Search Results

Search found 14131 results on 566 pages for 'note'.

Page 145/566 | < Previous Page | 141 142 143 144 145 146 147 148 149 150 151 152  | Next Page >

  • three rows divs streach ! plz

    - by rich wecks
    Dear ALl: Thank you for this amazing site, what I am trying to do is to make three divs top (nav) center and footer div top and bottom divs have fixed height My question how can I make the center div streach 100% and subtract the height of the others (divs [top and bottom])? here is the path to the test page thank you in advance note: I have given the body, html height 100%

    Read the article

  • how to clear the the activity stack in android.

    - by Sam
    Hi, im having following application flow in my android app, Login-Home-screen1-screen2-screen3-screen4- logout In the screen4 i've a log out button,which allow user to logout from the application and re login.when i re-logn to the app previous data still be shown,is there way to start the application in fresh when user log out from the app NOTE: all the above activities launch mode set to "single task", regards, Sam.

    Read the article

  • When, if ever, is "number of lines of code" a useful metric?

    - by user15071
    Some people claim that code's worst enemy is its size, and I tend to agree. Yet every day you keep hearing things like I write blah lines of code in a day. I own x lines of code. Windows is x million lines of code. Question: When is "#lines of code" useful? ps: Note that when such statements are made, the tone is "more is better".

    Read the article

  • what is the best and easiest to draw a multi bar chart in php

    - by gin
    i want to display the results of students scores in a multi-vertical bar chart (red bar for correct , green bar for false) for each question,, i already tried Google chart, but it gives me result in this way:link text note: the bars that reached the top , should not be at top ,, only because they have the highest value (75%), Google chart makes it at top which i don't want.. any suggestions about how to draw simple vertical bar chart with php

    Read the article

  • Redirect a specific IP address to a special page of my homepage with .htaccess

    - by Jim Knopf
    How can I use .htaccess to forward a visitor of a specific IP address to a webpage on my server? This example causes an infinite loop: RewriteCond %{REMOTE_ADDR} ^123\.\123\.123\.123$ RewriteRule ^(.*)$ /specialpage.php [R,L] I found this on the web but it just does not work: SetEnvIf REMOTE_ADDR 123.123.123.123 REDIR="redir" RewriteCond %{REDIR} redir RewriteRule ^(.*)$ /specialpage.php Note: My website consists of .htm, html and .php pages. Your help would be very much appreciated.

    Read the article

  • MySQL Table structure of thumb UP & DOWN for comments system ?

    - by Axel
    Hello, i already created a table for comments but i want to add the feature of thumb Up and Down for comments like Digg and Youtube, i use php & mysql and i'm wondering What's the best table scheme to implement that so comments with many likes will be on the top. This is my current comments table : comments(id,user,article,comment,stamp) Note: Only registred will be able to vote, so there isn't need to restrict the votes by IP Thanks

    Read the article

  • how to select posts by particular author? (wordpress)

    - by Radek
    I have a page with template No Sidebars I want to list 5 posts' titles on that page by author where the author's name = page's title any idea how to do so without using any plugin? I thought that query_posts function would do the trick but this important note kind of tells me that I cannot use query_posts

    Read the article

  • Executing JavaScript with Python without X.

    - by Thomas
    I want to parse a html-page that unfortunately requires JavaScript to show any content. In order to do so I use a small python-script that pulls the html-code of the page, but after that I have to execute the JavaScript in a DOM-context which seems pretty hard. To make it even harder I want to use it in a server environment that has no X11-server. Note: I already read about http://code.google.com/p/pywebkitgtk/ but it seems to need a X-server.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • How to implement == or >= operators for generic type

    - by momsd
    I have a generic type Foo which has a internal generic class Boo. Boo class a property Value of type K. In a method inside Foo i want to do a boo.Value >= value Note that second operand value is of type T. while compiling i am getting following error: Operator '=' cannot be applied to operands of type 'T' and 'T' Can anyone please tell me whats the problem here?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Updating a TextView with a SeekBar's value (ultra-slow)

    - by Peter Bjorn
    Now look at that! I am having trouble with one of the simplest goals: updating a plain TextView with the value of a SeekBar. This is my approach: @Override public void onProgressChanged(SeekBar seekBar, int progress, boolean fromUser) { if (fromUser) { mInfoText.setText(mFunction.getUserFriendlyString(progress)); } } It basically works, but it kind of blocks the whole UI when I'm dragging. (Note: I tried both View.post() and Activity.runOnUiThread()). Am I overlooking something?

    Read the article

  • Regarding orientation

    - by muhammadhanifas
    Anyone please answer for my requirement Im using my application in this order, first page = UIViewController, secondpage = UITabBarController with 4 tabs, I need landscape on the orientation on the second tabpage(UIViewController) ? not working.. Note : When using UITabBarController its working perfect but when I add the UIViewController for my first page, the orientation not working...? anyone who knows the solution plz answer

    Read the article

  • ASp.NET Dropdown and Dictionary

    - by Lijo
    Hi Team, I am using a dropdown list in ASP.NET with C#. I am trying to bind a dictionary to the dropdownlist. How can we specify the "Text" (key of dictionary as Text of drop down) and "value" (value as Value) for the dropdown? Could you please help? Note: There is a constraint that a class should not be introduced for this purpose. That is why I am trying to use a dictionary. Thanks Lijo

    Read the article

  • define colors as variables in CSS

    - by patrick
    Hi all, I'm working CSS file which is quite long. I know the client could ask for changes to the color scheme, and was wondering: is it possible to assign colors to variables so I can just change them to have the new color applied to all elements that use it? Please note I can't use php to dynamically change the css file.

    Read the article

  • Rendering suggested values from an ext Combobox to an element in the DOM

    - by qui
    I have an ext combobox which uses a store to suggest values to a user as they type. An example of which can be found here: combobox example Is there a way of making it so the suggested text list is rendered to an element in the DOM. Please note I do not mean the "applyTo" config option, as this would render the whole control, including the textbox to the DOM element.

    Read the article

  • When is a cookie available?

    - by H4mm3rHead
    Hi i have a web application where i plant a cookie on my page. Then the user goes to another page, and from that page calls my page from a script, like this: <script type="text/javascript" src="http://domain.com/page.aspx?id=6" ></script> But i cant access the cookie when it calls my page, why not? and how to work around it? Please note that this question is in relation to: http://stackoverflow.com/questions/2660427/javascript-and-webshop-tracking-affiliate-across-websites-how-to-do

    Read the article

  • Cannot resolve the collation conflict ???

    - by HAJJAJ
    hi guys I had this error and i don't know how to fix it Message=Cannot resolve the collation conflict between "Arabic_CI_AS" and "SQL_Latin1_General_CP1_CI_AS" in the equal to operation. note: I already change the collation from the database option -- Collation i change it from "Arabic_CI_AS" to "SQL_Latin1_General_CP1_CI_AS" and i am still getting the same error !! any suggestion to solve this ?

    Read the article

< Previous Page | 141 142 143 144 145 146 147 148 149 150 151 152  | Next Page >