Search Results

Search found 13710 results on 549 pages for 'partial methods'.

Page 135/549 | < Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How do I expose the columns collection of GridView control that is inside a user control

    - by Christopher Edwards
    See edit. I want to be able to do this in the aspx that consumes the user control. <uc:MyControl ID="MyGrid" runat="server"> <asp:BoundField DataField="FirstColumn" HeaderText="FirstColumn" /> <asp:BoundField DataField="SecondColumn" HeaderText="SecondColumn" /> </uc> I have this code (which doesn't work). Any ideas what I am doing wrong? VB Partial Public Class MyControl Inherits UserControl <System.Web.UI.IDReferenceProperty(GetType(DataControlFieldCollection))> _ Public Property Columns() As DataControlFieldCollection Get Return MyGridView.Columns End Get Set(ByVal value As DataControlFieldCollection) ' The Columns collection of the GridView is ReadOnly, so I rebuild it MyGridView.Columns.Clear() For Each c As DataControlField In value MyGridView.Columns.Add(c) Next End Set End Property ... End Class C# public partial class MyControl : UserControl {         [System.Web.UI.IDReferenceProperty(typeof(DataControlFieldCollection))]     public DataControlFieldCollection Columns {         get { return MyGridView.Columns; }         set {             MyGridView.Columns.Clear();             foreach (DataControlField c in value) {                 MyGridView.Columns.Add(c);             }         }     } ... } EDIT: Actually it does work, but auto complete does not work between the uc:MyControl opening and closing tags and I get compiler warnings:- Content is not allowed between the opening and closing tags for element 'MyControl'. Validation (XHTML 1.0 Transitional): Element 'columns' is not supported. Element 'BoundField' is not a known element. This can occur if there is a compilation error in the Web site, or the web.config file is missing. So I guess I need to use some sort of directive to tell the complier to expect content between the tags. Any ideas?

    Read the article

  • Need advice on using Grails and Ajax to append to a div like in Rails

    - by Nate
    I'm just starting out in Grails and need some advice on using Ajax. I want to append some html to the bottom of a div inside a form. This is basically what I have: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields -/div- -form- -a-Add Child 4-/a- When I click on the "Add Child" I want to make an ajax call that results in a new childrow getting inserted into the "listOfchildren" div. So the document would look like this: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields childrow 4 input fields -/div- -form- -a-Add Child 5-/a- In Rails I would do something simple like this: render :update do |page| page.insert_html :bottom, "list_of_children", :partial = child_partial page.replace "add_link", :partial = 'add_link' end The previous code sends an javascript back to the browser with two commands. The first command tells the browser to append some html to the bottom of a div. The second command updates the "add link" counter. In grails I can only see how to replace an entire div (which would wipe out the user's existing input) and I don't see how I can call multiple functions from the ajax response. I can probably do this if I was to write some javascript functions in prototype or whatever, but I'd like to avoid that if there is a simpler way. Thanks! Nate

    Read the article

  • LINQ Datacontext Disposal Issues

    - by Refracted Paladin
    I am getting a Cannot access object: DataContext after it's been disposed in the below DAL method. I thought that I would be okay calling dispose there. result is an IEnumurable and I thought it was IQueryable that caused these kinds of problems. What am I doing wrong? How SHOULD I be disposing of my DataContext. Is there something better to be returning then a DataTable? This is a Desktop app that points at SQL 2005. Example method that causes this error -- public static DataTable GetEnrolledMembers(Guid workerID) { var DB = CmoDataContext.Create(); var AllEnrollees = from enrollment in DB.tblCMOEnrollments where enrollment.CMOSocialWorkerID == workerID || enrollment.CMONurseID == workerID join supportWorker in DB.tblSupportWorkers on enrollment.EconomicSupportWorkerID equals supportWorker.SupportWorkerID into workerGroup from worker in workerGroup.DefaultIfEmpty() select new { enrollment.ClientID, enrollment.CMONurseID, enrollment.CMOSocialWorkerID, enrollment.EnrollmentDate, enrollment.DisenrollmentDate, ESFirstName = worker.FirstName, ESLastName = worker.LastName, ESPhone = worker.Phone }; var result = from enrollee in AllEnrollees.AsEnumerable() where (enrollee.DisenrollmentDate == null || enrollee.DisenrollmentDate > DateTime.Now) //let memberName = BLLConnect.MemberName(enrollee.ClientID) let lastName = BLLConnect.MemberLastName(enrollee.ClientID) let firstName = BLLConnect.MemberFirstName(enrollee.ClientID) orderby enrollee.DisenrollmentDate ascending, lastName ascending select new { enrollee.ClientID, //MemberName = memberName, LastName = lastName, FirstName = firstName, NurseName = BLLAspnetdb.NurseName(enrollee.CMONurseID), SocialWorkerName = BLLAspnetdb.SocialWorkerName(enrollee.CMOSocialWorkerID), enrollee.EnrollmentDate, enrollee.DisenrollmentDate, ESWorkerName = enrollee.ESFirstName + " " + enrollee.ESLastName, enrollee.ESPhone }; DB.Dispose(); return result.CopyLinqToDataTable(); } partial class where I create the DataContext -- partial class CmoDataContext { public static bool IsDisconnectedUser { get { return Settings.Default.IsDisconnectedUser; } } public static CmoDataContext Create() { var cs = IsDisconnectedUser ? Settings.Default.CMOConnectionString : Settings.Default.Central_CMOConnectionString; return new CmoDataContext(cs); }

    Read the article

  • Windows Media Encoder object not created in ASP.NET on MS Server 2003 64 bit

    - by Ron
    Hello, I created (and used) a Windows Media Encoder object in Microsoft Visual C# 2008 Express Edition on MS Server 2003 64 bit. This worked fine. However, when I attempted to create the equivalent Windows Media Encoder object using Microsoft Visual Web Developer 2008 on MS Server 2003 64 bit, the following exception was thrown: "Retrieving the COM class factory for component with CLSID {632B606A-BBC6-11D2-A329-006097C4E476} failed due to the following error: 80040154." It cannot be that the component isn’t registered, because both have a reference to the same WMEncEng.dll file. The Microsoft Visual Web Developer 2008 code also worked fine on XP 32 bit. Could it be a problem with permissions? Regardless, anyone have any ideas why this problem is occurring and, more importantly, how to resolve it? Thank you. Here are the two code snippets from MS Server 2003 64 bit: Microsoft Visual Web Developer 2008 (did not work): using System; using WMEncoderLib; namespace TestWMEnc { public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { try { WMEncoder encoder = new WMEncoder(); //exception thrown // ... } catch (Exception err) { string exception = err.Message; } } } } Microsoft Visual C# 2008 Express Edition (worked fine): using System; using System.Windows.Forms; using WMEncoderLib; namespace testWMEncoder { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { try { WMEncoder encoder = new WMEncoder(); // ... } catch (Exception err) { string exception = err.Message; } } } }

    Read the article

  • Using of Templated Helpers in MVC 2.0 : How can use the name of the property that I'm rendering insi

    - by Andrey Tagaew
    Hi. I'm reviewing new features of ASP.NET MVC 2.0. During the review i found really interesting using Templated Helpers. As they described it, the primary reason of using them is to provide common way of how some datatypes should be rendered. Now i want to use this way in my project for DateTime datatype My project was written for the MVC 1.0 so generating of editbox is looking like this: <%= Html.TextBox("BirthDate", Model.BirthDate, new { maxlength = 10, size = 10, @class = "BirthDate-date" })%> <script type="text/javascript"> $(document).ready(function() { $(".BirthDate-date").datepicker({ showOn: 'button', buttonImage: '<%=Url.Content("~/images/i_calendar.gif") %>', buttonImageOnly: true }); }); </script> Now i want to use Template Helper, so i want to have above code once i type next sentence: <%=Html.EditorFor(f=>f.BirthDate) %> According to the manual I create DataTime.ascx partial view inside Shared/EditorTemplates folder. I put there above code and stacked with the problem. How can i pass the name of the property that I'm rendering with template helper? As you can see from my example, i really need it, since I'm using the name of the property to specify data value and parameter name that will be send during the POST requsest. Also, I'm using it to generate class name for JS calendar building. I tried to remove my partial class for template helper and made MVC to generate its default behavior. Here what it generated for me: <input type="text" value="04/29/2010" name="LoanApplicationDays" id="LoanApplicationDays" class="text-box single-line"> As you can see, it used the name of the property for "name" and "id" attributes. This example let me to presume that Template Helper knows about the name of the property. So, there should be some way of how to use it in custom implementation. Thanks for your help!

