Search Results

Search found 54984 results on 2200 pages for 'program files'.

Page 164/2200 | < Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >

  • Windows 7 Locking Executable Files

    - by James Burgess
    Since I've been using Windows 7 RTM (as opposed to the Beta and RCs), I've been having a peculiar issue with executable files. I first noticed it whilst using Visual Studio, in that when building a project, it would often fail saying that the output file was locked - but the problem has stemmed further. When I've executed an application, closed it (cleanly), and attempted to delete/move/rename/overwrite said file, Windows 7 tells me that the file is locked/access is denied. I've made use of software like LockHunter/Unlocker but it is seemingly unable to remove these locks (most of the time, it shows no locks at all). After about 5-10 minutes, the respective files are unlocked again, but needless to say this is a bit of a workflow-breaker (as it's not simply constrained to VS). I've done the usual tasks of virus/malware scanning, and turned up with absolutely nothing. I've got no peculiar services running, and the problem was not present before I installed a Windows 7 RTM version. Any help is greatly appreciated.

    Read the article

  • Encrypt shared files on AD Domain.

    - by Walter
    Can I encrypt shared files on windows server and allow only authenticated domain users have access to these files? The scenario as follows: I have a software development company, and I would like to protect my source code from being copied by my programmers. One problem is that some programmers use their own laptops to developing the company's software. In this scenario it's impossible to prevent developers from copying the source code for their laptops. In this case I thought about the following solution, but i don't know if it's possible to implement. The idea is to encrypt the source code and they are accessible (decrypted) only when developers are logged into the AD domain, ie if they are not logged into the AD domain, the source code would be encrypted be useless. How can be implemented this using EFS?

    Read the article

  • Bash or python for changing spacing in files

    - by Werner
    Hi, I have a set of 10000 files. In all of them, the second line, looks like: AAA 3.429 3.84 so there is just one space (requirement) between AAA and the two other columns. The rest of lines on each file are completely different and correspond to 10 columns of numbers. Randomly, in around 20% of the files, and due to some errors, one gets BBB 3.429 3.84 so now there are two spaces between the first and second column. This is a big error so I need to fix it, changing from 2 to 1 space in the files where the error takes place. The first approach I thought of was to write a bash script that for each file reads the 3 values of the second line and then prints them with just one space, doing it for all the files. I wonder what do oyu think about this approach and if you could suggest something better, bashm python or someother approach. Thanks

    Read the article

  • get a set of files that have been modified after a certain date

    - by jcollum
    Does anyone have a handy powershell script that gets a set of files from TFS based on a modification date? I'd like to say "give me all the files in this folder (or subfolder) that were modified after X/Y/ZZZZ" and dump those files to a folder other than the folder they would normally go to. I know enough powershell to hack about and get this done, eventually, but I'm hoping to avoid that.

    Read the article

  • Haskell lazy I/O and closing files

    - by Jesse
    I've written a small Haskell program to print the MD5 checksums of all files in the current directory (searched recursively). Basically a Haskell version of md5deep. All is fine and dandy except if the current directory has a very large number of files, in which case I get an error like: <program>: <currentFile>: openBinaryFile: resource exhausted (Too many open files) It seems Haskell's laziness is causing it not to close files, even after its corresponding line of output has been completed. The relevant code is below. The function of interest is getList. import qualified Data.ByteString.Lazy as BS main :: IO () main = putStr . unlines =<< getList "." getList :: FilePath -> IO [String] getList p = let getFileLine path = liftM (\c -> (hex $ hash $ BS.unpack c) ++ " " ++ path) (BS.readFile path) in mapM getFileLine =<< getRecursiveContents p hex :: [Word8] -> String hex = concatMap (\x -> printf "%0.2x" (toInteger x)) getRecursiveContents :: FilePath -> IO [FilePath] -- ^ Just gets the paths to all the files in the given directory. Are there any ideas on how I could solve this problem? The entire program is available here: http://haskell.pastebin.com/PAZm0Dcb

    Read the article

  • Combine and compress script files in asp.net mvc

    - by victor_foster
    I am working in Visual Studio 2008, IIS7 and using asp.net MVC. I would like to know the best way to combine all of my Javascript files into one file to reduce the number of HTTP requests to the server. I have seen many articles on this subject but I'm not sure which one I should look at first (many of them are over a year old). Here are the things I would like to do: Combine my Javascript and css files Safely compress my Javascript files when I publish, but keep them uncompressed while I am debugging Cache my Css and Javascript files but allow them to refreshed with a hard refresh when they are updated without having to rename them.

    Read the article

  • tool for advanced ID3 tags handling and audio files ordering

    - by Juhele
    I have following problem – some of my files do not have complete ID3 tags and some have typos or small differences in writing - so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override “artist” in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but artist is missing etc. Without touching the audio quality, of course (but this should be no problem, I think). I already tried tools in Winamp, Songbird and other players and currently most advanced free tool I tried is Tagscanner. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • My C# program running as Windows Service is blocking Windows XP from hibernation

    - by sherpa
    I have Windows Service written in C#. It starts two threads, one is pooling a Web Service, second is waiting on a Monitor object for a new job to arrive. Besides that, the main thread acts as a WCF service host using NetNamedPipeBinding. It lets the client application to register a callback and then sends notifications back. The problem I have is that when this Windows Service is running, I cannot hibernate or Standby my computer which is running on Windows XP, SP3. When I set Windows to hibernate or standby, nothing happens. Then, at the moment when I go to Service Manager and stop the service, the system hibernation starts immediately. The service class extending the ServiceBase has properties like CanHandlePowerEvent, CanPauseAndContinue, etc. set to true... That didn't make any difference. The question is: what can be blocking the Hibernation/Standby from proceeding? What should I take care about to avoid it?

    Read the article

  • CVS list of files only in working directories

    - by Joshua Berry
    Is it possible to get a list of files that are in the working directory tree, but not in the current branch/tag? I currently diff the working copy with another directory updated to the same module and tag/branch but without the local non-repo files. It works, but doesn't honor the .cvsignore files. I figure there must be an option using a variation of 'cvs diff'. Thanks in advance.

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • EF 4.x generated entity classes (POCO) and Map files

    - by JBeckton
    I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

    Read the article

  • puppet agent doesn't retrieve files from master

    - by nicmon
    I have a very basic question regarding to Puppet 3.0.1 configuration. I setup a puppet master server (CentOS) with 2 agents (CentOS and Windows 7), all 3 can ping and access each other. There is no error at all. I have copied a file under /etc/puppet/files/test2.txt my site.pp (/etc/puppet/manifests) contains these lines: node default { include test file { "/tmp/testmaster.txt": owner => root, group => root, mode => 644, source => "puppet:///files/test2.txt" } } but there will no file be created on agent servers under /tmp/ once I run "puppet agent --test" here is the output: [root@agent1 ~]# puppet agent --test Info: Retrieving plugin Info: Caching catalog for agent1.mydomain.com Info: Applying configuration version '1354267916' Finished catalog run in 0.02 seconds "puppet apply /etc/puppet/manifests/site.pp" creates the testmaster.txt under /tmp/ on master.

    Read the article

  • hosting acounts for large uploads

    - by Phil Jackson
    Hi, im wondering if anyone knows of any host providers ( uk preferably ) that deals mostly with accepting large file uploads. Most hosts only let you push something like 1.5mb ( thats taking into account the connection and the max execution time ). What i am looking for is a host specificaly for storing files on. I was going to create an upload script onto my application which posted the file to the external host and then return back ( using headers so the user doen't even know they have left ). Does anyone know of a host for this?

    Read the article

  • multiple FileSystemWatchers to monitor files on local system?

    - by Jason Crowes
    We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Search Files (Preferably with index) on Windows 2000 Server

    - by ThinkBohemian
    I have many files on a windows server 2000 machine that is setup to act as a networked disk drive, is there anyway I can index the files and make that index available as a search to more people than just me? Bonus if the index can look inside of documents such as readme.txt? If there is no easy way to do this globaly (for all users) Is there a way I could generate and store an index locally on my computer? If this is the wrong place to ask this question, any advice on community more suited?

    Read the article

  • Creating a program to find longest path

    - by stef89
    Hi everyone, I'm fairly new to programming and I'm having a few problems. Basically I have to make a function that will find the lengths of all the paths through a network diagram. I've been working on this for hours but I can't seem to get anywhere. Using recursion I can navigate through every path but I'm just unsure as to how I should record the lengths of the paths. Any help would be greatly appreciated. Thanks! $dependencies = array("","","","1","3","4,2"); $durations = array("5","3","4","11","9","10"); function tracePath($path,$dependencies,$durations,$returnArray=array()) { if($dependencies[$path] != "") { $currentTaskDependencies = preg_split("/[\s]*[,][\s]*/", $dependencies[$path]); for($i=0;$i<count($currentTaskDependencies);$i++) { tracePath($currentTaskDependencies[$i]-1,$dependencies,$durations,$returnArray[$i]); } } return $returnArray; } tracePath(6,$dependencies,$durations);

    Read the article

  • criteria of software program being intelligent

    - by bobah
    Just out of curiosity, assuming there exists an software life form. How would you detect him/her? What are your criteria of figuring out if something/someone is intelligent or not? It seems to me that it should be quite simple to create such software once you set the right target (not just following a naive "mimic human-pass Turing Test" way). When posting an answer try also finding a counter example. I have real difficuly inventing anything consistent which I myself agree with. Warmup

    Read the article

  • Windows script to create directories of 3,000 files

    - by uhpl1
    We have some email archiving that is dumping all the emails into a directory. Because of some performance reasons with the server, I want to setup an automated task that will run a script once a day and if there is more than 3,000 (or whatever number) of files in the main directory, create a new directory with the date and move all the main directory files into it. I'm sure someone has already written something similar, so if anyone could point me at it that would be great. Batch file or Powershell would both be fine.

    Read the article

  • Seemingly random 404's for static files in Pyramid project

    - by seth
    I'm running a Pyramid project with mod_wsgi. Some of the files in my static directory (images, stylesheets, javascript) load fine, but others are coming up as not found. The files that are not working are all web fonts (otf, svg, woff and eot). I tried adding a text file into the static directory where the fonts are to see if I could access it, but it also came back with 404. The same text file also can't be accessed when put in the images folder. From what I'm looking at, it doesn't seem to be a permissions issue. Any ideas?

    Read the article

< Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >