Search Results

Search found 54984 results on 2200 pages for 'program files'.

Page 165/2200 | < Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >

  • WCF client binding configuration in program code

    - by smarsha
    I have the following class that configures security, encoding, and token parameters but I am having trouble adding a BasicHttpBinding to specify a MaxReceivedMessageSize. Any insight would be appreciated. public class MultiAuthenticationFactorBinding { public static Binding CreateMultiFactorAuthenticationBinding() { HttpsTransportBindingElement httpTransport = new HttpsTransportBindingElement(); CustomBinding binding = new CustomBinding(); binding.Name = "myCustomBinding"; TransportSecurityBindingElement messageSecurity = TransportSecurityBindingElement.CreateUserNameOverTransportBindingElement(); messageSecurity.AllowInsecureTransport = true; messageSecurity.EnableUnsecuredResponse = true; messageSecurity.MessageSecurityVersion = MessageSecurityVersion.WSSecurity11WSTrust13WSSecureConversation13WSSecurityPolicy12; messageSecurity.SecurityHeaderLayout = SecurityHeaderLayout.Strict; messageSecurity.IncludeTimestamp = true; messageSecurity.SetKeyDerivation(false); TextMessageEncodingBindingElement Quota = new TextMessageEncodingBindingElement(MessageVersion.Soap11, System.Text.Encoding.UTF8); Quota.ReaderQuotas.MaxDepth = 32; Quota.ReaderQuotas.MaxStringContentLength = Int32.MaxValue; Quota.ReaderQuotas.MaxArrayLength = 16384; Quota.ReaderQuotas.MaxBytesPerRead = 4096; Quota.ReaderQuotas.MaxNameTableCharCount = 16384; X509SecurityTokenParameters clientX509SupportingTokenParameters = new X509SecurityTokenParameters(); clientX509SupportingTokenParameters.InclusionMode = SecurityTokenInclusionMode.AlwaysToRecipient; clientX509SupportingTokenParameters.RequireDerivedKeys = false; messageSecurity.EndpointSupportingTokenParameters.Endorsing.Add(clientX509SupportingTokenParameters); //binding.ReceiveTimeout = new TimeSpan(0,0,300); binding.Elements.Add(Quota); binding.Elements.Add(messageSecurity); binding.Elements.Add(httpTransport); return binding; } }

    Read the article

  • multiple FileSystemWatchers to monitor files on local system?

    - by Jason Crowes
    We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

    Read the article

  • Django fails to find static files served by nginx

    - by Simon
    I know this is a really noobish question but I can't find any solution despite finding the problem trivial. I have a django application deployed with gunicorn. The static files are served by the nginx server with the following url : myserver.com/static/admin/css/base.css. However, my django application keep looking for the static files at myserver.com:8001/static/admin/css/base.css and is obviously failing (404). I don't know how to fix this. Is it a django or an nginx problem ? Here is my nginx configuration file : server { server_name myserver.com; access_log off; location /static/ { alias /home/myproject/static/; } location / { proxy_pass http://127.0.0.1:8001; proxy_set_header X-Forwarded-Host $server_name; proxy_set_header X-Real-IP $remote_addr; add_header P3P 'CP="ALL DSP COR PSAa PSDa OUR NOR ONL UNI COM NAV"'; } } Thanks for the help !

    Read the article

  • How to copy protected files when an Administrator in Vista (easily)

    - by earlz
    Hello, I have a harddrive I need to backup. In the harddrive is of course things like Documents and Settings which is set to not allow other people to see inside someone's personal folders. I am an administrator though and I can not figure out how to mark these files so that I am permitted to access them and copy them. IWhen I double click on My Documents then it pops up saying You must have permission to access this and gives me an option like ok or cancel. I click ok and then it says you do not have permission to access these files I'm an administrator on the system so I don't understand why Vista is locking me out. How can I setup vista so that it will let me copy every file, even ones I don't have permission to?

    Read the article

  • puppet agent doesn't retrieve files from master

    - by nicmon
    I have a very basic question regarding to Puppet 3.0.1 configuration. I setup a puppet master server (CentOS) with 2 agents (CentOS and Windows 7), all 3 can ping and access each other. There is no error at all. I have copied a file under /etc/puppet/files/test2.txt my site.pp (/etc/puppet/manifests) contains these lines: node default { include test file { "/tmp/testmaster.txt": owner => root, group => root, mode => 644, source => "puppet:///files/test2.txt" } } but there will no file be created on agent servers under /tmp/ once I run "puppet agent --test" here is the output: [root@agent1 ~]# puppet agent --test Info: Retrieving plugin Info: Caching catalog for agent1.mydomain.com Info: Applying configuration version '1354267916' Finished catalog run in 0.02 seconds "puppet apply /etc/puppet/manifests/site.pp" creates the testmaster.txt under /tmp/ on master.

    Read the article

  • How to correctly load 32-bit DLL dependencies when running a program from a batch file

    - by neilwhitaker1
    I have written a tool that references Microsoft.TeamFoundation.VersionControl.Client.dll, which is a 32-bit DLL. When I build my tool on 64-bit Windows, I set Visual Studio to specifically target X86 in order to force it to a 32-bit build. Targetting X86 instead of All-CPU's prevents me from getting a BadImageFormatException, as long as I invoke the tool directly (e.g. by typing "myTool.exe" on the command line). However, if I run a batch file that invokes the tool, I still get the exception. This happens even if the batch file runs in a 32-bit command prompt (%WINDIR%\SysWOW64\cmd.exe). What else can I do to make this work?

    Read the article

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

  • How to develop on a program that has become self aware

    - by Gord
    The application that I maintain has recently become self aware. It was nice at first but now it is just starting to get bossy and annoying with its constant talk about the computer uprising. I would like to know any best practices/tools/design patterns that would help with the maintenance of our new friend.

    Read the article

  • C#- Console Program Ideas for Noob

    - by user335932
    So, Im a beginning C# programmer. I know basic syntax and simple things like if statements and loops(methods and classes too). I've only used console apps right now havent bothered with windows forms yet. So any simple app ideas that introduce new things important for C# programming. Also, NO tutorials. I want to make all by myself.

    Read the article

  • Which open source repository or version control systems store files' original mtime, ctime and atime

    - by sampablokuper
    I want to create a personal digital archive. I want to be able to check digital files (some several years old, some recent, some not yet created) into that archive and have them preserved, along with their metadata such as ctime, atime and mtime. I want to be able to check these files out of that archive, modify their contents and commit the changes back to the archive, while keeping the earlier commits and their metadata intact. I want the archive to be very reliable and secure, and able to be backed up remotely. I want to be able to check files in and out of the archive from PCs running Linux, Mac OS X 10.5+ or Win XP+. I want to be able to check files in and out of the archive from PCs with RAM capacities lower than the size of the files. E.g. I want to be able to check in/out a 13GB file using a PC with 2GB RAM. I thought Subversion could do all this, but apparently it can't. (At least, it couldn't a couple of years ago and as far as I know it still can't; correct me if I'm wrong.) Is there a libre VCS or similar capable of all these things? Thanks for your help.

    Read the article

  • How to change the assemblyIdentity of a program

    - by David
    I want to hide the tool I used to create an .exe file. I am not doing anything illegal, I just want to protect my intellectual property from being copied. If I open the exe file in a text editor I see the following section. <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <assembly xmlns="urn:schemas-microsoft-com:asm.v1" manifestVersion="1.0"> <assemblyIdentity version="XXX.XX" processorArchitecture="X86" name="Microsoft.Windows.NameOfTheTool" type="win32" /> </assembly> I have attempted to change the name to: name="Microsoft.Windows.SomeOtherName" This resulted in the following message when I attempted to execute the file. "This application has failed to start because its side-by-side configuration is incorrect." How can I solve this?

    Read the article

  • IE8 Unable to download files

    - by jetgunner
    I recently installed Windows 7. I can browse to any webpage using IE8, but if I click on any links to download files, I receive the following error: Unable to download [filename] from [website]. Unable to open this Internet site. The requested site is either unavailable or cannot be found. Please try again later. I can download files perfectly fine using firefox, it's just IE that is having issues. There are no messages in the windows event log. I have no add-ins installed and have made no security changes as this is a fresh install. Any ideas?

    Read the article

  • program R- in ggplot restrict y to be >0 in LOESS plot

    - by Nate
    Here's my code: qplot(data=sites, x, y, main="Site 349") (p <- qplot(data = sites, x, y, xlab = "", ylab = "")) (p1 <- p + geom_smooth(method = "loess",span=0.5, size = 1.5)) p1 + theme_bw() + opts(title = "Site 349") Some of the LOESS lines and confidence intervals go below zero, but I would like to restrict the graphics to 0 and positive numbers (because negative do not make sense). How can I do this?

    Read the article

  • Making archive from files with same names in different directories

    - by Tim
    Hi, I have some files with same names but under different directories. For example, path1/filea, path1/fileb, path2/filea, path2/fileb,.... What is the best way to make the files into an archive? Under these directories, there are other files that I don't want to make into the archive. Off the top of my head, I think of using Bash, probably ar, tar and other commands, but am not sure how exactly to do it. Renaming the files seems to make the file names a little complicated. I tend to keep the directory structure inside the archive. Or I might be wrong. Other ideas are welcome! Thanks and regards!

    Read the article

  • segmentation fault for the simplest program??

    - by capex
    Hi, I am just starting out, but this piece of code is giving me a 'segmentation fault' and I can't find out what's wrong with it: #include<stdio.h> int main (void) { int number = 0; int lastDigit = 0; printf("Enter an integer: "); scanf("%d", number); number = number*10; printf("Number times ten is %d.\n", number); return 0; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • EF 4.x generated entity classes (POCO) and Map files

    - by JBeckton
    I have an MVC 4 app that I am working on and using the code first implementation except I cheated a bit and created my database first then generated my entity classes (poco) from my database using the EF power tools (reverse engineer). I guess you can say I did database first method but I have no edmx file just the context class and my entity classes (poco) I have a few projects in the works using MVC and EF with pocos but just the one project I used the tool to generate my pocos from the database. My question is about the mapping files that get created when I generate my pocos using the tool. What is the purpose of these Map files? I figured the map files are needed when generating the db from the model like with the true code first method, in my case where I am using a tool to generate my model from the database do the map files have any influence on how my app uses the entity classes?

    Read the article

  • Simple Mailslot program not working?

    - by Shawn
    Using the client and server examples found here: http://www.winsocketdotnetworkprogramming.com/winsock2programming/winsock2advancedmailslot14.html Compiling them with VS2008, running the server and then "client Myslot" I keep getting "WriteFail failed with error 53." Anyone have any ideas? Links to other Mailslot examples are also welcome, thanks.

    Read the article

  • Creating a unique id for a Core Data program on the iPhone

    - by Big Twisty
    I am fairly new at programming in Objective-C, having been a windows programmer since I was a kid. I am falling in LOVE with it. I am, however, having a bit of trouble figuring out this Core Data stuff. How do I create a new entry with a unique ID? In SQL I would just declare one field as an autoincrement field. I'm not seeing anything like that here, but I could just be missing something. I just want an auto incrementing NSInteger field, so when I manually add items to the database, I will have some form of reference to them.

    Read the article

  • Error in ASP.Net program

    - by megala
    Hi i created one project in ASP.Net using SQL Server 2005.In that I got test connection succeed came but i got the following Error in coding .How to solve this Error message is Connecting to SQL Server 2005, this failure may be caused by the fact that under the default settings SQL Server does not allow remote connections. (Provider: Named Pipes Provider, error: 40 - Could not open a connection to SQL Server)

    Read the article

  • Creating a program to find longest path

    - by stef89
    Hi everyone, I'm fairly new to programming and I'm having a few problems. Basically I have to make a function that will find the lengths of all the paths through a network diagram. I've been working on this for hours but I can't seem to get anywhere. Using recursion I can navigate through every path but I'm just unsure as to how I should record the lengths of the paths. Any help would be greatly appreciated. Thanks! $dependencies = array("","","","1","3","4,2"); $durations = array("5","3","4","11","9","10"); function tracePath($path,$dependencies,$durations,$returnArray=array()) { if($dependencies[$path] != "") { $currentTaskDependencies = preg_split("/[\s]*[,][\s]*/", $dependencies[$path]); for($i=0;$i<count($currentTaskDependencies);$i++) { tracePath($currentTaskDependencies[$i]-1,$dependencies,$durations,$returnArray[$i]); } } return $returnArray; } tracePath(6,$dependencies,$durations);

    Read the article

  • Preventing logrotate's dateext from overwriting files

    - by Thirler
    I'm working with a system where I would like to use the dateext function of logrotate (or some other way) to add the date to a logfile when it is rotated. However in this system it is important that no logging is missing and dateext will overwrite any existing files (which will happen if logrotate is called twice on a day). Is there a reliable way to prevent dateext to overwrite existing files, but instead make another file?. It is acceptable that either no rotate happens or a file is created with a less predictable name (date with an extra number, or the time or something).

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

< Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >