Search Results

Search found 13710 results on 549 pages for 'partial methods'.

Page 134/549 | < Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >

  • Is this how dynamic language copes with dynamic requirement?

    - by Amumu
    The question is in the title. I want to have my thinking verified by experienced people. You can add more or disregard my opinion, but give me a reason. Here is an example requirement: Suppose you are required to implement a fighting game. Initially, the game only includes fighters, who can attack each other. Each fighter can punch, kick or block incoming attacks. Fighters can have various fighting styles: Karate, Judo, Kung Fu... That's it for the simple universe of the game. In an OO like Java, it can be implemented similar to this way: abstract class Fighter { int hp, attack; void punch(Fighter otherFighter); void kick(Fighter otherFighter); void block(Figther otherFighter); }; class KarateFighter extends Fighter { //...implementation...}; class JudoFighter extends Fighter { //...implementation... }; class KungFuFighter extends Fighter { //...implementation ... }; This is fine if the game stays like this forever. But, somehow the game designers decide to change the theme of the game: instead of a simple fighting game, the game evolves to become a RPG, in which characters can not only fight but perform other activities, i.e. the character can be a priest, an accountant, a scientist etc... At this point, to make it more generic, we have to change the structure of our original design: Fighter is not used to refer to a person anymore; it refers to a profession. The specialized classes of Fighter (KaraterFighter, JudoFighter, KungFuFighter) . Now we have to create a generic class named Person. However, to adapt this change, I have to change the method signatures of the original operations: class Person { int hp, attack; List<Profession> skillSet; }; abstract class Profession {}; class Fighter extends Profession { void punch(Person otherFighter); void kick(Person otherFighter); void block(Person otherFighter); }; class KarateFighter extends Fighter { //...implementation...}; class JudoFighter extends Fighter { //...implementation... }; class KungFuFighter extends Fighter { //...implementation ... }; class Accountant extends Profession { void calculateTax(Person p) { //...implementation...}; void calculateTax(Company c) { //...implementation...}; }; //... more professions... Here are the problems: To adapt to the method changes, I have to fix the places where the changed methods are called (refactoring). Every time a new requirement is introduced, the current structural design has to be broken to adapt the changes. This leads to the first problem. Rigid structure makes it hard for code reuse. A function can only accept the predefined types, but it cannot accept future unknown types. A written function is bound to its current universe and has no way to accommodate to the new types, without modifications or rewrite from scratch. I see Java has a lot of deprecated methods. OO is an extreme case because it has inheritance to add up the complexity, but in general for statically typed language, types are very strict. In contrast, a dynamic language can handle the above case as follow: ;;fighter1 punch fighter2 (defun perform-punch (fighter1 fighter2) ...implementation... ) ;;fighter1 kick fighter2 (defun perform-kick (fighter1 fighter2) ...implementation... ) ;;fighter1 blocks attacks from fighter2 (defun perform-block (fighter1 fighter2) ...implementation... ) fighter1 and fighter2 can be anything as long as it has the required data for calculation; or methods (duck typing). You don't have to change from the type Fighter to Person. In the case of Lisp, because Lisp only has a single data structure: list, it's even easier to adapt to changes. However, other dynamic languages can have similar behaviors as well. I work primarily with static languages (mainly C and Java, but working with Java was a long time ago). I started learning Lisp and some other dynamic languages this year. I can see how it helps improving my productivity.

    Read the article

  • DataContractSerializer: type is not serializable because it is not public?

    - by Michael B. McLaughlin
    I recently ran into an odd and annoying error when working with the DataContractSerializer class for a WP7 project. I thought I’d share it to save others who might encounter it the same annoyance I had. So I had an instance of  ObservableCollection<T> that I was trying to serialize (with T being a class I wrote for the project) and whenever it would hit the code to save it, it would give me: The data contract type 'ProjectName.MyMagicItemsClass' is not serializable because it is not public. Making the type public will fix this error. Alternatively, you can make it internal, and use the InternalsVisibleToAttribute attribute on your assembly in order to enable serialization of internal members - see documentation for more details. Be aware that doing so has certain security implications. This, of course, was malarkey. I was trying to write an instance of MyAwesomeClass that looked like this: [DataContract] public class MyAwesomeClass { [DataMember] public ObservableCollection<MyMagicItemsClass> GreatItems { get; set; }   [DataMember] public ObservableCollection<MyMagicItemsClass> SuperbItems { get; set; }     public MyAwesomeClass { GreatItems = new ObservableCollection<MyMagicItemsClass>(); SuperbItems = new ObservableCollection<MyMagicItemsClass>(); } }   That’s all well and fine. And MyMagicItemsClass was also public with a parameterless public constructor. It too had DataContractAttribute applied to it and it had DataMemberAttribute applied to all the properties and fields I wanted to serialize. Everything should be cool, but it’s not because I keep getting that “not public” exception. I could tell you about all the things I tried (generating a List<T> on the fly to make sure it wasn’t ObservableCollection<T>, trying to serialize the the Collections directly, moving it all to a separate library project, etc.), but I want to keep this short. In the end, I remembered my the “Debug->Exceptions…” VS menu option that brings up the list of exception-related circumstances under which the Visual Studio debugger will break. I checked the “Thrown” checkbox for “Common Language Runtime Exceptions”, started the project under the debugger, and voilà: the true problem revealed itself. Some of my properties had fairly elaborate setters whose logic I wanted to ignore. So for some of them, I applied an IgnoreDataMember attribute to them and applied the DataMember attribute to the underlying fields instead. All of which, in line with good programming practices, were private. Well, it just so happens that WP7 apps run in a “partial trust” environment and outside of “full trust”-land, DataContractSerializer refuses to serialize or deserialize non-public members. Of course that exception was swallowed up internally by .NET so all I ever saw was that bizarre message about things that I knew for certain were public being “not public”. I changed all the private fields I was serializing to public and everything worked just fine. In hindsight it all makes perfect sense. The serializer uses reflection to build up its graph of the object in order to write it out. In partial trust, you don’t want people using reflection to get at non-public members of an object since there are potential security problems with allowing that (you could break out of the sandbox pretty quickly by reflecting and calling the appropriate methods and cause some havoc by reflecting and setting the appropriate fields in certain circumstances. The fact that you cannot reflect your own assembly seems a bit heavy-handed, but then again I’m not a compiler writer or a framework designer and I have no idea what sorts of difficulties would go into allowing that from a compilation standpoint or what sorts of security problems allowing that could present (if any). So, lesson learned. If you get an incomprehensible exception message, turn on break on all thrown exceptions and try running it again (it might take a couple of tries, depending) and see what pops out. Chances are you’ll find the buried exception that actually explains what was going on. And if you’re getting a weird exception when trying to use DataContractSerializer complaining about public types not being public, chances are you’re trying to serialize a private or protected field/property.

    Read the article

  • .NET Security Part 4

    - by Simon Cooper
    Finally, in this series, I am going to cover some of the security issues that can trip you up when using sandboxed appdomains. DISCLAIMER: I am not a security expert, and this is by no means an exhaustive list. If you actually are writing security-critical code, then get a proper security audit of your code by a professional. The examples below are just illustrations of the sort of things that can go wrong. 1. AppDomainSetup.ApplicationBase The most obvious one is the issue covered in the MSDN documentation on creating a sandbox, in step 3 – the sandboxed appdomain has the same ApplicationBase as the controlling appdomain. So let’s explore what happens when they are the same, and an exception is thrown. In the sandboxed assembly, Sandboxed.dll (IPlugin is an interface in a partially-trusted assembly, with a single MethodToDoThings on it): public class UntrustedPlugin : MarshalByRefObject, IPlugin { // implements IPlugin.MethodToDoThings() public void MethodToDoThings() { throw new EvilException(); } } [Serializable] internal class EvilException : Exception { public override string ToString() { // show we have read access to C:\Windows // read the first 5 directories Console.WriteLine("Pwned! Mwuahahah!"); foreach (var d in Directory.EnumerateDirectories(@"C:\Windows").Take(5)) { Console.WriteLine(d.FullName); } return base.ToString(); } } And in the controlling assembly: // what can possibly go wrong? AppDomainSetup appDomainSetup = new AppDomainSetup { ApplicationBase = AppDomain.CurrentDomain.SetupInformation.ApplicationBase } // only grant permissions to execute // and to read the application base, nothing else PermissionSet restrictedPerms = new PermissionSet(PermissionState.None); restrictedPerms.AddPermission( new SecurityPermission(SecurityPermissionFlag.Execution)); restrictedPerms.AddPermission( new FileIOPermission(FileIOPermissionAccess.Read, appDomainSetup.ApplicationBase); restrictedPerms.AddPermission( new FileIOPermission(FileIOPermissionAccess.pathDiscovery, appDomainSetup.ApplicationBase); // create the sandbox AppDomain sandbox = AppDomain.CreateDomain("Sandbox", null, appDomainSetup, restrictedPerms); // execute UntrustedPlugin in the sandbox // don't crash the application if the sandbox throws an exception IPlugin o = (IPlugin)sandbox.CreateInstanceFromAndUnwrap("Sandboxed.dll", "UntrustedPlugin"); try { o.MethodToDoThings() } catch (Exception e) { Console.WriteLine(e.ToString()); } And the result? Oops. We’ve allowed a class that should be sandboxed to execute code with fully-trusted permissions! How did this happen? Well, the key is the exact meaning of the ApplicationBase property: The application base directory is where the assembly manager begins probing for assemblies. When EvilException is thrown, it propagates from the sandboxed appdomain into the controlling assembly’s appdomain (as it’s marked as Serializable). When the exception is deserialized, the CLR finds and loads the sandboxed dll into the fully-trusted appdomain. Since the controlling appdomain’s ApplicationBase directory contains the sandboxed assembly, the CLR finds and loads the assembly into a full-trust appdomain, and the evil code is executed. So the problem isn’t exactly that the sandboxed appdomain’s ApplicationBase is the same as the controlling appdomain’s, it’s that the sandboxed dll was in such a place that the controlling appdomain could find it as part of the standard assembly resolution mechanism. The sandbox then forced the assembly to load in the controlling appdomain by throwing a serializable exception that propagated outside the sandbox. The easiest fix for this is to keep the sandbox ApplicationBase well away from the ApplicationBase of the controlling appdomain, and don’t allow the sandbox permissions to access the controlling appdomain’s ApplicationBase directory. If you do this, then the sandboxed assembly can’t be accidentally loaded into the fully-trusted appdomain, and the code can’t be executed. If the plugin does try to induce the controlling appdomain to load an assembly it shouldn’t, a SerializationException will be thrown when it tries to load the assembly to deserialize the exception, and no damage will be done. 2. Loading the sandboxed dll into the application appdomain As an extension of the previous point, you shouldn’t directly reference types or methods in the sandboxed dll from your application code. That loads the assembly into the fully-trusted appdomain, and from there code in the assembly could be executed. Instead, pull out methods you want the sandboxed dll to have into an interface or class in a partially-trusted assembly you control, and execute methods via that instead (similar to the example above with the IPlugin interface). If you need to have a look at the assembly before executing it in the sandbox, either examine the assembly using reflection from within the sandbox, or load the assembly into the Reflection-only context in the application’s appdomain. The code in assemblies in the reflection-only context can’t be executed, it can only be reflected upon, thus protecting your appdomain from malicious code. 3. Incorrectly asserting permissions You should only assert permissions when you are absolutely sure they’re safe. For example, this method allows a caller read-access to any file they call this method with, including your documents, any network shares, the C:\Windows directory, etc: [SecuritySafeCritical] public static string GetFileText(string filePath) { new FileIOPermission(FileIOPermissionAccess.Read, filePath).Assert(); return File.ReadAllText(filePath); } Be careful when asserting permissions, and ensure you’re not providing a loophole sandboxed dlls can use to gain access to things they shouldn’t be able to. Conclusion Hopefully, that’s given you an idea of some of the ways it’s possible to get past the .NET security system. As I said before, this post is not exhaustive, and you certainly shouldn’t base any security-critical applications on the contents of this blog post. What this series should help with is understanding the possibilities of the security system, and what all the security attributes and classes mean and what they are used for, if you were to use the security system in the future.

    Read the article

  • Local LINQtoSQL Database For Your Windows Phone 7 Application

    - by Tim Murphy
    There aren’t many applications that are of value without having some for of data store.  In Windows Phone development we have a few options.  You can store text directly to isolated storage.  You can also use a number of third party libraries to create or mimic databases in isolated storage.  With Mango we gained the ability to have a native .NET database approach which uses LINQ to SQL.  In this article I will try to bring together the components needed to implement this last type of data store and fill in some of the blanks that I think other articles have left out. Defining A Database The first things you are going to need to do is define classes that represent your tables and a data context class that is used as the overall database definition.  The table class consists of column definitions as you would expect.  They can have relationships and constraints as with any relational DBMS.  Below is an example of a table definition. First you will need to add some assembly references to the code file. using System.ComponentModel;using System.Data.Linq;using System.Data.Linq.Mapping; You can then add the table class and its associated columns.  It needs to implement INotifyPropertyChanged and INotifyPropertyChanging.  Each level of the class needs to be decorated with the attribute appropriate for that part of the definition.  Where the class represents the table the properties represent the columns.  In this example you will see that the column is marked as a primary key and not nullable with a an auto generated value. You will also notice that the in the column property’s set method It uses the NotifyPropertyChanging and NotifyPropertyChanged methods in order to make sure that the proper events are fired. [Table]public class MyTable: INotifyPropertyChanged, INotifyPropertyChanging{ public event PropertyChangedEventHandler PropertyChanged; private void NotifyPropertyChanged(string propertyName) { if(PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } public event PropertyChangingEventHandler PropertyChanging; private void NotifyPropertyChanging(string propertyName) { if(PropertyChanging != null) { PropertyChanging(this, new PropertyChangingEventArgs(propertyName)); } } private int _TableKey; [Column(IsPrimaryKey = true, IsDbGenerated = true, DbType = "INT NOT NULL Identity", CanBeNull = false, AutoSync = AutoSync.OnInsert)] public int TableKey { get { return _TableKey; } set { NotifyPropertyChanging("TableKey"); _TableKey = value; NotifyPropertyChanged("TableKey"); } } The last part of the database definition that needs to be created is the data context.  This is a simple class that takes an isolated storage location connection string its constructor and then instantiates tables as public properties. public class MyDataContext: DataContext{ public MyDataContext(string connectionString): base(connectionString) { MyRecords = this.GetTable<MyTable>(); } public Table<MyTable> MyRecords;} Creating A New Database Instance Now that we have a database definition it is time to create an instance of the data context within our Windows Phone app.  When your app fires up it should check if the database already exists and create an instance if it does not.  I would suggest that this be part of the constructor of your ViewModel. db = new MyDataContext(connectionString);if(!db.DatabaseExists()){ db.CreateDatabase();} The next thing you have to know is how the connection string for isolated storage should be constructed.  The main sticking point I have found is that the database cannot be created unless the file mode is read/write.  You may have different connection strings but the initial one needs to be similar to the following. string connString = "Data Source = 'isostore:/MyApp.sdf'; File Mode = read write"; Using you database Now that you have done all the up front work it is time to put the database to use.  To make your life a little easier and keep proper separation between your view and your viewmodel you should add a couple of methods to the viewmodel.  These will do the CRUD work of your application.  What you will notice is that the SubmitChanges method is the secret sauce in all of the methods that change data. private myDataContext myDb;private ObservableCollection<MyTable> _viewRecords;public ObservableCollection<MyTable> ViewRecords{ get { return _viewRecords; } set { _viewRecords = value; NotifyPropertyChanged("ViewRecords"); }}public void LoadMedstarDbData(){ var tempItems = from MyTable myRecord in myDb.LocalScans select myRecord; ViewRecords = new ObservableCollection<MyTable>(tempItems);}public void SaveChangesToDb(){ myDb.SubmitChanges();}public void AddMyTableItem(MyTable newScan){ myDb.LocalScans.InsertOnSubmit(newScan); myDb.SubmitChanges();}public void DeleteMyTableItem(MyTable newScan){ myDb.LocalScans.DeleteOnSubmit(newScan); myDb.SubmitChanges();} Updating existing database What happens when you need to change the structure of your database?  Unfortunately you have to add code to your application that checks the version of the database which over time will create some pollution in your codes base.  On the other hand it does give you control of the update.  In this example you will see the DatabaseSchemaUpdater in action.  Assuming we added a “Notes” field to the MyTable structure, the following code will check if the database is the latest version and add the field if it isn’t. if(!myDb.DatabaseExists()){ myDb.CreateDatabase();}else{ DatabaseSchemaUpdater dbUdater = myDb.CreateDatabaseSchemaUpdater(); if(dbUdater.DatabaseSchemaVersion < 2) { dbUdater.AddColumn<MyTable>("Notes"); dbUdater.DatabaseSchemaVersion = 2; dbUdater.Execute(); }} Summary This approach does take a fairly large amount of work, but I think the end product is robust and very native for .NET developers.  It turns out to be worth the investment. del.icio.us Tags: Windows Phone,Windows Phone 7,LINQ to SQL,LINQ,Database,Isolated Storage

    Read the article

  • Plagued by multithreaded bugs

    - by koncurrency
    On my new team that I manage, the majority of our code is platform, TCP socket, and http networking code. All C++. Most of it originated from other developers that have left the team. The current developers on the team are very smart, but mostly junior in terms of experience. Our biggest problem: multi-threaded concurrency bugs. Most of our class libraries are written to be asynchronous by use of some thread pool classes. Methods on the class libraries often enqueue long running taks onto the thread pool from one thread and then the callback methods of that class get invoked on a different thread. As a result, we have a lot of edge case bugs involving incorrect threading assumptions. This results in subtle bugs that go beyond just having critical sections and locks to guard against concurrency issues. What makes these problems even harder is that the attempts to fix are often incorrect. Some mistakes I've observed the team attempting (or within the legacy code itself) includes something like the following: Common mistake #1 - Fixing concurrency issue by just put a lock around the shared data, but forgetting about what happens when methods don't get called in an expected order. Here's a very simple example: void Foo::OnHttpRequestComplete(statuscode status) { m_pBar->DoSomethingImportant(status); } void Foo::Shutdown() { m_pBar->Cleanup(); delete m_pBar; m_pBar=nullptr; } So now we have a bug in which Shutdown could get called while OnHttpNetworkRequestComplete is occuring on. A tester finds the bug, captures the crash dump, and assigns the bug to a developer. He in turn fixes the bug like this. void Foo::OnHttpRequestComplete(statuscode status) { AutoLock lock(m_cs); m_pBar->DoSomethingImportant(status); } void Foo::Shutdown() { AutoLock lock(m_cs); m_pBar->Cleanup(); delete m_pBar; m_pBar=nullptr; } The above fix looks good until you realize there's an even more subtle edge case. What happens if Shutdown gets called before OnHttpRequestComplete gets called back? The real world examples my team has are even more complex, and the edge cases are even harder to spot during the code review process. Common Mistake #2 - fixing deadlock issues by blindly exiting the lock, wait for the other thread to finish, then re-enter the lock - but without handling the case that the object just got updated by the other thread! Common Mistake #3 - Even though the objects are reference counted, the shutdown sequence "releases" it's pointer. But forgets to wait for the thread that is still running to release it's instance. As such, components are shutdown cleanly, then spurious or late callbacks are invoked on an object in an state not expecting any more calls. There are other edge cases, but the bottom line is this: Multithreaded programming is just plain hard, even for smart people. As I catch these mistakes, I spend time discussing the errors with each developer on developing a more appropriate fix. But I suspect they are often confused on how to solve each issue because of the enormous amount of legacy code that the "right" fix will involve touching. We're going to be shipping soon, and I'm sure the patches we're applying will hold for the upcoming release. Afterwards, we're going to have some time to improve the code base and refactor where needed. We won't have time to just re-write everything. And the majority of the code isn't all that bad. But I'm looking to refactor code such that threading issues can be avoided altogether. One approach I am considering is this. For each significant platform feature, have a dedicated single thread where all events and network callbacks get marshalled onto. Similar to COM apartment threading in Windows with use of a message loop. Long blocking operations could still get dispatched to a work pool thread, but the completion callback is invoked on on the component's thread. Components could possibly even share the same thread. Then all the class libraries running inside the thread can be written under the assumption of a single threaded world. Before I go down that path, I am also very interested if there are other standard techniques or design patterns for dealing with multithreaded issues. And I have to emphasize - something beyond a book that describes the basics of mutexes and semaphores. What do you think? I am also interested in any other approaches to take towards a refactoring process. Including any of the following: Literature or papers on design patterns around threads. Something beyond an introduction to mutexes and semaphores. We don't need massive parallelism either, just ways to design an object model so as to handle asynchronous events from other threads correctly. Ways to diagram the threading of various components, so that it will be easy to study and evolve solutions for. (That is, a UML equivalent for discussing threads across objects and classes) Educating your development team on the issues with multithreaded code. What would you do?

    Read the article

  • Getting warning about sensitive information that could be disclosed to 3rd parties - Asp.net MVC 2.0

    - by chobo2
    Hi I never gotten this message before I started to use asp.net mvc 2.0 and jquery 1.4. <title>This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.</title> <span><H1>Server Error in '/' Application.<hr width=100% size=1 color=silver></H1> <h2> <i>This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.</i> </h2></span> <font face="Arial, Helvetica, Geneva, SunSans-Regular, sans-serif "> <b> Description: </b>An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. <br><br> <b> Exception Details: </b>System.InvalidOperationException: This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.<br><br> So it makes me wondering what sensitive data could be disclosed and if so how to get around this? What I was trying to send back was a rendered string of a partial view(http://www.klopfenstein.net/lorenz.aspx/render-partial-view-to-string-in-asp-net-mvc) and a success msg.

    Read the article

  • How to use multiple DisplayName attribute using Entity Framework and ASP.Net Mvc 2

    - by Picflight
    Depending on where I use my Class, I want to be able to show a different DisplayName. I have the following class: [MetadataType(typeof(PortalMetaData))] [System.Web.Mvc.Bind(Exclude = "PortalId")] public partial class Portal { public Portal() { this.Created = DateTime.Now; } } public class PortalMetaData { [Required(ErrorMessage = "Portal name is required")] [StringLength(50, ErrorMessage = "Portal name must be under 50 characters")] public object PortalName { get; set; } [Required(ErrorMessage = "Description is required")] public object Description { get; set; } } I have a corresponding Table in the database Portal I use the Portal table with a PortalController for the Site Admin to update the records in the Portal Table. I want another user with a different Role (AsstAdmin) to be able to update this table as well. To facilitate that I am thinking of creating a separate partial class that somehow links back to the Portal Model. This would allow me to display limited Fields for update by the AsstAdmin and I can display a different name for the Field as well. How can I accomplish this task? If I add the following class which inherits from Portal than I get an exception: Unable to cast object of type 'Project1.Mvc.Models.Portal' to type 'Prpject1.Mvc.Models.Site'. [MetadataType(typeof(SiteMetaData))] public class Site : Portal { public Site() { } } public class SiteMetaData { [Required(DisplayName = "Site Description")] public object Description { get; set; } }

    Read the article

  • Bread Crumbs With C#

    - by kareemsaad
    I made Class And user Control In master.cs public partial class BreadCrumbs : System.Web.UI.UserControl { protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here bc1.PageTitle = HeaderText; } protected BreadCrumbs.ctrlBreadCrumbs bc1; private string _strHeaderText; public string HeaderText { get { return _strHeaderText; } set { _strHeaderText = value; } } } User Control: public partial class BreadCrumbs : System.Web.UI.UserControl { protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here bc1.PageTitle = HeaderText; } protected BreadCrumbs.ctrlBreadCrumbs bc1; private string _strHeaderText; public string HeaderText { get { return _strHeaderText; } set { _strHeaderText = value; } } } protected System.Web.UI.WebControls.Literal lblPageTitle; protected namespace.headerBreadCrumb header; ClsCategory clscategory = new ClsCategory(); protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here string PageTitle = "ASP.NET Breadcrumbs with C#"; lblPageTitle.Text = PageTitle; header.HeaderText = PageTitle; but it not work well i think problem here <%@ Register TagPrefix="bc" Namespace="BreadCrumbs" Assembly="BreadCrumbs" %> <bc:ctrlBreadCrumbs id="bc1" runat="server" />

    Read the article

  • ASP.NET 4.0 UpdatePanel and UserControl with PlaceHolder

    - by Chris
    I don't know if this is ASP.NET 4.0 specific but I don't recall having this problem in previous versions. I have very simple user control called "TestModal" that contains a PlaceHolder control which I use to instantiate a template in. When I put an UpdatePanel inside this UserControl on the page the updatepanel only does full postbacks and not partial postbacks. What gives? USER CONTROL MARKUP: <%@ Control Language="C#" AutoEventWireup="true" CodeBehind="TestModal.ascx.cs" Inherits="MyProject.UserControls.TestModal" %> <div id="<%= this.ClientID %>"> <asp:PlaceHolder ID="plchContentTemplate" runat="server"></asp:PlaceHolder> </div> USER CONTROL CODE BEHIND: public partial class TestModal : System.Web.UI.UserControl { private ITemplate _contentTemplate; [TemplateInstance(TemplateInstance.Single)] [PersistenceMode(PersistenceMode.InnerProperty), TemplateContainer(typeof(TemplateControl))] public ITemplate ContentTemplate { get { return _contentTemplate; } set { _contentTemplate = value; } } protected override void OnInit(EventArgs e) { base.OnInit(e); if (_contentTemplate != null) _contentTemplate.InstantiateIn(plchContentTemplate); } } ASPX PAGE MARKUP: <ajaxToolkit:ToolkitScriptManager ID="scriptManager" EnablePartialRendering="true" AllowCustomErrorsRedirect="true" CombineScripts="true" EnablePageMethods="true" ScriptMode="Release" AsyncPostBackTimeout="180" runat="server"></ajaxToolkit:ToolkitScriptManager> <uc1:TestModal ID="testModal" ClientIDMode="Static" runat="server"> <ContentTemplate> <asp:UpdatePanel ID="upAttachments" UpdateMode="Conditional" ChildrenAsTriggers="true" runat="server"> <ContentTemplate> <asp:LinkButton ID="lnkRemoveAttachment" runat="server"><img src="/images/icons/trashcan.png" style="border: none;" /></asp:LinkButton> </ContentTemplate> </asp:UpdatePanel> </ContentTemplate> </uc1:TestModal>

    Read the article

  • How to clone a Model using Entity Framework and ASP.Net Mvc 2

    - by Picflight
    I have the following class: [MetadataType(typeof(PortalMetaData))] [System.Web.Mvc.Bind(Exclude = "PortalId")] public partial class Portal { public Portal() { this.Created = DateTime.Now; } } public class PortalMetaData { [Required(ErrorMessage = "Portal name is required")] [StringLength(50, ErrorMessage = "Portal name must be under 50 characters")] public object PortalName { get; set; } [Required(ErrorMessage = "Description is required")] public object Description { get; set; } } I have a corresponding Table in the database Portal I use the Portal table with a PortalController for the Site Admin to update the records in the Portal Table. I want another user with a different Role (AsstAdmin) to be able to update this table as well. To facilitate that I am thinking of creating a separate partial class that somehow links back to the Portal Model. This would allow me to display limited Fields for update by the AsstAdmin and I can display a different name for the Field as well. How can I accomplish this task? If I add the following class which inherits from Portal than I get an exception: Unable to cast object of type 'Project1.Mvc.Models.Portal' to type 'Prpject1.Mvc.Models.Site'. [MetadataType(typeof(SiteMetaData))] public class Site : Portal { public Site() { } } public class SiteMetaData { [Required(DisplayName = "Site Description")] public object Description { get; set; } }

    Read the article

  • ASP.NET MVC 2 validation LINQ to SQL

    - by Chino
    Currently I have a DataModel object which contains my linq to sql classes(a dmbl file). Currently I use a partial class to validate the incoming input. For example public partial class User : IEntity { public NameValueCollection CheckModel() { return GetRuleViolations(); } /// <summary> /// Method validates incoming data, by given rules in the if statement. /// </summary> /// <returns>NameValueCollection</returns> private NameValueCollection GetRuleViolations() { NameValueCollection errors = new NameValueCollection(); if (string.IsNullOrEmpty(Username)) errors.Add("Username", "A username is required"); // and so on return errors; } } Now what I want to try to do is add validation attributes to the fields. For example I want to try to add the required attribute to the field Username instead/in addtion of using the validation I currently have. My question is how can I achieve this because the dmbl file is auto generated. Or maybe it is not possible and should I use a different approach?

    Read the article

  • Primefaces, JavaScript, and JSF does not work well together or am I doing something wrong

    - by Harry Pham
    Here is something so simple <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <input id="tom"/> When u click on the Tom, the textbox get focus. Great, now try this <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <h:inputText id="tom"/> <br/> when I click nothing happen, I check firebug, I see document.getElementById("tom") is null When I try to use jQuery $('#tom').focus(), nothing happen, no error, but did not get focus either. This is the response (not sure if this is the response from the server) when I see from firebug <?xml version="1.0" encoding="utf-8"?> <partial-response> <changes> <update id="javax.faces.ViewState"><![CDATA[455334589763307998:-2971181471269134244]]></update> </changes> <extension primefacesCallbackParam="validationFailed">{"validationFailed":false}</extension> </partial-response>

    Read the article

  • Ajax actionlinks straight from a DropDownList

    - by Ingó Vals
    I've got a small linkbox on the side of my page that is rendered as a PartialView. In it I have a dropDownlist the should change the routing value of the links in the box but I'm having difficulty doing so. My current plan is to call on something similar to a Ajax.ActionLink to reload the partial view into the with a different parameter based on the value of the dropdown selection. However I'm having multiple problems with this, for example as a novice in using dropdownlists I have no idea how to call on the selected value for example. <%= Html.DropDownList("DropDownList1", new SelectList(Model, "ID", "Name"), "--Pick--", new { AutoPostBack = "true", onchange = "maybe something here" })%> I tried putting in the sys.mvc.AsyncHyperlink into the onchange attribute and that worked except I don't know how to put in the route value for it. Sys.Mvc.AsyncHyperlink.handleClick(this, new Sys.UI.DomEvent(event), { insertionMode: Sys.Mvc.InsertionMode.replace, updateTargetId: 'SmallMenu' } Is there no straight Ajax drop down list that fires events onchange? Any way this is possible? I have later in the Partial view the Ajax actionlinks but they need to have their id's updated by the value in the dropdownlist and if I could do that somehow else I would appreciate a suggestion.

    Read the article

  • Problem with custom Equality in Entity Framework

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • Automatic INotifyPropertyChanged Implementation through T4 code generation?

    - by chrischu
    I'm currently working on setting up a new project of mine and was wondering how I could achieve that my ViewModel classes do have INotifyPropertyChanged support while not having to handcode all the properties myself. I looked into AOP frameworks but I think they would just blow up my project with another dependency. So I thought about generating the property implementations with T4. The setup would be this: I have a ViewModel class that declares just its Properties background variables and then I use T4 to generate the Property Implementations from it. For example this would be my ViewModel: public partial class ViewModel { private string p_SomeProperty; } Then T4 would go over the source file and look for member declarations named "p_" and generate a file like this: public partial class ViewModel { public string SomeProperty { get { return p_SomeProperty; } set { p_SomeProperty= value; NotifyPropertyChanged("SomeProperty"); } } } This approach has some advantages but I'm not sure if it can really work. So I wanted to post my idea here on StackOverflow as a question to get some feedback on it and maybe some advice how it can be done better/easier/safer.

    Read the article

  • entity framework POCO template in a n-tiers design question

    - by bryan
    HI all I was trying to follow the POCO Template walkthrough . And now I am having problems using it in n-tiers design. By following the article, I put my edmx model, and the template generated context.tt in my DAL project, and moved the generated model.tt entity classes to my Business Logic layer (BLL) project. By doing this, I could use those entities inside my BLL without referencing the DAL, I guess that is the idea of PI; without knowing anything about the data source. Now, I want to extend the entities (inside the model.tt) to perform some CUD action in the BLL project,so I added a new partial class same name as the one generated from template, public partial class Company { public static IEnumerable AllCompanies() { using(var context = new Entities()){ var q = from p in context.Companies select p; return q.ToList(); } } } however visual studio won't let me do that, and I think it was because the context.tt is in the DAL project, and the BLL project could not add a reference to the DAL project as DAL has already reference to the BLL. So I tried to added this class to the DAL and it compiled, but intelisense won't show up the BLL.Company.AllCompanies() in my web service method from my webservice project which has reference to my BLL project. What should I do now? I want to add CUD methods to the template generated entities in my BLL project, and call them in my web services from another project. I have been looking for this answer a few days already, and I really need some guides from here please. Bryan

    Read the article

  • Rails 3 - yield return or callback won't call in view <%= yield(:sidebar) || render('shared/sidebar'

    - by rzar
    Hey folks, I'm migrating a Website from Rails 2 (latest) to Rails 3 (beta2). Testing with Ruby 1.9.1p378 and Ruby 1.9.2dev (2010-04-05 trunk 27225) Stuck in a situation, i don't know which part will work well. Suspect yield is the problem, but don't know exactly. In my Layout Files I use the following technique quite often: app/views/layouts/application.html.erb: <%= yield(:sidebar) || render('shared/sidebar') %> For Example the partial look like: app/views/shared/_sidebar.html.erb: <p>Default sidebar Content. Bla Bla</p> Now it is time for the key part! In any view, I want to create a content_for block (optional). This can contain a pice of HTML etc. example below. If this block is set, the pice HTML inside should render in application.html.erb. If not, Rails should render the Partial at shared/_sidebar.html.erb on the right hand side. app/views/books/index.html.erb: <% content_for :sidebar do %> <strong>You have to read REWORK, a book from 37signals!</strong> <% end %> So you've got the idea. Hopefully. This technique worked well in any Rails 2.x Application. Now, in Rails 3 (beta2) only the yield Part is working. || render('shared/sidebar') The or side will not process by rails or maybe ruby. Thanks for input and time!

    Read the article

  • can't get jquery livequery to with an update panel

    - by Jeremy
    I have some basic html inside an asp.net update panel. Using livequery, I set up autocomplete, blur and keydown events so that they all continue to be wired up after the update panel does a partial page load. When the page initially loads, all the events work fine but after the update panel does a partial page reload, none of the events wired up with livequery continue to work. Are there known issues with livequery and update panels? Html: <asp:UpdatePanel ID="upData" runat="server" UpdateMode="Conditional"> <ContentTemplate> <asp:DataList ID="dlData" runat="server" DataSource='<%# this.Data %>' DataKeyField="ID"> <ItemTemplate> <table> <tr> <th class="required">Location</th> <td><asp:TextBox ID="txtFromLocation" MaxLength="10" CssClass="searchlocation fromlocation required" runat="server" Text='<%# Eval("FromLocation")%>'/><asp:RequiredFieldValidator ID="rvalFromLocation" runat="server" ControlToValidate="txtFromLocation" ValidationGroup="leg">*</asp:RequiredFieldValidator></td> </tr> </table> </ItemTemplate> </asp:DataList> </ContentTemplate> </asp:UpdatePanel> And then I have my javascript. Normally it has a bunch of other code, but I can reduce it down to this and still have the problem: $(document).ready(function() { $(".searchlocation").livequery(function() { $(this).keydown(function(event) {alert('test');}); }); });

    Read the article

  • ASP.NET Content Web Form - content from placeholder disappears

    - by Naeem Sarfraz
    I'm attempting to set a class on the body tag in my asp.net site which uses a master page and content web forms. I simply want to be able to do this by adding a bodycssclass property (see below) to the content web form page directive. It works through the solution below but when i attempt to view Default.aspx the Content1 control loses its content. Any ideas why? Here is how I'm doing it. I have a master page with the following content: <%@ Master Language="C#" ... %> <html><head>...</head> <body id=ctlBody runat=server> <asp:ContentPlaceHolder ID="cphMain" runat="server" /> </body> </html> it's code behind looks like: public partial class Site : MasterPageBase { public override string BodyCssClass { get { return ctlBody.Attributes["class"]; } set { ctlBody.Attributes["class"] = value; } } } it inherits from: public abstract class MasterPageBase : MasterPage { public abstract string BodyCssClass { get; set; } } my default.aspx is defined as: <%@ Page Title="..." [master page definition etc..] bodycssclass="home" %> <asp:Content ID="Content1" ContentPlaceHolderID="cphMain" runat="server"> Some content </asp:Content> the code behind for this file looks like: public partial class Default : PageBase { ... } and it inherits from : public class PageBase : Page { public string BodyCssClass { get { MasterPageBase mpbCurrent = this.Master as MasterPageBase; return mpbCurrent.BodyCssClass; } set { MasterPageBase mpbCurrent = this.Master as MasterPageBase; mpbCurrent.BodyCssClass = value; } } }

    Read the article

  • How to copy the shipping address to billing address

    - by Jerry
    Hi all I like to know if I can copy the shipping address to billing address. I got most of the parts done but I am not sure how to copy select menu (states) value to billing address. I really appreciate any helps. My code $(document).ready(function(){ Jquery $('#same').click(function(){ if($('#same').attr('checked')){ $('#bfName').val($('#fName').val()); $('#blName').val($('#lName').val()); $('#baddress1').val($('#address1').val()); $('#baddress2').val($('#address2').val()); $('#bcity').val($('#city').val()); alert(($('#state option:selected').val())); //not sure what to do here $('#bzip').val($('#zip').val()); }; }); Html <td><select name="state"> //shipping states......only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> <td><select name="bstate"> //billing state................only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> Thanks a lot!

    Read the article

  • How can I render a list of objects using DisplayFor but from the controller in ASP.NET MVC?

    - by Darragh
    Here's the scenaio, I have an Employee object and a Company object which has a list of employees. I have Company.aspx which inherits from ViewPage<Company>. In Company.aspx I call Html.DisplayFor(m => m.Employees). I have an Employee.ascx partial view which inherits from ViewUserControl<Employee in my DisplayTemplates folder. Everything works fine and Company.aspx renders the Employee.ascx partial for each employee. Now I have two additional methods on my controller called GetEmployees and GetEmployee(Id). In the GetEmployee(Id) action I want to return the markup to display this one employee, and in GetEmployees() I want to render the markup to display all the employees (these two action methods will be called via AJAX). In the GetEmployee action I call return PartialView("DisplayTemplates\Employee", employee) This works, although I'd prefer something like return PartialViewFor(employee) which would determine the view name by convention. Anwyay, my question is how should I implement the GetEmployees() action? I don't want to create any more views, because frankly, I don't see why I should have to. I've tried the following which fails miserably :) return Content(New HtmlHelper<IList<Of DebtDto>>(null, null).DisplayFor(m => debts)); However if I could create an instance of an HtmlHelper object in my controller, I suppose I could get it to work, but it feels wrong. Any ideas? Have i missed something obvious?

    Read the article

  • WPF binding fails with custom add and remove accessors for INotifyPropertyChanged.PropertyChanged

    - by emddudley
    I have a scenario which is causing strange behavior with WPF data binding and INotifyPropertyChanged. I want a private member of the data binding source to handle the INotifyPropertyChanged.PropertyChanged event. I get some exceptions which haven't helped me debug, even when I have "Enable .NET Framework source stepping" checked in Visual Studio's options: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.InvalidOperationException' occurred in PresentationCore.dll Here's the source code: XAML <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="TestApplication.MainWindow" DataContext="{Binding RelativeSource={RelativeSource Self}}" Height="100" Width="100"> <StackPanel> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="A" /> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="B" /> </StackPanel> </Window> Normal implementation works public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; public MainWindow() { InitializeComponent(); } } Desired implementation doesn't work public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged { add { lock (this.mHandler) { this.mHandler.PropertyChanged += value; } } remove { lock (this.mHandler) { this.mHandler.PropertyChanged -= value; } } } public bool CheckboxIsChecked { get { return this.mHandler.CheckboxIsChecked; } set { this.mHandler.CheckboxIsChecked = value; } } private HandlesPropertyChangeEvents mHandler = new HandlesPropertyChangeEvents(); public MainWindow() { InitializeComponent(); } public class HandlesPropertyChangeEvents : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; } }

    Read the article

  • Rails 3.2 Ajax Update Div when Text Field Populated

    - by ctilley79
    In the end I would like a text field that passes a client_id to the partial. I would like to do this asynchronously so the shipment_products partial would dynamically change when the textfield value was updated. What is the best way to do this? In index.html.erb <!-- Text Field Here--> <div id="available_products"> <%= render "shipment_products" %> </div> In _shipment_products.html.erb <div id="shipment_products_container"> <h3>Assign Products to Ship<\h3> <ul class="shipment_products" id="shipment_products"> <% Product.by_client(client_id).each do |product|%> <!-- TextField value passed here --> <%= content_tag_for :li, product, :value => product.id do %> <%= hidden_field_tag("shipment[product_ids][]", product.id) %> <%= product.product_name %> <% end %> <% end %> <\ul> </div> This is similar to what I want in the end.

    Read the article

  • Ajax.BeginForm driving me crazy

    - by Fabio Milheiro
    ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 130 131 132 133 134 135 136 137 138 139 140 141  | Next Page >