    Read the article

  • What is the correct way to create dynamic javascript in ASP.net MVC2?

    - by sabbour
    I'm creating a Google Maps partial view/user control in my project that is passed a strongly typed list of objects containing latitude and longitude values. Currently, this is the code I have for the partial: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<IEnumerable<Project.Models.Entities.Location>>" %> <!-- Place for google to put the map --> <div id="report_map_canvas" style="width: 100%; height: 728px; margin-bottom: 2px;"> </div> <script type='text/javascript'> google.load("maps", "2"); $(document).ready(initializeMap); function initializeMap() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById('report_map_canvas')); map.setCenter(new GLatLng(51.5, -0.1167), 2); <% foreach (var item in Model) { %> map.addOverlay(new GMarker(new GLatLng('<%= Html.Encode(item.latitude)%>','<%= Html.Encode(item.longitude)%>'),{ title: '<%= Html.Encode(String.Format("{0:F}",item.speed)) %> km/h '})); <% } %> map.setUIToDefault(); } } </script> Is it right to dynamically create the javascript file this way by looping over the list and emitting javascript? Is there a better way to do it?

    Read the article

  • Delphi - Populate an imagelist with icons at runtime 'destroys' transparency

    - by ben
    Hi again, I've spended hours for this (simple) one and don't find a solution :/ I'm using D7 and the TImageList. The ImageList is assigned to a toolbar. When I populate the ImageList at designtime, the icons (with partial transparency) are looking fine. But I need to populate it at runtime, and when I do this the icons are looking pretty shitty - complete loose of the partial transparency. I just tried to load the icons from a .res file - with the same result. I've tried third party image lists also without success. I have no clue what I could do :/ Thanks 2 all ;) edit: To be honest I dont know exactly whats going on. Alpha blending is the correkt term... Here are 2 screenies: Icon added at designtime: Icon added at runtime: Your comment that alpha blending is not supported just brought the solution: I've edited the image in an editor and removed the "alpha blended" pixels - and now it looks fine. But its still strange that the icons look other when added at runtime instead of designtime. If you (or somebody else ;) can explain it, I would be happy ;) thanks for you support!

    Read the article

  • Rails ajax jquery problem

    - by user283179
    Ok I have this problem I'm trying to use Jquery to load a partial in replace of a listed object. loadshow: $(function() { $(".style_image_<%= style.id %> a").click(function() { $(".style_image_<%= style.id %>").html("loading... ") $(".style_image_<%= style.id %>").html("<%= escape_javascript(render("show")) %>") $.get(this.href, null, null, "html"); return false; }); }); _show.html.erb: <%=link_to image_tag(style.cover.pic.url(:normal)), style %> I'm getting this error: missing ) after argument list [Break on this error] $(".style_image_<%= style.id %>").htm...scape_javascript(render("show")) %>")\n There is two problems with my code here the first is the click function is not targeting the .style_image_<%= style.id % .... i.e (.style_image_42) if I replace the css target with 42 instead of _style.id the click target works; why is this? And with or without this change the _show partial is not render and the above error is given. Not really that good with Javascript any help would be great! P.s. The effect I really want is like one of those super cool cargo themes: http://cargocollective.com/publikspace Thanks Dan!

    Read the article

  • How to include a child object's child object in Entity Framework 5

    - by Brendan Vogt
    I am using Entity Framework 5 code first and ASP.NET MVC 3. I am struggling to get a child object's child object to populate. Below are my classes.. Application class; public class Application { // Partial list of properties public virtual ICollection<Child> Children { get; set; } } Child class: public class Child { // Partial list of properties public int ChildRelationshipTypeId { get; set; } public virtual ChildRelationshipType ChildRelationshipType { get; set; } } ChildRelationshipType class: public class ChildRelationshipType { public int Id { get; set; } public string Name { get; set; } } Part of GetAll method in the repository to return all the applications: return DatabaseContext.Applications .Include("Children"); The Child class contains a reference to the ChildRelationshipType class. To work with an application's children I would have something like this: foreach (Child child in application.Children) { string childName = child.ChildRelationshipType.Name; } I get an error here that the object context is already closed. How do I specify that each child object must include the ChildRelationshipType object like what I did above?

    Read the article

  • How to implement IEquatable<T> when mutable fields are part of the equality - Problem with GetHashCo

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. The problem is that when I hit save, the ID changes from 0 to its db value. So the question is how can I have an equatable object, being properly hashed. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • C sharp code cleanup : resharper

    - by Ankit Rathod
    Hello, I just used Resharper in one application and it made me feel as if i don't know how to code at all in C# :(. On every line it gave me it's suggestions :- Few of Resharper's favorite suggestions are :- 1) SomObject o = new SomeObject(); Resharper will convert to : var o = new SomeObject() 2) this.Loaded += new RoutedEventHandler(MainPage_Loaded); to this.Loaded += MainPage_Loaded; 3) convert my variables and putting _ in front of all instance variables. 4) Removing class parent's name. I tested this on Silverlight. public partial class MainPage : UserControl to public partial class MainPage EDIT :- 5) replace instance variable this.variable = somevalue to variable = somevalue Are all of these really necessary? Is it really going to affect the efficiency of my program? I mean what good is it going to do by replacing my class names with var keyword. After all var is also replaced with class name at compile time. Is it doing because it has been programmed to do or do these things really affect in some or another way? Thanks in advance :)

    Read the article

  • I can't get datepicker to work

    - by vikitor
    Hi, I need a field that displays the datepicker. I followed the example given by the JQuery UI documentation and haven't managed to get it to work. My html where I have my text field is: <div class="editor-field"> <input type = "text" name = "DatePublished" id = "Published" /> <%= Html.ValidationMessage("DatePublished" ,"*") %> </div> This HTML is in a partial view, lets call it pv.ascx, and it is called in the main page as a modal box: <div id = "ModalBox"> <% Html.RenderAction("pv", "Example"); %> </div> The thing is, that I try to call the datepicker creation anytime I enter the main page, and I do it in my javascript file app.js: $().ready(function() { var place = window.location.pathname; var placesplit = place.split("/"); //Depending on the location we are on, we execute different subroutines $('#Published').datepicker(); }); But nothing happens when I focus on the text field. What is wrong? Could it be that being called from a partial view it doesn't work? Thank you everyone, vikitor

    Read the article

  • Binding UpdateSourceTrigger=Explicit, updates source at program startup

    - by GTD
    I have following code: <Window x:Class="WpfApplication1.Window1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="Window1" Height="300" Width="300"> <Grid> <TextBox Text="{Binding Path=Name, Mode=OneWayToSource, UpdateSourceTrigger=Explicit, FallbackValue=default text}" KeyUp="TextBox_KeyUp" x:Name="textBox1"/> </Grid> public partial class Window1 : Window { public Window1() { InitializeComponent(); } private void TextBox_KeyUp(object sender, KeyEventArgs e) { if (e.Key == Key.Enter) { BindingExpression exp = this.textBox1.GetBindingExpression(TextBox.TextProperty); exp.UpdateSource(); } } } public class ViewModel { public string Name { set { Debug.WriteLine("setting name: " + value); } } } public partial class App : Application { protected override void OnStartup(StartupEventArgs e) { base.OnStartup(e); Window1 window = new Window1(); window.DataContext = new ViewModel(); window.Show(); } } I want to update source only when "Enter" key is pressed in textbox. This works fine. However binding updates source at program startup. How can I avoid this? Am I missing something?

    Read the article

  • alternative to JQuery form.submit() to do ajax post

    - by BluntTool
    Hello, I have a mvc2 application with a view like this <% using (Ajax.BeginForm("UserApprove", new { id = Model.id }, new AjaxOptions() { UpdateTargetId = "statusLights", OnSuccess = "HideButtons" }, new { id = "UserApprove" })) {%> <input type="button" value="Approve" onclick="$('#dialogApprove').dialog('open')" /> <div id="dialogApprove" title="Confirm"> <p> Are you sure you want to approve this request? </p> </div> <% } %> FYI, the controller returns a partial view back. I used to not have the jquery dialog and just simple a <input type="Submit" value="Approve" /> that used to work fine I added the jquery dialog and I have something like this to initialize the dialog. $("#dialogApprove").dialog({ autoOpen: false, draggable: true, resizable: false, buttons: { "Cancel": function() { $(this).dialog("close") }, "Approve": function() { $("#UserApprove").submit(); $(this).dialog("close"); } } }); The $("#UserApprove").submit(); does not seem to be doing an ajax post. It comes back with just the text from the partial view returned in a new page. I dont want to use the jquery form plugin which has .ajaxSubmit(). Is there any other way to force an ajax post from the jquery dialog "approve" button?

    Read the article

  • Multiple forms on a single page

    - by normalocity
    I've got an app that's in invite-only beta right now. Problem is, I can't get the invite system to work. :( On my root page there's a login form (which works just fine), and I'm trying to add a "request invite" form on the same page. I started doing it by putting the form for InviteRequest (ActiveRecord) inside a partial, in the "views" folder for "InviteRequest". The app is definitely calling this partial, but I'm getting the following error: NoMethodError in User_sessions#new Showing app/views/invite_request/_new.html.erb where line #2 raised: undefined method `invite_requests_path' for #<ActionView::Base:0x25b3248> Extracted source (around line #2): 1: <% @invite_request = InviteRequest.new() %> 2: <% form_for @invite_request do |ir| %> 3: <%= ir.label :email %> 4: <%= ir.text_field :email %> 5: <% end %> I also read through the "Multiple Models in a Form" section of my trusty copy of "Agile Web Development with Rails", about maybe doing this with a "fieldset" tag, but not sure if this is the right approach. Thx.

    Read the article

  • MVC2 Client Validation isn't working when getting form from ajax call

    - by devlife
    I'm trying to use MVC2 client-side validation in a partial view that is rendered via $.get. However, the client validation isn't working. I'm not quite sure what the deal is. [Required(ErrorMessage = "Email is required")] public string Email { get; set; } <% using ( Ajax.BeginForm( new AjaxOptions { Confirm = "You sure?" } ) ) { %> <%: Html.TextBoxFor( m => m.Email, new { @class = "TextBox150" } )%> <%= Html.ValidationMessageFor( m => m.Email )%> <input type="submit" value="Add/Save" style="float: right;" /> <% } %> I'm not doing anything special to render the the partial view. Just putting the html into a div and showing it in a modal popup. On a side note, does anyone know if it's possible to submit the form with client validation without a submit button?

    Read the article

  • ASP.NET MVC PartialView generic ModelView

    - by Greg Ogle
    I have an ASP.NET MVC application which I want to dynamically pick the partial view and what data gets passed to it, while maintaining strong types. So, in the main form, I want a class that has a view model that contains a generically typed property which should contain the data for the partial view's view model. public class MainViewModel<T> { public T PartialViewsViewModel { get; set; } } In the User Control, I would like something like: Inherits="System.Web.Mvc.ViewUserControl<MainViewModel<ParticularViewModel>>" %> Though in my parent form, I must put Inherits="System.Web.Mvc.ViewPage<MainViewModel<ParticularViewModel>>" %> for it to work. Is there a way to work around this? The use case is to make the user control pluggable. I understand that I could inherit a base class, but that would put me back to having something like a dictionary instead of a typed view model.

    Read the article

  • How can I randomly iterate through a large Range?

    - by void
    I would like to randomly iterate through a range. Each value will be visited only once and all values will eventually be visited. For example: class Array def shuffle ret = dup j = length i = 0 while j > 1 r = i + rand(j) ret[i], ret[r] = ret[r], ret[i] i += 1 j -= 1 end ret end end (0..9).to_a.shuffle.each{|x| f(x)} where f(x) is some function that operates on each value. A Fisher-Yates shuffle is used to efficiently provide random ordering. My problem is that shuffle needs to operate on an array, which is not cool because I am working with astronomically large numbers. Ruby will quickly consume a large amount of RAM trying to create a monstrous array. Imagine replacing (0..9) with (0..99**99). This is also why the following code will not work: tried = {} # store previous attempts bigint = 99**99 bigint.times { x = rand(bigint) redo if tried[x] tried[x] = true f(x) # some function } This code is very naive and quickly runs out of memory as tried obtains more entries. What sort of algorithm can accomplish what I am trying to do? [Edit1]: Why do I want to do this? I'm trying to exhaust the search space of a hash algorithm for a N-length input string looking for partial collisions. Each number I generate is equivalent to a unique input string, entropy and all. Basically, I'm "counting" using a custom alphabet. [Edit2]: This means that f(x) in the above examples is a method that generates a hash and compares it to a constant, target hash for partial collisions. I do not need to store the value of x after I call f(x) so memory should remain constant over time. [Edit3/4/5/6]: Further clarification/fixes.

    Read the article

  • Javascript callback not firing when AJAX operation complete

    - by MisterJames
    Given the following code on an ASP.NET MVC View: <% using (Ajax.BeginForm("AddCommunity", new AjaxOptions { UpdateTargetId = "community-list", OnSuccess = "BindCommunityHover" })) { %> Add Community: <input type="text" id="communityName" name="communityName" /> <input type="submit" value="Add" /> <% } %> And the following JavaScript method in the file: function BindCommunityHover() { $(".community-item-li").hover( function () { $(this).addClass("communityHover"); }, function () { $(this).removeClass("communityHover"); } ); }; Is there any reason why BindCommunityHover is not being called when the AJAX result comes back? The community-list div is properly updated (the action returns a partial view). I have also tried setting OnComplete (instead of OnSuccess) to no avail. The BindCommunityHover method is called in a $(function(){...}); block when the page first loads, and for all existing .community-item-li elements, it works. The partial result from my controller replaces all items in that div with more of the same class. The OnSuccess method is supposed to fire after the document is updated. Update: k...this gets weird. I added the following to the BindCommunityHover method: alert($(".community-item-li").size()); I'm getting 240 in the alert when the page loads and when the callback fires. So, the callback IS firing, jQuery is matching the elements but not applying the styles...

    Read the article

  • What's a good plugin or guide I can use to create javascript widgets from a Rails App?

    - by nicosuria
    I've been looking around for a while now and the best guide I've seen so far is Dr Nic's DIY widgets how to (here). I haven't been able to make something like this work: Assuming this is my widget code: <script src="http://mysite/nomnoms.js"> </script> And my nomnoms controller looks like (assume that the list partial exists and simply lists down a link to the show page of each nomnom in the @nomnoms variable): class NomnomsController < ApplicationController def index @nomnoms = Nomnom.find(:all) @content = render_to_string(:partial => 'list') end end And in the index.js of my nomnoms_controller I have: page << "document.write('<div>'" page << "document.write('#{@content.to_json}')" page << "</div>" The above setup doesn't render anything :(. But when I change the second line of index.js to: page << "document.write('nomnoms should be here') ...the widget renders the text. Any help or even a point in the right direction would be greatly appreciated. Thanks in advance.

    Read the article

  • Assign delegate event handler from dynamically added child control

    - by mickyjtwin
    I have a control that handles commenting. In this control, I have set a delegate event handler for sending an email. I then have various types of controls, e.g. blog, articles etc, each of which may or may not have the commenting control added (which is done dynamically with me not knowing the id's), i.e. the commenting control is added outside this control. Each of these controls handles it's emailing differently(hence the event). What I'm trying to determine, is how to assign the event in the parent control. At the moment, I'm having to recursively search through all the controls on the page until I find the comment control, and set it that way. Example below explains: COMMENTING CONTROL public delegate void Commenting_OnSendEmail(); public partial class Commenting : UserControl { public Commenting_OnSendEmail OnComment_SendEmail(); private void Page_Load(object sender, EventArgs e) { if(OnComment_SendEmail != null) { OnComment_SendEmail(); } } } PARENT CONTROL public partial class Blog : UserControl { private void Page_Load(object sender, EventArgs e) { Commenting comControl = (Commenting)this.FindControl<Commenting>(this); if(comControl != null) { comCtrol.OnComment_SendEmail += new Commenting_OnSendMail(Blog_Comment_OnSendEmail); } } } Is there an easier way?

    Read the article

  • Can I stop the dbml designer from adding a connection string to the dbml file?

    - by drs9222
    We have a custom function AppSettings.GetConnectionString() which is always called to determine the connection string that should be used. How this function works is unimportant to the discussion. It suffices to say that it returns a connection string and I have to use it. I want my LINQ to SQL DataContext to use this so I removed all connection string informatin from the dbml file and created a partial class with a default constructor like this: public partial class SampleDataContext { public SampleDataContext() : base(AppSettings.GetConnectionString()) { } } This works fine until I use the designer to drag and drop a table into the diagram. The act of dragging a table into the diagram will do several unwanted things: A settings file will be created A app.config file will be created My dbml file will have the connection string embedded in it All of this is done before I even save the file! When I save the diagram the designer file is recreated and it will contain its own default constructor which uses the wrong connection string. Of course this means my DataContext now has two default constructors and I can't build anymore! I can undo all of these bad things but it is annoying. I have to manually remove the connection string and the new files after each change! Is there anyway I can stop the designer from making these changes without asking? EDIT The requirement to use the AppSettings.GetConnectionString() method was imposed on me rather late in the game. I used to use something very similar to what it generates for me. There are quite a few places that call the default constructor. I am aware that change them all to create the data context in another way (using a different constructor, static method, factory, ect..). That kind of change would only be slightly annoying since it would only have to be done once. However, I feel, that it is sidestepping the real issue. The dbml file and configuration files would still contain an incorrect, if unused, connection string which at best could confuse other developers.

    Read the article

  • Ruby on Rails: How to use a local variable in a collection_select

    - by mmacaulay
    I have a partial view which I'm passing a local variable into: <%= render :partial => "products/product_row", :locals => { :product => product } %> These are rows in a table, and I want to have a <select> in each row for product categories: <%= collection_select(:product, :category_id, @current_user.categories, :id, :name, options = {:prompt => "-- Select a category --"}, html_options = { :id => "", :class => "product_category" }) %> (Note: the id = "" is there because collection_select tries to give all these select elements the same id.) The problem is that I want to have product.category be selected by default and this doesn't work unless I have an instance variable @product. I can't do this in the controller because this is a collection of products. One way I was able to get around this was to have this line just before the collection_select: <% @product = product %> But this seems very hacky and would be a problem if I ever wanted to have an actual instance variable @product in the controller. I guess one workaround would be to name this instance variable something more specific like @product_select_tmp in hopes of not interfering with anything that might be declared in the controller. This still seems very hacky though, and I'd prefer a cleaner solution. Surely there must be a way to have collection_select use a local variable instead of an instance variable. Note that I've tried a few different ways of calling collection_select with no success: <%= collection_select(product, ... <%= collection_select('product', ... etc. Any help greatly appreciated!

    Read the article

  • Importing from referenced assembly - MEF

    - by cmaduro
    I have the following simplified code: namespace Silverbits.Applications { public partial class SilverbitsApplication : Application { [Import("MainPage")] public UserControl MainPage { get { return RootVisual as UserControl; } set { RootVisual = value; } } public SilverbitsApplication() { this.Startup += this.SilverbitsApplication_StartUp; this.Exit += new EventHandler(SilverbitsApplication_Exit); this.UnhandledException += this.SilverbitsApplication_UnhandledException; InitializeComponent(); } private void SilverbitsApplication_StartUp(object sender, StartupEventArgs e) { CompositionInitializer.SatisfyImports(this); } } namespace Manpower4U { public class App : SilverbitsApplication { public App() : base() { } } } namespace Manpower4U { [Export("MainPage")] public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); } } } The idea is that I have a Silverbits Library which is a completely different solution. And I have Manpower4U silverlight application that references my Silverbits library. I want to export MainPage from Manpower4U and set it to the RootVisual in my SilverbitsApplication class. SilverbitsApplication class is basically App.xaml/App.cs from the silverlight application, only I put it in a class library and subclassed App.cs file in Manpower4U, which is now the entry point of Manpower4U. MEF cannot resolve the import. How do I get this to work?

    Read the article

< Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >