Search Results

Search found 14131 results on 566 pages for 'note'.

Page 144/566 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • C# getting the results from an asynchronous call

    - by Jim Beam
    I have an API that I'm working with and it has limited documentation. I have been told that some of the methods that it executes are called asynchronously. How can I get the result of these asynchronous calls. Note that I am not doing anything special to call them, the API handles the asynchronous part. But I can't seem to get a "reply" back from these calls - I'm assuming that's because they are in another thread.

    Read the article

  • Using s/// in an expression

    - by mikeY
    I got a headache looking for this: How do you use s/// in an expression as opposed to an assignment. To clarify what I mean, I'm looking for a perl equivalent of python's re.sub(...) when used in the following context: newstring = re.sub('ab', 'cd', oldstring) The only way I know how to do this in perl so far is: $oldstring =~ s/ab/cd/; $newstring = $oldstring; Note the extra assignment.

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • No pre-built ActionBar for Android pre-3.0?

    - by Ollie C
    I note the release a few days ago of the static library bringing fragments to Android versions prior to 3.0, but does this library include the ActionBar? I suspect not. I assume that for an app that will work on pre-3.0 versions, that it needs a hand-built ActionBar implementation for versions up to 2.3 and then to use the OS default ActionBar in v3.0? for some reason I assumed the library had ActionBar in it, but as I dig further I'm not finding any evidence of its presence.

    Read the article

  • AWK Shift empty column to left (to start position)

    - by Filip Zembol
    INPUT: fofo jojo tst fojo jofo sts rhr hrhh dodo jojo hoho jojo zozo roro vovo OUTPUT: fofo jojo tst fojo jofo sts rhr hrhh dodo jojo hoho jojo zozo roro popo NOTE: Please help me, I need to shift all rows, which have first column empty. Every fields are tab delimited. In this file some rows start from first column, but some rows start from second or third column. Thank you

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • VS2010 throws exception while opening project

    - by Prashant
    When I try opening a project I get an exception saying Web application is configured to use IIS. Error : The Web Application Project EntityServices is configured to use IIS. To access local IIS Web sites, you must install the following IIS components: IIS 6 Metabase and IIS 6 Configuration Compatibility In addition, you must run Visual Studio in the context of an administrator account. NOTE - I have already installed IIS 7. My box is a x64 bit Windows 7 box.

    Read the article

  • what is the best and easiest to draw a multi bar chart in php

    - by gin
    i want to display the results of students scores in a multi-vertical bar chart (red bar for correct , green bar for false) for each question,, i already tried Google chart, but it gives me result in this way:link text note: the bars that reached the top , should not be at top ,, only because they have the highest value (75%), Google chart makes it at top which i don't want.. any suggestions about how to draw simple vertical bar chart with php

    Read the article

  • MySQL Table structure of thumb UP & DOWN for comments system ?

    - by Axel
    Hello, i already created a table for comments but i want to add the feature of thumb Up and Down for comments like Digg and Youtube, i use php & mysql and i'm wondering What's the best table scheme to implement that so comments with many likes will be on the top. This is my current comments table : comments(id,user,article,comment,stamp) Note: Only registred will be able to vote, so there isn't need to restrict the votes by IP Thanks

    Read the article

  • How to get the Queue name that NServiceBus pulled the message from.

    - by Simon
    I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

    Read the article

  • How can get autosuggest in cake php

    - by rajesh
    i hav entered my code in controller like below function keyup(){ $this-Note-simple(); if(strlen($searchq)0){ while ($row = mysql_fetch_array($getRecord)) { echo $row['name']; echo $row['department']; } return $row; } } as soon as i entered this one it doesn't display any info .... what correction should require.......

    Read the article

  • fread and fwrite are not recommended for use with structured data

    - by forest58
    A book beginning linux programming 3ed says "Note that fread and fwrite are not recommended for use with structured data.Part of the problem is that files written with fwrite are potentially nonportable between different machines." What does that mean exactly? what calls should I use if I want to write a portable structured data reader or writer? direct system calls?

    Read the article

  • iPad web app: Prevent input focus AFTER ajax call

    - by Mike Barwick
    So I've read around and can't for the life of me figure out of to solve my issue effectively. In short, I have a web app built for the iPad - which works as it should. However, I have an Ajax form which also submits as it should. But, after the callback and I clear/reset my form, the "iPad" automatically focuses on an input and opens the keyboard again. This is far from ideal. I managed to hack my way around it, but it's still not perfect. The code below is run on my ajax callback, which works - except there's still a flash of the keyboard quickly opening and closing. Note, my code won't work unless I use setTimeout. Also, from my understanding, document.activeElement.blur(); only works when there's a click event, so I triggered one via js. IN OTHER WORDS, HOW DO I PREVENT THE KEYBOARD FROM REOPENING AFTER AJAX CALL ON WEB APP? PS: Ajax call works fine and doesn't open the keyboard in Safari on the iPad, just web app mode. Here's my code: hideKeyboard: function () { // iOS web app only, iPad IS_IPAD = navigator.userAgent.match(/iPad/i) != null; if (IS_IPAD) { $(window).one('click', function () { document.activeElement.blur(); }); setTimeout(function () { $(window).trigger('click'); }, 500); } } Maybe it's related to how I'm clearing my forms, so here's that code. Note, all inputs have tabindex="-1" as well. clearForm: function () { // text, textarea, etc $('#campaign-form-wrap > form')[0].reset(); // checkboxes $('input[type="checkbox"]').removeAttr('checked'); $('#campaign-form-wrap > form span.custom.checkbox').removeClass('checked'); // radio inputs $('input[type="radio"]').removeAttr('checked'); $('#campaign-form-wrap > form span.custom.radio').removeClass('checked'); // selects $('form.custom .user-generated-field select').each(function () { var selection = $(this).find('option:first').text(), labelFor = $(this).attr('name'), label = $('[for="' + labelFor + '"]'); label.find('.selection-choice').html(selection); }); optin.hideKeyboard(); }

    Read the article

  • Check for Windsor Container Component Instance

    - by jeffn825
    How can I use my Windsor container to check if an instance (not just a component) has been registered? ie. container.ContainsInstance(typeof(MyType)) [EDIT] Another way of writing this might be Kernel.GetAssignableHandlers(typeof(object)) .Where(handler => handler.Service == typeof(MyType) || handler.ComponentModel.Implementation == typeof(MyType)) .Any(handler => handler.***Instance*** != null) Note that the property Instance doesn't exist in the API. Thanks.

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >