Replaced 'Rebuild' with 'Refresh' throughout entire code. Rebuild will now be known as Refresh. mc_com.exe has been fully updated TV Show Resolutions... Resolved issue #206 - having to hit save twice when updating runtime manually Shrunk cache size and lowered loading times f...Delta Engine: Delta Engine Beta Preview v0.9.1: v0.9.1 beta release with lots of refactoring, fixes, new samples and support for iOS, Android and WP7 (you need a Marketplace account however). If you want a binary release for the games (like v0.9.0), just say so in the Forum or here and we will quickly prepare one. It is just not much different from v0.9.0, so I left it out this time. See http://DeltaEngine.net/Wiki.Roadmap for details.ASP.net Awesome Samples (Web-Forms): 1.0 samples: Full Demo VS2008 Very Simple Demo VS2010 (demos for the ASP.net Awesome jQuery Ajax Controls)SharpMap - Geospatial Application Framework for the CLR: SharpMap-0.9-AnyCPU-Trunk-2011.11.17: This is a build of SharpMap from the 0.9 development trunk as per 2011-11-17 For most applications the AnyCPU release is the recommended, but in case you need an x86 build that is included to. For some dataproviders (GDAL/OGR, SqLite, PostGis) you need to also referense the SharpMap.Extensions assembly For SqlServer Spatial you need to reference the SharpMap.SqlServerSpatial assemblySQL Monitor - tracking sql server activities: SQLMon 4.1 alpha 5: 1. added basic schema support 2. added server instance name and process id 3. fixed problem with object search index out of range 4. improved version comparison with previous/next difference navigation 5. remeber main window spliter and object explorer spliter positionAJAX Control Toolkit: November 2011 Release: AJAX Control Toolkit Release Notes - November 2011 Release Version 51116November 2011 release of the AJAX Control Toolkit. AJAX Control Toolkit .NET 4 - Binary – AJAX Control Toolkit for .NET 4 and sample site (Recommended). AJAX Control Toolkit .NET 3.5 - Binary – AJAX Control Toolkit for .NET 3.5 and sample site (Recommended). Notes: - The current version of the AJAX Control Toolkit is not compatible with ASP.NET 2.0. The latest version that is compatible with ASP.NET 2.0 can be found h...MVC Controls Toolkit: Mvc Controls Toolkit 1.5.5: Added: Now the DateRanteAttribute accepts complex expressions containing "Now" and "Today" as static minimum and maximum. Menu, MenuFor helpers capable of handling a "currently selected element". The developer can choose between using a standard nested menu based on a standard SimpleMenuItem class or specifying an item template based on a custom class. Added also helpers to build the tree structure containing all data items the menu takes infos from. Improved the pager. Now the developer ...SharpCompress - a fully native C# library for RAR, 7Zip, Zip, Tar, GZip, BZip2: SharpCompress 0.7: Reworked API to be more consistent. See Supported formats table. Added some more helper methods - e.g. OpenEntryStream (RarArchive/RarReader does not support this) Fixed up testsSilverlight Toolkit: Windows Phone Toolkit - Nov 2011 (7.1 SDK): This release is coming soon! What's new ListPicker once again works in a ScrollViewer LongListSelector bug fixes around OutOfRange exceptions, wrong ordering of items, grouping issues, and scrolling events. ItemTuple is now refactored to be the public type LongListSelectorItem to provide users better access to the values in selection changed handlers. PerformanceProgressBar binding fix for IsIndeterminate (item 9767 and others) There is no longer a GestureListener dependency with the C...DotNetNuke® Community Edition: 06.01.01: Major Highlights Fixed problem with the core skin object rendering CSS above the other framework inserted files, which caused problems when using core style skin objects Fixed issue with iFrames getting removed when content is saved Fixed issue with the HTML module removing styling and scripts from the content Fixed issue with inserting the link to jquery after the header of the page Security Fixesnone Updated Modules/Providers ModulesHTML version 6.1.0 ProvidersnoneDotNetNuke Performance Settings: 01.00.00: First release of DotNetNuke SQL update queries to set the DNN installation for optimimal performance. Please review and rate this release... (stars are welcome)SCCM Client Actions Tool: SCCM Client Actions Tool v0.8: SCCM Client Actions Tool v0.8 is currently the latest version. It comes with following changes since last version: Added "Wake On LAN" action. WOL.EXE is now included. Added new action "Get all active advertisements" to list all machine based advertisements on remote computers. Added new action "Get all active user advertisements" to list all user based advertisements for logged on users on remote computers. Added config.ini setting "enablePingTest" to control whether ping test is ru...C.B.R. : Comic Book Reader: CBR 0.3: New featuresAdd magnifier size and scale New file info view in the backstage Add dynamic properties on book and settings Sorting and grouping in the explorer with new design Rework on conversion : Images, PDF, Cbr/rar, Cbz/zip, Xps to the destination formats Images, Cbz and XPS ImprovmentsSuppress MainViewModel and ExplorerViewModel dependencies Add view notifications and Messages from MVVM Light for ViewModel=>View notifications Make thread better on open catalog, no more ihm freeze, less t...Desktop Google Reader: 1.4.2: This release remove the like and the broadcast buttons as Google Reader stopped supporting them (no, we don't like this decission...) Additionally and to have at least a small plus: the login window now automaitcally logs you in if you stored username and passwort (no more extra click needed) Finally added WebKit .NET to the about window and removed Awesomium MD5-Hash: 5fccf25a2fb4fecc1dc77ebabc8d3897 SHA-Hash: d44ff788b123bd33596ad1a75f3b9fa74a862fdbRDRemote: Remote Desktop remote configurator V 1.0.0: Remote Desktop remote configurator V 1.0.0New ProjectsAutonomous Robot Combat: The project is about a Robotic game arena where 6-8 robots will engage in a team combat using infrared guns. The infrared guns will also have red light LEDs to simulate muzzle flash. Once the project finishes, it will be displayed in University of Plymouth.B2BPro: B2BPro best solution for businessBattlestar Galactica Fighters: Battlestar Galactica Fighters is a 3D vertical scrolling shoot 'em up. It's developed in C# and F# for the XNA Programming exam at Master in Computer Game Developement 2011/2012 in Verona, Italy.Content Compiler 3 - Compile your XNA media outside Visual Studio!: The Content Compiler helps you to compile your media files for use with XNA without using Visual Studio. After almost three years of Development, the third version of the CCompiler is nearly finished and we decided to put it up on Codeplex to "keep it alive".CreaMotion NHibernate Class Builder: NHibernate Class Builder C# , WPF Supports all type relations Supports MsSql, MySql -- Specially developed for NHibernate Learnersecs_tqdt_kd: Electric Custom System Thông quan di?n t? Kinh DoanhIMDb Helper: IMDb Helper is a C# library that provides access to information in the IMDb website. IMDb Helper uses web requests to access the IMDb website, and regular expressions to parse the responses (it doesn't use any external library, only pure .NET). Lion Solution: This is an open source Accounting project for small business usage. Developed by: Sleiman Jneidi Hussein Zawawi Management of Master Lists in SharePoint with Choice Filter Lookup column: Management of Master Lists in SharePoint with Choice Filter Lookup column you can view the detail of the project on http://sharepointarrow.blogspot.com/2011/11/management-of-master-lists-in.htmlMRDS FezMini Robot Brick: This is an attemp to write services for MRDS to control a FezMini Robot with a wireless connection attached to COM2 on the FezMini Board.MVC Route Unit Tester: Provides convenient, easy to use methods that let you unit test the route table in your ASP.NET MVC application. Unlike many libraries, this lets you test routes both ways -- both incoming and going. You can specify an incoming request and assert that it matches a given route (or that there are no matches). You can also specify route data and assert that a given URL will be generated by your application.MyWalk: MyWalk (codename: MyLife) is a novel health application that makes tracking walking a part of daily life. NGeo: NGeo makes it easier for users of geographic data to invoke GeoNames and Yahoo! GeoPlanet / PlaceFinder services. You'll no longer have to write your own GeoNames, GeoPlanet, or PlaceFinder clients. It's developed in ASP.NET 4.0, and uses WCF ServiceModel libraries to deserialize JSON data into Plain Old C# Objects.Octopus Tools: Octopus is an automated deployment server for .NET applications, powered by NuGet. OctopusTools is a set of useful command line and MSBuild tasks designed for automating Octopus.PDV Moveis: Loja MoveisReddit#: Reddit# is a Reddit library for C# or other .Net languages.Rubik: Rubik is, simply, a stab at creating a decent implementation of a Rubik's cube in WPF, and in the process aplying MVVM to the 3D game milieu.Sample Service-Oriented Architecture: Sample of service-oriented architecture using WCF.SFinger: SFinger adds two finger scrolling to synaptics touchpad on Windows. SigemFinal: Versión final del proyecto de diseñoSlResource: silverlight resource managementSonce - Simple ON-line Circuit Editor: Circuit Editor in Silverlight, unfinished student project written in C#Tricofil: Site da Tricofil com Administrador de ConteudoTwincat Ads .Net Client: This is the client implementation of the Ads/Ams protocol created by Beckhoff. (I'm not affiliated with Beckhoff) This implementation will be in C# and will not depend on other libraries. This means it can be used in silverlight and windows phone projects. This project is not finished yet!!WomanMagazine: This is a woman Online Magazine with lot of info and entertainment resources for women

    Read the article

  • Why is Java EE 6 better than Spring ?

    - by arungupta
    Java EE 6 was released over 2 years ago and now there are 14 compliant application servers. In all my talks around the world, a question that is frequently asked is Why should I use Java EE 6 instead of Spring ? There are already several blogs covering that topic: Java EE wins over Spring by Bill Burke Why will I use Java EE instead of Spring in new Enterprise Java projects in 2012 ? by Kai Waehner (more discussion on TSS) Spring to Java EE migration (Part 1 and 2, 3 and 4 coming as well) by David Heffelfinger Spring to Java EE - A Migration Experience by Lincoln Baxter Migrating Spring to Java EE 6 by Bert Ertman and Paul Bakker at NLJUG Moving from Spring to Java EE 6 - The Age of Frameworks is Over at TSS Java EE vs Spring Shootout by Rohit Kelapure and Reza Rehman at JavaOne 2011 Java EE 6 and the Ewoks by Murat Yener Definite excuse to avoid Spring forever - Bert Ertman and Arun Gupta I will try to share my perspective in this blog. First of all, I'd like to start with a note: Thank you Spring framework for filling the interim gap and providing functionality that is now included in the mainstream Java EE 6 application servers. The Java EE platform has evolved over the years learning from frameworks like Spring and provides all the functionality to build an enterprise application. Thank you very much Spring framework! While Spring was revolutionary in its time and is still very popular and quite main stream in the same way Struts was circa 2003, it really is last generation's framework - some people are even calling it legacy. However my theory is "code is king". So my approach is to build/take a simple Hello World CRUD application in Java EE 6 and Spring and compare the deployable artifacts. I started looking at the official tutorial Developing a Spring Framework MVC Application Step-by-Step but it is using the older version 2.5. I wasn't able to find any updated version in the current 3.1 release. Next, I downloaded Spring Tool Suite and thought that would provide some template samples to get started. A least a quick search did not show any handy tutorials - either video or text-based. So I searched and found a link to their SVN repository at src.springframework.org/svn/spring-samples/. I tried the "mvc-basic" sample and the generated WAR file was 4.43 MB. While it was named a "basic" sample it seemed to come with 19 different libraries bundled but it was what I could find: ./WEB-INF/lib/aopalliance-1.0.jar./WEB-INF/lib/hibernate-validator-4.1.0.Final.jar./WEB-INF/lib/jcl-over-slf4j-1.6.1.jar./WEB-INF/lib/joda-time-1.6.2.jar./WEB-INF/lib/joda-time-jsptags-1.0.2.jar./WEB-INF/lib/jstl-1.2.jar./WEB-INF/lib/log4j-1.2.16.jar./WEB-INF/lib/slf4j-api-1.6.1.jar./WEB-INF/lib/slf4j-log4j12-1.6.1.jar./WEB-INF/lib/spring-aop-3.0.5.RELEASE.jar./WEB-INF/lib/spring-asm-3.0.5.RELEASE.jar./WEB-INF/lib/spring-beans-3.0.5.RELEASE.jar./WEB-INF/lib/spring-context-3.0.5.RELEASE.jar./WEB-INF/lib/spring-context-support-3.0.5.RELEASE.jar./WEB-INF/lib/spring-core-3.0.5.RELEASE.jar./WEB-INF/lib/spring-expression-3.0.5.RELEASE.jar./WEB-INF/lib/spring-web-3.0.5.RELEASE.jar./WEB-INF/lib/spring-webmvc-3.0.5.RELEASE.jar./WEB-INF/lib/validation-api-1.0.0.GA.jar And it is not even using any database! The app deployed fine on GlassFish 3.1.2 but the "@Controller Example" link did not work as it was missing the context root. With a bit of tweaking I could deploy the application and assume that the account got created because no error was displayed in the browser or server log. Next I generated the WAR for "mvc-ajax" and the 5.1 MB WAR had 20 JARs (1 removed, 2 added): ./WEB-INF/lib/aopalliance-1.0.jar./WEB-INF/lib/hibernate-validator-4.1.0.Final.jar./WEB-INF/lib/jackson-core-asl-1.6.4.jar./WEB-INF/lib/jackson-mapper-asl-1.6.4.jar./WEB-INF/lib/jcl-over-slf4j-1.6.1.jar./WEB-INF/lib/joda-time-1.6.2.jar./WEB-INF/lib/jstl-1.2.jar./WEB-INF/lib/log4j-1.2.16.jar./WEB-INF/lib/slf4j-api-1.6.1.jar./WEB-INF/lib/slf4j-log4j12-1.6.1.jar./WEB-INF/lib/spring-aop-3.0.5.RELEASE.jar./WEB-INF/lib/spring-asm-3.0.5.RELEASE.jar./WEB-INF/lib/spring-beans-3.0.5.RELEASE.jar./WEB-INF/lib/spring-context-3.0.5.RELEASE.jar./WEB-INF/lib/spring-context-support-3.0.5.RELEASE.jar./WEB-INF/lib/spring-core-3.0.5.RELEASE.jar./WEB-INF/lib/spring-expression-3.0.5.RELEASE.jar./WEB-INF/lib/spring-web-3.0.5.RELEASE.jar./WEB-INF/lib/spring-webmvc-3.0.5.RELEASE.jar./WEB-INF/lib/validation-api-1.0.0.GA.jar 2 more JARs for just doing Ajax. Anyway, deploying this application gave the following error: Caused by: java.lang.NoSuchMethodError: org.codehaus.jackson.map.SerializationConfig.<init>(Lorg/codehaus/jackson/map/ClassIntrospector;Lorg/codehaus/jackson/map/AnnotationIntrospector;Lorg/codehaus/jackson/map/introspect/VisibilityChecker;Lorg/codehaus/jackson/map/jsontype/SubtypeResolver;)V    at org.springframework.samples.mvc.ajax.json.ConversionServiceAwareObjectMapper.<init>(ConversionServiceAwareObjectMapper.java:20)    at org.springframework.samples.mvc.ajax.json.JacksonConversionServiceConfigurer.postProcessAfterInitialization(JacksonConversionServiceConfigurer.java:40)    at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.applyBeanPostProcessorsAfterInitialization(AbstractAutowireCapableBeanFactory.java:407) Seems like some incorrect repos in the "pom.xml". Next one is "mvc-showcase" and the 6.49 MB WAR now has 28 JARs as shown below: ./WEB-INF/lib/aopalliance-1.0.jar./WEB-INF/lib/aspectjrt-1.6.10.jar./WEB-INF/lib/commons-fileupload-1.2.2.jar./WEB-INF/lib/commons-io-2.0.1.jar./WEB-INF/lib/el-api-2.2.jar./WEB-INF/lib/hibernate-validator-4.1.0.Final.jar./WEB-INF/lib/jackson-core-asl-1.8.1.jar./WEB-INF/lib/jackson-mapper-asl-1.8.1.jar./WEB-INF/lib/javax.inject-1.jar./WEB-INF/lib/jcl-over-slf4j-1.6.1.jar./WEB-INF/lib/jdom-1.0.jar./WEB-INF/lib/joda-time-1.6.2.jar./WEB-INF/lib/jstl-api-1.2.jar./WEB-INF/lib/jstl-impl-1.2.jar./WEB-INF/lib/log4j-1.2.16.jar./WEB-INF/lib/rome-1.0.0.jar./WEB-INF/lib/slf4j-api-1.6.1.jar./WEB-INF/lib/slf4j-log4j12-1.6.1.jar./WEB-INF/lib/spring-aop-3.1.0.RELEASE.jar./WEB-INF/lib/spring-asm-3.1.0.RELEASE.jar./WEB-INF/lib/spring-beans-3.1.0.RELEASE.jar./WEB-INF/lib/spring-context-3.1.0.RELEASE.jar./WEB-INF/lib/spring-context-support-3.1.0.RELEASE.jar./WEB-INF/lib/spring-core-3.1.0.RELEASE.jar./WEB-INF/lib/spring-expression-3.1.0.RELEASE.jar./WEB-INF/lib/spring-web-3.1.0.RELEASE.jar./WEB-INF/lib/spring-webmvc-3.1.0.RELEASE.jar./WEB-INF/lib/validation-api-1.0.0.GA.jar The app at least deployed and showed results this time. But still no database! Next I tried building "jpetstore" and got the error: [ERROR] Failed to execute goal on project org.springframework.samples.jpetstore:Could not resolve dependencies for project org.springframework.samples:org.springframework.samples.jpetstore:war:1.0.0-SNAPSHOT: Failed to collect dependencies for [commons-fileupload:commons-fileupload:jar:1.2.1 (compile), org.apache.struts:com.springsource.org.apache.struts:jar:1.2.9 (compile), javax.xml.rpc:com.springsource.javax.xml.rpc:jar:1.1.0 (compile), org.apache.commons:com.springsource.org.apache.commons.dbcp:jar:1.2.2.osgi (compile), commons-io:commons-io:jar:1.3.2 (compile), hsqldb:hsqldb:jar:1.8.0.7 (compile), org.apache.tiles:tiles-core:jar:2.2.0 (compile), org.apache.tiles:tiles-jsp:jar:2.2.0 (compile), org.tuckey:urlrewritefilter:jar:3.1.0 (compile), org.springframework:spring-webmvc:jar:3.0.0.BUILD-SNAPSHOT (compile), org.springframework:spring-orm:jar:3.0.0.BUILD-SNAPSHOT (compile), org.springframework:spring-context-support:jar:3.0.0.BUILD-SNAPSHOT (compile), org.springframework.webflow:spring-js:jar:2.0.7.RELEASE (compile), org.apache.ibatis:com.springsource.com.ibatis:jar:2.3.4.726 (runtime), com.caucho:com.springsource.com.caucho:jar:3.2.1 (compile), org.apache.axis:com.springsource.org.apache.axis:jar:1.4.0 (compile), javax.wsdl:com.springsource.javax.wsdl:jar:1.6.1 (compile), javax.servlet:jstl:jar:1.2 (runtime), org.aspectj:aspectjweaver:jar:1.6.5 (compile), javax.servlet:servlet-api:jar:2.5 (provided), javax.servlet.jsp:jsp-api:jar:2.1 (provided), junit:junit:jar:4.6 (test)]: Failed to read artifact descriptor for org.springframework:spring-webmvc:jar:3.0.0.BUILD-SNAPSHOT: Could not transfer artifact org.springframework:spring-webmvc:pom:3.0.0.BUILD-SNAPSHOT from/to JBoss repository (http://repository.jboss.com/maven2): Access denied to: http://repository.jboss.com/maven2/org/springframework/spring-webmvc/3.0.0.BUILD-SNAPSHOT/spring-webmvc-3.0.0.BUILD-SNAPSHOT.pom It appears the sample is broken - maybe I was pulling from the wrong repository - would be great if someone were to point me at a good target to use here. With a 50% hit on samples in this repository, I started searching through numerous blogs, most of which have either outdated information (using XML-heavy Spring 2.5), some piece of configuration (which is a typical "feature" of Spring) is missing, or too much complexity in the sample. I finally found this blog that worked like a charm. This blog creates a trivial Spring MVC 3 application using Hibernate and MySQL. This application performs CRUD operations on a single table in a database using typical Spring technologies.  I downloaded the sample code from the blog, deployed it on GlassFish 3.1.2 and could CRUD the "person" entity. The source code for this application can be downloaded here. More details on the application statistics below. And then I built a similar CRUD application in Java EE 6 using NetBeans wizards in a couple of minutes. The source code for the application can be downloaded here and the WAR here. The Spring Source Tool Suite may also offer similar wizard-driven capabilities but this blog focus primarily on comparing the runtimes. The lack of STS tutorials was slightly disappointing as well. NetBeans however has tons of text-based and video tutorials and tons of material even by the community. One more bit on the download size of tools bundle ... NetBeans 7.1.1 "All" is 211 MB (which includes GlassFish and Tomcat) Spring Tool Suite  2.9.0 is 347 MB (~ 65% bigger) This blog is not about the tooling comparison so back to the Java EE 6 version of the application .... In order to run the Java EE version on GlassFish, copy the MySQL Connector/J to glassfish3/glassfish/domains/domain1/lib/ext directory and create a JDBC connection pool and JDBC resource as: ./bin/asadmin create-jdbc-connection-pool --datasourceclassname \\ com.mysql.jdbc.jdbc2.optional.MysqlDataSource --restype \\ javax.sql.DataSource --property \\ portNumber=3306:user=mysql:password=mysql:databaseName=mydatabase \\ myConnectionPool ./bin/asadmin create-jdbc-resource --connectionpoolid myConnectionPool jdbc/myDataSource I generated WARs for the two projects and the table below highlights some differences between them: Java EE 6 Spring WAR File Size 0.021030 MB 10.87 MB (~516x) Number of files 20 53 (> 2.5x) Bundled libraries 0 36 Total size of libraries 0 12.1 MB XML files 3 5 LoC in XML files 50 (11 + 15 + 24) 129 (27 + 46 + 16 + 11 + 19) (~ 2.5x) Total .properties files 1 Bundle.properties 2 spring.properties, log4j.properties Cold Deploy 5,339 ms 11,724 ms Second Deploy 481 ms 6,261 ms Third Deploy 528 ms 5,484 ms Fourth Deploy 484 ms 5,576 ms Runtime memory ~73 MB ~101 MB Some points worth highlighting from the table ... 516x WAR file, 10x deployment time - With 12.1 MB of libraries (for a very basic application) bundled in your application, the WAR file size and the deployment time will naturally go higher. The WAR file for Spring-based application is 516x bigger and the deployment time is double during the first deployment and ~ 10x during subsequent deployments. The Java EE 6 application is fully portable and will run on any Java EE 6 compliant application server. 36 libraries in the WAR - There are 14 Java EE 6 compliant application servers today. Each of those servers provide all the functionality like transactions, dependency injection, security, persistence, etc typically required of an enterprise or web application. There is no need to bundle 36 libraries worth 12.1 MB for a trivial CRUD application. These 14 compliant application servers provide all the functionality baked in. Now you can also deploy these libraries in the container but then you don't get the "portability" offered by Spring in that case. Does your typical Spring deployment actually do that ? 3x LoC in XML - The number of XML files is about 1.6x and the LoC is ~ 2.5x. So much XML seems circa 2003 when the Java language had no annotations. The XML files can be further reduced, e.g. faces-config.xml can be replaced without providing i18n, but I just want to compare stock applications. Memory usage - Both the applications were deployed on default GlassFish 3.1.2 installation and any additional memory consumed as part of deployment/access was attributed to the application. This is by no means scientific but at least provides an initial ballpark. This area definitely needs more investigation. Another table that compares typical Java EE 6 compliant application servers and the custom-stack created for a Spring application ... Java EE 6 Spring Web Container ? 53 MB (tcServer 2.6.3 Developer Edition) Security ? 12 MB (Spring Security 3.1.0) Persistence ? 6.3 MB (Hibernate 4.1.0, required) Dependency Injection ? 5.3 MB (Framework) Web Services ? 796 KB (Spring WS 2.0.4) Messaging ? 3.4 MB (RabbitMQ Server 2.7.1) 936 KB (Java client 936) OSGi ? 1.3 MB (Spring OSGi 1.2.1) GlassFish and WebLogic (starting at 33 MB) 83.3 MB There are differentiating factors on both the stacks. But most of the functionality like security, persistence, and dependency injection is baked in a Java EE 6 compliant application server but needs to be individually managed and patched for a Spring application. This very quickly leads to a "stack explosion". The Java EE 6 servers are tested extensively on a variety of platforms in different combinations whereas a Spring application developer is responsible for testing with different JDKs, Operating Systems, Versions, Patches, etc. Oracle has both the leading OSS lightweight server with GlassFish and the leading enterprise Java server with WebLogic Server, both Java EE 6 and both with lightweight deployment options. The Web Container offered as part of a Java EE 6 application server not only deploys your enterprise Java applications but also provide operational management, diagnostics, and mission-critical capabilities required by your applications. The Java EE 6 platform also introduced the Web Profile which is a subset of the specifications from the entire platform. It is targeted at developers of modern web applications offering a reasonably complete stack, composed of standard APIs, and is capable out-of-the-box of addressing the needs of a large class of Web applications. As your applications grow, the stack can grow to the full Java EE 6 platform. The GlassFish Server Web Profile starting at 33MB (smaller than just the non-standard tcServer) provides most of the functionality typically required by a web application. WebLogic provides battle-tested functionality for a high throughput, low latency, and enterprise grade web application. No individual managing or patching, all tested and commercially supported for you! Note that VMWare does have a server, tcServer, but it is non-standard and not even certified to the level of the standard Web Profile most customers expect these days. Customers who choose this risk proprietary lock-in since VMWare does not seem to want to formally certify with either Java EE 6 Enterprise Platform or with Java EE 6 Web Profile but of course it would be great if they were to join the community and help their customers reduce the risk of deploying on VMWare software. Some more points to help you decide choose between Java EE 6 and Spring ... Freedom to choose container - There are 14 Java EE 6 compliant application servers today, with a variety of open source and commercial offerings. A Java EE 6 application can be deployed on any of those containers. So if you deployed your application on GlassFish today and would like to scale up with your demands then you can deploy the same application to WebLogic. And because of the portability of a Java EE 6 application, you can even take it a different vendor altogether. Spring requires a runtime which could be any of these app servers as well. But why use Spring when all the required functionality is already baked into the application server itself ? Spring also has a different definition of portability where they claim to bundle all the libraries in the WAR file and move to any application server. But we saw earlier how bloated that archive could be. The equivalent features in Spring runtime offerings (mainly tcServer) are not all open source, not as mature, and often require manual assembly.  Vendor choice - The Java EE 6 platform is created using the Java Community Process where all the big players like Oracle, IBM, RedHat, and Apache are conritbuting to make the platform successful. Each application server provides the basic Java EE 6 platform compliance and has its own competitive offerings. This allows you to choose an application server for deploying your Java EE 6 applications. If you are not happy with the support or feature of one vendor then you can move your application to a different vendor because of the portability promise offered by the platform. Spring is a set of products from a single company, one price book, one support organization, one sustaining organization, one sales organization, etc. If any of those cause a customer headache, where do you go ? Java EE, backed by multiple vendors, is a safer bet for those that are risk averse. Production support - With Spring, typically you need to get support from two vendors - VMWare and the container provider. With Java EE 6, all of this is typically provided by one vendor. For example, Oracle offers commercial support from systems, operating systems, JDK, application server, and applications on top of them. VMWare certainly offers complete production support but do you really want to put all your eggs in one basket ? Do you really use tcServer ? ;-) Maintainability - With Spring, you are likely building your own distribution with multiple JAR files, integrating, patching, versioning, etc of all those components. Spring's claim is that multiple JAR files allow you to go à la carte and pick the latest versions of different components. But who is responsible for testing whether all these versions work together ? Yep, you got it, its YOU! If something does not work, who patches and maintains the JARs ? Of course, you! Commercial support for such a configuration ? On your own! The Java EE application servers manage all of this for you and provide a well-tested and commercially supported bundle. While it is always good to realize that there is something new and improved that updates and replaces older frameworks like Spring, the good news is not only does a Java EE 6 container offer what is described here, most also will let you deploy and run your Spring applications on them while you go through an upgrade to a more modern architecture. End result, you get the best of both worlds - keeping your legacy investment but moving to a more agile, lightweight world of Java EE 6. A message to the Spring lovers ... The complexity in J2EE 1.2, 1.3, and 1.4 led to the genesis of Spring but that was in 2004. This is 2012 and the name has changed to "Java EE 6" :-) There are tons of improvements in the Java EE platform to make it easy-to-use and powerful. Some examples: Adding @Stateless on a POJO makes it an EJB EJBs can be packaged in a WAR with no special packaging or deployment descriptors "web.xml" and "faces-config.xml" are optional in most of the common cases Typesafe dependency injection is now part of the Java EE platform Add @Path on a POJO allows you to publish it as a RESTful resource EJBs can be used as backing beans for Facelets-driven JSF pages providing full MVC Java EE 6 WARs are known to be kilobytes in size and deployed in milliseconds Tons of other simplifications in the platform and application servers So if you moved away from J2EE to Spring many years ago and have not looked at Java EE 6 (which has been out since Dec 2009) then you should definitely try it out. Just be at least aware of what other alternatives are available instead of restricting yourself to one stack. Here are some workshops and screencasts worth trying: screencast #37 shows how to build an end-to-end application using NetBeans screencast #36 builds the same application using Eclipse javaee-lab-feb2012.pdf is a 3-4 hours self-paced hands-on workshop that guides you to build a comprehensive Java EE 6 application using NetBeans Each city generally has a "spring cleanup" program every year. It allows you to clean up the mess from your house. For your software projects, you don't need to wait for an annual event, just get started and reduce the technical debt now! Move away from your legacy Spring-based applications to a lighter and more modern approach of building enterprise Java applications using Java EE 6. Watch this beautiful presentation that explains how to migrate from Spring -> Java EE 6: List of files in the Java EE 6 project: ./index.xhtml./META-INF./person./person/Create.xhtml./person/Edit.xhtml./person/List.xhtml./person/View.xhtml./resources./resources/css./resources/css/jsfcrud.css./template.xhtml./WEB-INF./WEB-INF/classes./WEB-INF/classes/Bundle.properties./WEB-INF/classes/META-INF./WEB-INF/classes/META-INF/persistence.xml./WEB-INF/classes/org./WEB-INF/classes/org/javaee./WEB-INF/classes/org/javaee/javaeemysql./WEB-INF/classes/org/javaee/javaeemysql/AbstractFacade.class./WEB-INF/classes/org/javaee/javaeemysql/Person.class./WEB-INF/classes/org/javaee/javaeemysql/Person_.class./WEB-INF/classes/org/javaee/javaeemysql/PersonController$1.class./WEB-INF/classes/org/javaee/javaeemysql/PersonController$PersonControllerConverter.class./WEB-INF/classes/org/javaee/javaeemysql/PersonController.class./WEB-INF/classes/org/javaee/javaeemysql/PersonFacade.class./WEB-INF/classes/org/javaee/javaeemysql/util./WEB-INF/classes/org/javaee/javaeemysql/util/JsfUtil.class./WEB-INF/classes/org/javaee/javaeemysql/util/PaginationHelper.class./WEB-INF/faces-config.xml./WEB-INF/web.xml List of files in the Spring 3.x project: ./META-INF ./META-INF/MANIFEST.MF./WEB-INF./WEB-INF/applicationContext.xml./WEB-INF/classes./WEB-INF/classes/log4j.properties./WEB-INF/classes/org./WEB-INF/classes/org/krams ./WEB-INF/classes/org/krams/tutorial ./WEB-INF/classes/org/krams/tutorial/controller ./WEB-INF/classes/org/krams/tutorial/controller/MainController.class ./WEB-INF/classes/org/krams/tutorial/domain ./WEB-INF/classes/org/krams/tutorial/domain/Person.class ./WEB-INF/classes/org/krams/tutorial/service ./WEB-INF/classes/org/krams/tutorial/service/PersonService.class ./WEB-INF/hibernate-context.xml ./WEB-INF/hibernate.cfg.xml ./WEB-INF/jsp ./WEB-INF/jsp/addedpage.jsp ./WEB-INF/jsp/addpage.jsp ./WEB-INF/jsp/deletedpage.jsp ./WEB-INF/jsp/editedpage.jsp ./WEB-INF/jsp/editpage.jsp ./WEB-INF/jsp/personspage.jsp ./WEB-INF/lib ./WEB-INF/lib/antlr-2.7.6.jar ./WEB-INF/lib/aopalliance-1.0.jar ./WEB-INF/lib/c3p0-0.9.1.2.jar ./WEB-INF/lib/cglib-nodep-2.2.jar ./WEB-INF/lib/commons-beanutils-1.8.3.jar ./WEB-INF/lib/commons-collections-3.2.1.jar ./WEB-INF/lib/commons-digester-2.1.jar ./WEB-INF/lib/commons-logging-1.1.1.jar ./WEB-INF/lib/dom4j-1.6.1.jar ./WEB-INF/lib/ejb3-persistence-1.0.2.GA.jar ./WEB-INF/lib/hibernate-annotations-3.4.0.GA.jar ./WEB-INF/lib/hibernate-commons-annotations-3.1.0.GA.jar ./WEB-INF/lib/hibernate-core-3.3.2.GA.jar ./WEB-INF/lib/javassist-3.7.ga.jar ./WEB-INF/lib/jstl-1.1.2.jar ./WEB-INF/lib/jta-1.1.jar ./WEB-INF/lib/junit-4.8.1.jar ./WEB-INF/lib/log4j-1.2.14.jar ./WEB-INF/lib/mysql-connector-java-5.1.14.jar ./WEB-INF/lib/persistence-api-1.0.jar ./WEB-INF/lib/slf4j-api-1.6.1.jar ./WEB-INF/lib/slf4j-log4j12-1.6.1.jar ./WEB-INF/lib/spring-aop-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-asm-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-beans-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-context-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-context-support-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-core-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-expression-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-jdbc-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-orm-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-tx-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-web-3.0.5.RELEASE.jar ./WEB-INF/lib/spring-webmvc-3.0.5.RELEASE.jar ./WEB-INF/lib/standard-1.1.2.jar ./WEB-INF/lib/xml-apis-1.0.b2.jar ./WEB-INF/spring-servlet.xml ./WEB-INF/spring.properties ./WEB-INF/web.xml So, are you excited about Java EE 6 ? Want to get started now ? Here are some resources: Java EE 6 SDK (including runtime, samples, tutorials etc) GlassFish Server Open Source Edition 3.1.2 (Community) Oracle GlassFish Server 3.1.2 (Commercial) Java EE 6 using WebLogic 12c and NetBeans (Video) Java EE 6 with NetBeans and GlassFish (Video) Java EE with Eclipse and GlassFish (Video)

    Read the article

  • Validation in Silverlight

    - by Timmy Kokke
    Getting started with the basics Validation in Silverlight can get very complex pretty easy. The DataGrid control is the only control that does data validation automatically, but often you want to validate your own entry form. Values a user may enter in this form can be restricted by the customer and have to fit an exact fit to a list of requirements or you just want to prevent problems when saving the data to the database. Showing a message to the user when a value is entered is pretty straight forward as I’ll show you in the following example.     This (default) Silverlight textbox is data-bound to a simple data class. It has to be bound in “Two-way” mode to be sure the source value is updated when the target value changes. The INotifyPropertyChanged interface must be implemented by the data class to get the notification system to work. When the property changes a simple check is performed and when it doesn’t match some criteria an ValidationException is thrown. The ValidatesOnExceptions binding attribute is set to True to tell the textbox it should handle the thrown ValidationException. Let’s have a look at some code now. The xaml should contain something like below. The most important part is inside the binding. In this case the Text property is bound to the “Name” property in TwoWay mode. It is also told to validate on exceptions. This property is false by default.   <StackPanel Orientation="Horizontal"> <TextBox Width="150" x:Name="Name" Text="{Binding Path=Name, Mode=TwoWay, ValidatesOnExceptions=True}"/> <TextBlock Text="Name"/> </StackPanel>   The data class in this first example is a very simplified person class with only one property: string Name. The INotifyPropertyChanged interface is implemented and the PropertyChanged event is fired when the Name property changes. When the property changes a check is performed to see if the new string is null or empty. If this is the case a ValidationException is thrown explaining that the entered value is invalid.   public class PersonData:INotifyPropertyChanged { private string _name; public string Name { get { return _name; } set { if (_name != value) { if(string.IsNullOrEmpty(value)) throw new ValidationException("Name is required"); _name = value; if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Name")); } } } public event PropertyChangedEventHandler PropertyChanged=delegate { }; } The last thing that has to be done is letting binding an instance of the PersonData class to the DataContext of the control. This is done in the code behind file. public partial class Demo1 : UserControl { public Demo1() { InitializeComponent(); this.DataContext = new PersonData() {Name = "Johnny Walker"}; } }   Error Summary In many cases you would have more than one entry control. A summary of errors would be nice in such case. With a few changes to the xaml an error summary, like below, can be added.           First, add a namespace to the xaml so the control can be used. Add the following line to the header of the .xaml file. xmlns:Controls="clr-namespace:System.Windows.Controls;assembly=System.Windows.Controls.Data.Input"   Next, add the control to the layout. To get the result as in the image showed earlier, add the control right above the StackPanel from the first example. It’s got a small margin to separate it from the textbox a little.   <Controls:ValidationSummary Margin="8"/>   The ValidationSummary control has to be notified that an ValidationException occurred. This can be done with a small change to the xaml too. Add the NotifyOnValidationError to the binding expression. By default this value is set to false, so nothing would be notified. Set the property to true to get it to work.   <TextBox Width="150" x:Name="Name" Text="{Binding Name, Mode=TwoWay, ValidatesOnExceptions=True, NotifyOnValidationError=True}"/>   Data annotation Validating data in the setter is one option, but not my personal favorite. It’s the easiest way if you have a single required value you want to check, but often you want to validate more. Besides, I don’t consider it best practice to write logic in setters. The way used by frameworks like WCF Ria Services is the use of attributes on the properties. Instead of throwing exceptions you have to call the static method ValidateProperty on the Validator class. This call stays always the same for a particular property, not even when you change the attributes on the property. To mark a property “Required” you can use the RequiredAttribute. This is what the Name property is going to look like:   [Required] public string Name { get { return _name; } set { if (_name != value) { Validator.ValidateProperty(value, new ValidationContext(this, null, null){ MemberName = "Name" }); _name = value; if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Name")); } } }   The ValidateProperty method takes the new value for the property and an instance of ValidationContext. The properties passed to the constructor of the ValidationContextclass are very straight forward. This part is the same every time. The only thing that changes is the MemberName property of the ValidationContext. Property has to hold the name of the property you want to validate. It’s the same value you provide the PropertyChangedEventArgs with. The System.ComponentModel.DataAnnotation contains eight different validation attributes including a base class to create your own. They are: RequiredAttribute Specifies that a value must be provided. RangeAttribute The provide value must fall in the specified range. RegularExpressionAttribute Validates is the value matches the regular expression. StringLengthAttribute Checks if the number of characters in a string falls between a minimum and maximum amount. CustomValidationAttribute Use a custom method to validate the value. DataTypeAttribute Specify a data type using an enum or a custom data type. EnumDataTypeAttribute Makes sure the value is found in a enum. ValidationAttribute A base class for custom validation attributes All of these will ensure that an validation exception is thrown, except the DataTypeAttribute. This attribute is used to provide some additional information about the property. You can use this information in your own code.   [Required] [Range(0,125,ErrorMessage = "Value is not a valid age")] public int Age {   It’s no problem to stack different validation attributes together. For example, when an Age is required and must fall in the range from 0 to 125:   [Required, StringLength(255,MinimumLength = 3)] public string Name {   Or in one row like this, for a required Name with at least 3 characters and a maximum of 255:   Delayed validation Having properties marked as required can be very useful. The only downside to the technique described earlier is that you have to change the value in order to get it validated. What if you start out with empty an empty entry form? All fields are empty and thus won’t be validated. With this small trick you can validate at the moment the user click the submit button.   <TextBox Width="150" x:Name="NameField" Text="{Binding Name, Mode=TwoWay, ValidatesOnExceptions=True, NotifyOnValidationError=True, UpdateSourceTrigger=Explicit}"/>   By default, when a TwoWay bound control looses focus the value is updated. When you added validation like I’ve shown you earlier, the value is validated. To overcome this, you have to tell the binding update explicitly by setting the UpdateSourceTrigger binding property to Explicit:   private void SubmitButtonClick(object sender, RoutedEventArgs e) { NameField.GetBindingExpression(TextBox.TextProperty).UpdateSource(); }   This way, the binding is in two direction but the source is only updated, thus validated, when you tell it to. In the code behind you have to call the UpdateSource method on the binding expression, which you can get from the TextBox.   Conclusion Data validation is something you’ll probably want on almost every entry form. I always thought it was hard to do, but it wasn’t. If you can throw an exception you can do validation. If you want to know anything more in depth about something I talked about in this article let me know. I might write an entire post to that.

    Read the article

  • What’s New in The Second Edition of Regular Expressions Cookbook

    - by Jan Goyvaerts
    %COOKBOOKFRAME% The second edition of Regular Expressions Cookbook is a completely revised edition, not just a minor update. All of the content from the first edition has been updated for the latest versions of the regular expression flavors and programming languages we discuss. We’ve corrected all errors that we could find and rewritten many sections that were either unclear or lacking in detail. And lack of detail was not something the first edition was accused of. Expect the second edition to really dot all i’s and cross all t’s. A few sections were removed. In particular, we removed much talk about browser inconsistencies as modern browsers are much more compatible with the official JavaScript standard. There is plenty of new content. The second edition has 101 more pages, bringing the total to 612. It’s almost 20% bigger than the first edition. We’ve added XRegExp as an additional regex flavor to all recipes throughout the book where XRegExp provides a better solution than standard JavaScript. We did keep the standard JavaScript solutions, so you can decide which is better for your needs. The new edition adds 21 recipes, bringing the total to 146. 14 of the new recipes are in the new Source Code and Log Files chapter. These recipes demonstrate techniques that are very useful for manipulating source code in a text editor and for dealing with log files using a grep tool. Chapter 3 which has recipes for programming with regular expressions gets only one new recipe, but it’s a doozy. If anyone has ever flamed you for using a regular expression instead of a parser, you’ll now be able to tell them how you can create your own parser by mixing regular expressions with procedural code. Combined with the recipes from the new Source Code and Log Files chapter, you can create parsers for whatever custom language or file format you like. If you have any interest in regular expressions at all, whether you’re a beginner or already consider yourself an expert, you definitely need a copy of the second edition of Regular Expressions Cookbook if you didn’t already buy the first. If you did buy the first edition, and you often find yourself referring back to it, then the second edition is a very worthwhile upgrade. You can buy the second edition of Regular Expressions Cookbook from Amazon or wherever technical books are sold. Ask for ISBN 1449319432.

    Read the article

  • Le C++ expressif n° 4 : une bibliothèque de fonctions lambda en à peine 30 lignes - partie 1, un article d'Eric Niebler traduit par cob59

    Dans cet article, Eric Niebler entre dans les détails de la création de grammaires, en particulier sur le rôle des transformées, qui permettent d'appliquer une action spécifique lorsque l'entrée correspond à la grammaire donnée. De cette manière, il est possible d'étendre les fonctionnalités des expressions de Boost.Proto. Cet article explique aussi comment créer sa propre bibliothèques de fonctions pour faciliter la création d'expression Le C++ expressif n° 4 : une bibliothèque de fonctions lambda en à peine 30 lignes - partie 1 Avec l'ajout des transformées, commencez-vous à voir des doma...

    Read the article

  • Silverlight Cream for April 02, 2010 -- #828

    - by Dave Campbell
    In this Issue: Phil Middlemiss, Robert Kozak, Kathleen Dollard, Avi Pilosof, Nokola, Jeff Wilcox, David Anson, Timmy Kokke, Tim Greenfield, and Josh Smith. Shoutout: SmartyP has additional info up on his WP7 Pivot app: Preview of My Current Windows Phone 7 Pivot Work From SilverlightCream.com: A Chrome and Glass Theme - Part I Phil Middlemiss is starting a tutorial series on building a new theme for Silverlight, in this first one we define some gradients and color resources... good stuff Phil Intercepting INotifyPropertyChanged This is Robert Kozak's first post on this blog, but it's a good one about INotifyPropertyChanged and MVVM and has a solution in the post with lots of code and discussion. How do I Display Data of Complex Bound Criteria in Horizontal Lists in Silverlight? Kathleen Dollard's latest article in Visual Studio magazine is in answer to a question about displaying a list of complex bound criteria including data, child data, and photos, and displaying them horizontally one at a time. Very nice-looking result, and all the code. Windows Phone: Frame/Page navigation and transitions using the TransitioningContentControl Avi Pilosof discusses the built-in (boring) navigation on WP7, and then shows using the TransitionContentControl from the Toolkit to apply transitions to the navigation. EasyPainter: Cloud Turbulence and Particle Buzz Nokola returns with a couple more effects for EasyPainter: Cloud Turbulence and Particle Buzz ... check out the example screenshots, then go grab the code. Property change notifications for multithreaded Silverlight applications Jeff Wilcox is discussing the need for getting change notifications to always happen on the UI thread in multi-threaded apps... great diagrams to see what's going on. Tip: The default value of a DependencyProperty is shared by all instances of the class that registers it David Anson has a tip up about setting the default value of a DependencyProperty, and the consequence that may have depending upon the type. Building a “real” extension for Expression Blend Timmy Kokke's code is WPF, but the subject is near and dear to us all, Timmy has a real-world Expression Blend extension up... a search for controls in the Objects and Timelines pane ... and even if that doesn't interest you... it's the source to a Blend extension! XPath support in Silverlight 4 + XPathPad Tim Greenfield not only talks about XPath in SL4RC, but he has produced a tool, XPathPad, and provided the source... if you've used XPath, you either are a higher thinker than me(not a big stretch), or you need this :) Using a Service Locator to Work with MessageBoxes in an MVVM Application Josh Smith posted about a question that comes up a lot: showing a messagebox from a ViewModel object. This might not work for custom message boxes or unit testing. This post covers the Unit Testing aspect. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    Windows Phone MIX10

    Read the article

  • Silverlight Cream for March 05, 2010 -- #807

    - by Dave Campbell
    In this Issue: Phil Middlemiss(-2-, -3-), Pencho Popadiyn, John Papa(-2-, -3-), Jim Lynn, and SilverLaw(-2-). Shoutouts: Walt Ritscher has added more shaders and features: Shazzam 1.2 – Feature Overview I hope you're getting as excited as I am about MIX10. You should be reading MIX10 News and checking out the sessions and the directory of attendees. From SilverlightCream.com: Watermarked TextBox Part I Phil Middlemiss's Orb Radio Button hit number two in the Silverlight Cream Skim page, in 2 days... now Phil has a very nice 3-part tutorial up on creating a Watermarked TextBox with lots of cool features. This is part 1 and starts the series off. Watermarked TextBox Part II In Phil Middlemiss's Part II of the Watermarked TextBox tutorial, he's concentrating on visual elements of the control began in the last episode... you're paying attention, right? ... this is a cool control :) Watermarked Textbox Part III In the final part of Phil Middlemiss's tutorial series, he's wiring all the pieces together in the UserControl. Go grab the control, then leave Phil some love on his blog! Using Reactive Extensions in Silverlight Pencho Popadiyn has a great tutorial up on SilverlightShow about Rx ... if you want to get your arms around this... this tutorial is a good place to begin. Silverlight TV 10: Silverlight Hyper Video Platform with Jesse Liberty Running a little behind here, but check out John Papa and THE Silverlight GeekTM Jesse Liberty discussing Jesse's Hyper Video Platform on Silverlight TV Silverlight TV 11: Dynamically Loading XAPs with MEF In Silverlight TV episode 11, John Papa talks to Glenn Block about MEF and partitioning and dynamically loading XAPs ... good stuff. Silverlight TV 12: The Best Blend 3 Video Ever! And the latest Silverlight TV episode, number 12, has John Papa and Adam Kinney giving "The Best Blend 3 Video ever (or at least on Silverlight TV)"... check out the list of topics and you'll want to watch :) InvalidOperation_EnumFailedVersion when binding data to a Silverlight Chart Read Jim Lynn's post about a problem found while deploying his app, the very confusing (long) error, and the workaround. Leather Stamped Style Series For Silverlight Controls - Part 1 SilverLaw contued after his 'leather stamped' textbox and has added TextBlock, Button and some template bindings... check it out then get it at the Expression Gallery Circular Accordion Style Silverlight 3 SilverLaw also built a Circualar Accordian style... interesting idea and once again it, in the Expression Gallery. He's also looking for feedback. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    MIX10

    Read the article

  • SQL SERVER – 5 Tips for Improving Your Data with expressor Studio

    - by pinaldave
    It’s no secret that bad data leads to bad decisions and poor results.  However, how do you prevent dirty data from taking up residency in your data store?  Some might argue that it’s the responsibility of the person sending you the data.  While that may be true, in practice that will rarely hold up.  It doesn’t matter how many times you ask, you will get the data however they decide to provide it. So now you have bad data.  What constitutes bad data?  There are quite a few valid answers, for example: Invalid date values Inappropriate characters Wrong data Values that exceed a pre-set threshold While it is certainly possible to write your own scripts and custom SQL to identify and deal with these data anomalies, that effort often takes too long and becomes difficult to maintain.  Instead, leveraging an ETL tool like expressor Studio makes the data cleansing process much easier and faster.  Below are some tips for leveraging expressor to get your data into tip-top shape. Tip 1:     Build reusable data objects with embedded cleansing rules One of the new features in expressor Studio 3.2 is the ability to define constraints at the metadata level.  Using expressor’s concept of Semantic Types, you can define reusable data objects that have embedded logic such as constraints for dealing with dirty data.  Once defined, they can be saved as a shared atomic type and then re-applied to other data attributes in other schemas. As you can see in the figure above, I’ve defined a constraint on zip code.  I can then save the constraint rules I defined for zip code as a shared atomic type called zip_type for example.   The next time I get a different data source with a schema that also contains a zip code field, I can simply apply the shared atomic type (shown below) and the previously defined constraints will be automatically applied. Tip 2:     Unlock the power of regular expressions in Semantic Types Another powerful feature introduced in expressor Studio 3.2 is the option to use regular expressions as a constraint.   A regular expression is used to identify patterns within data.   The patterns could be something as simple as a date format or something much more complex such as a street address.  For example, I could define that a valid IP address should be made up of 4 numbers, each 0 to 255, and separated by a period.  So 192.168.23.123 might be a valid IP address whereas 888.777.0.123 would not be.   How can I account for this using regular expressions? A very simple regular expression that would look for any 4 sets of 3 digits separated by a period would be:  ^[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}$ Alternatively, the following would be the exact check for truly valid IP addresses as we had defined above:  ^(25[0-5]|2[0-4][0-9]|1[0-9]{2}|[1-9]?[0-9])\.(25[0-5]|2[0-4][0-9]|1[0-9]{2}|[1-9]?[0-9])\.(25[0-5]|2[0-4][0-9]|1[0-9]{2}|[1-9]?[0-9])\.(25[0-5]|2[0-4][0-9]|1[0-9]{2}|[1-9]?[0-9])$ .  In expressor, we would enter this regular expression as a constraint like this: Here we select the corrective action to be ‘Escalate’, meaning that the expressor Dataflow operator will decide what to do.  Some of the options include rejecting the offending record, skipping it, or aborting the dataflow. Tip 3:     Email pattern expressions that might come in handy In the example schema that I am using, there’s a field for email.  Email addresses are often entered incorrectly because people are trying to avoid spam.  While there are a lot of different ways to define what constitutes a valid email address, a quick search online yields a couple of really useful regular expressions for validating email addresses: This one is short and sweet:  \b[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}\b (Source: http://www.regular-expressions.info/) This one is more specific about which characters are allowed:  ^([a-zA-Z0-9_\-\.]+)@((\[[0-9]{1,3}\.[0-9]{1,3}\.[0-9]{1,3}\.)|(([a-zA-Z0-9\-]+\.)+))([a-zA-Z]{2,4}|[0-9]{1,3})(\]?)$ (Source: http://regexlib.com/REDetails.aspx?regexp_id=26 ) Tip 4:     Reject “dirty data” for analysis or further processing Yet another feature introduced in expressor Studio 3.2 is the ability to reject records based on constraint violations.  To capture reject records on input, simply specify Reject Record in the Error Handling setting for the Read File operator.  Then attach a Write File operator to the reject port of the Read File operator as such: Next, in the Write File operator, you can configure the expressor operator in a similar way to the Read File.  The key difference would be that the schema needs to be derived from the upstream operator as shown below: Once configured, expressor will output rejected records to the file you specified.  In addition to the rejected records, expressor also captures some diagnostic information that will be helpful towards identifying why the record was rejected.  This makes diagnosing errors much easier! Tip 5:    Use a Filter or Transform after the initial cleansing to finish the job Sometimes you may want to predicate the data cleansing on a more complex set of conditions.  For example, I may only be interested in processing data containing males over the age of 25 in certain zip codes.  Using an expressor Filter operator, you can define the conditional logic which isolates the records of importance away from the others. Alternatively, the expressor Transform operator can be used to alter the input value via a user defined algorithm or transformation.  It also supports the use of conditional logic and data can be rejected based on constraint violations. However, the best tip I can leave you with is to not constrain your solution design approach – expressor operators can be combined in many different ways to achieve the desired results.  For example, in the expressor Dataflow below, I can post-process the reject data from the Filter which did not meet my pre-defined criteria and, if successful, Funnel it back into the flow so that it gets written to the target table. I continue to be impressed that expressor offers all this functionality as part of their FREE expressor Studio desktop ETL tool, which you can download from here.  Their Studio ETL tool is absolutely free and they are very open about saying that if you want to deploy their software on a dedicated Windows Server, you need to purchase their server software, whose pricing is posted on their website. Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: Pinal Dave, PostADay, SQL, SQL Authority, SQL Query, SQL Scripts, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • What’s New in Delphi XE6 Regular Expressions

    - by Jan Goyvaerts
    There’s not much new in the regular expression support in Delphi XE6. The big change that should be made, upgrading to PCRE 8.30 or later and switching to the pcre16 functions that use UTF-16, still hasn’t been made. XE6 still uses PCRE 7.9 and thus continues to require conversion from the UTF-16 strings that Delphi uses natively to the UTF-8 strings that older versions of PCRE require. Delphi XE6 does fix one important issue that has plagued TRegEx since it was introduced in Delphi XE. Previously, TRegEx could not find zero-length matches. So a regex like (?m)^ that should find a zero-length match at the start of each line would not find any matches at all with TRegEx. The reason for this is that TRegEx uses TPerlRegEx to do the heavy lifting. TPerlRegEx sets its State property to [preNotEmpty] in its constructor, which tells it to skip zero-length matches. This is not a problem with TPerlRegEx because users of this class can change the State property. But TRegEx does not provide a way to change this property. So in Delphi XE5 and prior, TRegEx cannot find zero-length matches. In Delphi XE6 TPerlRegEx’s constructor was changed to initialize State to the empty set. This means TRegEx is now able to find zero-length matches. TRegex.Replace() using the regex (?m)^ now inserts the replacement at the start of each line, as you would expect. If you use TPerlRegEx directly, you’ll need to set State to [preNotEmpty] in your own code if you relied on its behavior to skip zero-length matches. You will need to check existing applications that use TRegEx for regular expressions that incorrectly allow zero-length matches. In XE5 and prior, TRegEx using \d* would match all numbers in a string. In XE6, the same regex still matches all numbers, but also finds a zero-length match at each position in the string. RegexBuddy 4 warns about zero-length matches on the Create panel if you set it to Detailed mode. At the bottom of the regex tree there will be a node saying either “your regular expression may find zero-length matches” or “zero-length matches will be skipped” depending on whether your application allows zero-length matches (XE6 TRegEx) or not (XE–XE5 TRegEx).

    Read the article

  • Silverlight Cream for December 28, 2010 -- #1017

    - by Dave Campbell
    In this Issue: Davide Zordan, Alex Golesh, Michael S. Scherotter, Andrej Tozon, Alex Knight, Jeff Blankenburg(-2-), Jeremy Likness, and Laurent Bugnion. Above the Fold: Silverlight: "My “What’s new in Silverlight 4 demo” app" Andrej Tozon WP7: "Taking a screenshot from within a Silverlight #WP7 application" Laurent Bugnion Expression Blend: "PathListBox: getting started" Alex Knight Shoutouts: If you haven't seen this SurfCube app demo on YouTube yet... check it out now: SurfCube V1.0 Windows Phone 7 Browser Want to get a free WP7 class from Shawn Wildermuth? Check this out: Webinar: Writing your first Windows Phone 7 Application Koen Zwikstra announed the next preview of his great tool: Silverlight Spy Preview 2 From SilverlightCream.com: Using the Multi-Touch Behavior in a Windows Phone 7 Multi-Page application Davide Zordan has a post up responding to questions he receives about multi-touch on WP7 in applications spanning more than one page. Silverlight for Windows Phone 7 Quick Tip: Fix missing icons while using DatePicker/TimePicker controls Alex Golesh discusses the use of the DatePicker control from the WP7 toolkit and found an unpleasant surprise associated with the Done/Cancel icons in the ApplicationBar, and has a solution for us. Updated SMF Thumbnail Scrubbing Sample Code Michael S. Scherotter has a post up about an update he's done to Silverlight 4 of code that allows thumbnail views of a video while 'scrubbing' ... don't know what that is? read the post :) My “What’s new in Silverlight 4 demo” app Andrej Tozon admits he's a little behind with this post, but as he points out, it might be a good time to review Silverlight 4 features, on the eve of 5. PathListBox: getting started One half the Knight team -- Alex Knight this time, has the first post of a series on the PathListBox up ... some real Expression Blend goodness. What I Learned in WP7 – Issue #9 Two more from Jeff Blankenburg today, in his number 9, he starts off demonstrating passing data between pages when navigating and fnishes up with some excellent info for submitting apps to the marketplace. What I Learned in WP7 – #Issue 10 Jeff Blankenburg's number 10 elaborates on the query string data he discussed in number 9. Using Sterling in Windows Phone 7 Applications Who better than the author?? Jeremy Likness has an end-to-end WP7/Sterling app up on his blog... begin with downloading Sterling, discuss what's needed to support Tombstoning, even custom serialization. Taking a screenshot from within a Silverlight #WP7 application Laurent Bugnion has a post up describing something people have been looking for: getting a screenshot of a WP7 application's page. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    Windows Phone MIX10

    Read the article

  • Silverlight Cream for March 10, 2010 - 2 -- #811

    - by Dave Campbell
    In this Issue: AfricanGeek, Phil Middlemiss, Damon Payne, David Anson, Jesse Liberty, Jeremy Likness, Jobi Joy(-2-), Fredrik Normén, Bobby Diaz, and Mike Taulty(-2-). Shoutouts: Shawn Wildermuth blogged that they posted My "What's New in Silverlight 3" Video from 0reDev Last Fall Shawn Wildermuth also has a post up for his loyal followers: Where to See Me At MIX10 Jonas Follesø has presentation materials up as well: MVVM presentation from NDC2009 on Vimeo Adam Kinney updated his Favorite Tool and Library Downloads for Silverlight From SilverlightCream.com: Styling Silverlight ListBox with Blend 3 In his latest Video Tutorial, AfricanGeek is animating the ListBox control by way of Expression Blend 3. Animating the Silverlight Opacity Mask Phil Middlemiss has written a Behavior that lets you turn a FrameworkElement into an opacity mask for it's parent container... check out his tutorial and grab the code. AddRange for ObservableCollection in Silverlight 3 Damon Payne has a post up discussing the problem with large amounts of data in an ObservableCollection, and how using AddRange is a performance booster. Easily rotate the axis labels of a Silverlight/WPF Toolkit chart David Anson blogged a solution to rotating the axis labels of a Silverlight and WPF chart. Persisting the Configuration (Updated) Jesse Liberty has a good discussion on the continuation of his HyperVideo Platform talking about what all he is needing from the database in the form of configuration information... including the relationships. Animations and View Models: IAnimationDelegate Check out Jeremy Likness' IAnimationDelegate that lets your ViewModel fire and respond to animations without having to know all about them. Button Style - Silverlight Jobi Joy converted a WPF control template into Silverlight... and you'll want to download the XAML he's got for this :) A Simple Accordion banner using ListBox Jobi Joy also has an Image Accordian created in Expression Blend... and it's a 'drop this XAML in your User Control' kinda thing... again, go grab the XAML :) WCF RIA Services Silverlight Business Application – Using ASP.NET SiteMap for Navigation Fredrik Normén has a code-laden post up on RIA Services and the ASP.NET SiteMap. He is using the Silverlight Business app template that comes with WCF RIA Services. A Simple, Selectable Silverlight TextBlock (sort of)... Bobby Diaz shares with us his solution for a Text control that can be copied from in the same manner 'normal' web controls can be. He also includes a link to another post on the same topic. Silverlight 4 Beta Networking. Part 11 - WCF and TCP Mike Taulty has another pair of video tutorials up in his Networking series. This one is on WCF over TCP Silverlight 4 Beta Networking. Part 12 - WCF and Polling HTTP Mike Taulty's 12th networking video tutorial is on WCF with HTTP polling duplex. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    MIX10

    Read the article

< Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >