Search Results

Search found 11597 results on 464 pages for 'complete graph'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 190/464 | < Previous Page | 186 187 188 189 190 191 192 193 194 195 196 197  | Next Page >

  • SQLAlchemy - select for update example

    - by Mark
    I'm looking for a complete example of using select for update in SQLAlchemy, but haven't found one googling. I need to lock a single row and update a column, the following code doesn't work (blocks forever): s = table.select(table.c.user=="test",for_update=True) u = table.update().where(table.c.user=="test") u.execute(email="foo") Do I need a commit? How do I do that? As far as I know you need to: begin transaction select ... for update update commit

    Read the article

  • is it legal to use fontsquirrel.com to create a @font-face kit for a font I have been given?

    - by ongoingworlds
    fontsquirrel.com allows you to upload a font and create a @font-face kit which you can apply to your website and use to display fonts which will display cross-browser (even in IE6!). But what I want to know is, is this legal? I've been supplied the font "Lubalin Graph Std" and told to use this for headers on the website I'm creating. I can upload the font file to fontsquirrel.com and use this to display headers in this font across the website - but I'm worried we'll get into trouble for doing this. What should I do?

    Read the article

  • pthread and child process data sharing in C

    - by mustafabattal
    hi everyone, my question is somewhat conceptual, how is parent process' data shared with child process created by a "fork()" call or with a thread created by "pthread_create()" for example, are global variables directly passed into child process and if so, does modification on that variable made by child process effect value of it in parent process? i appreciate partial and complete answers in advance, if i'm missing any existing resource, i'm sorry, i've done some search on google but couldn't find good results thanks again for your time and answers

    Read the article

  • Where the hell is shared_ptr!?!

    - by Jake
    I am so frustrated right now after several hours trying to find where the hell is shared_ptr located at. None of the examples i see show complete code to include the headers for shared_ptr (and working). simply stating "std" "tr1" and "" is not helping at all! I have downloaded boosts and all but still it doesn't show up! Can someone help me by telling exactly where to find it? Thanks for letting me vent my frustrations!

    Read the article

  • Solving a SQL Server Deadlock situation

    - by mjh41
    I am trying to find a solution that will resolve a recurring deadlock situation in SQL server. I have done some analysis on the deadlock graph generated by the profiler trace and have come up with this information: The first process (spid 58) is running this query: UPDATE cds.dbo.task_core SET nstate = 1 WHERE nmboxid = 89 AND ndrawerid = 1 AND nobjectid IN (SELECT nobjectid FROM ( SELECT nobjectid, count(nobjectid) AS counting FROM cds.dbo.task_core GROUP BY nobjectid) task_groups WHERE task_groups.counting > 1) The second process (spid 86) is running this query: INSERT INTO task_core (…) VALUES (…) spid 58 is waiting for a Shared Page lock on CDS.dbo.task_core (spid 86 holds a conflicting intent exclusive (IX) lock) spid 86 is waiting for an Intent Exclusive (IX) page lock on CDS.dbo.task_core (spid 58 holds a conflicting Update lock)

    Read the article

  • JQUERY animate Delay?

    - by AnApprentice
    I'm using JQUERY animate to show a banner at the top of the page, which is a DIV that is set to top -60 to hide it. I'm using the following JS call to show the div: // Animation $('#message-dock').animate({ top: 0 }, 500, function() { // Animation complete. }); What I can't figure out is for some reason there is an unwanted delay before I start seeing the div and I can't figure out why? Any Ideas?

    Read the article

  • How can I create an editable combo box in HTML/Javascript?

    - by Christian Davén
    I need to let users select an item from a dropdown list, but also allow them to instead enter any text, even if it doesn't match an item in the list. How can I achieve this on a web page with HTML and Javascript? The select field doesn't let users enter text, and the input text field doesn't show the preferred alternatives. All items must show if the user opens the dropdown, so it can't be a simple auto-complete that only shows matching items.

    Read the article

  • Auto-Completion in Unix VI editor

    - by IllustratedInsomnia
    Hey guys, after using graphical IDE's like Visual Studio, I'm used to pressing CTRL+Space to auto-complete a variable or function name. Now, I know such a thing isn't completely possible in VI, but I heard there was a list of commands that could be mapped that allowed automatic completion of variables and functions in the current file opened. Does anyone know what this sequence is? Thanks in advance.

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • jQuery Sparklines: $.getJSON data can't be read

    - by Bob Jansen
    I'm trying to generate a pie graph with Sparklines but I'm running into some trouble. I can't seem to figure out what I'm doing wrong, but I feel it is a silly mistake. I'm using the following code to generate a sparkline chart in the div #traffic_bos_ss: //Display Visitor Screen Size Stats $.getJSON('models/ucp/traffic/traffic_display_bos.php', { type: 'ss', server: server, api: api, ip: ip, }, function(data) { var values = data.views; //alert(values); $('#traffic_bos_ss').sparkline(values, { type: "pie", height: "100%", tooltipFormat: 'data.screen - {{value}}', }); }); The JSON string fetched: {"screen":"1220x1080, 1620x1080, 1920x1080","views":"[2, 2, 61]"} For some reason Sparklines does not process the variable values. When I alert the variable it outputs "[2, 2, 61]". Now the jQuery code does work when I replace the snippet: var values = data.views; with var values = [2, 2, 61]; What am I doing wrong?

    Read the article

  • plot 3D and combine in matlab

    - by George
    Hello ,i have this matrix "experiment=2*rand(npoints,3)-1". I want to plot in in 3D,so i use "mesh(experiment)". How can i take red points in my plot? Also,i want to implement in the above plot , a sphere with radius 1 at 0,0,0. I did : mesh(experiment) hold on [x,y,z]=sphere; r=1; mesh(r*x,r*y,r*z) hold off but 1) i am not taking radius 1 2) the figures just showing in the same graph but don't combine Thanks

    Read the article

  • Count the number of rows of a CSV file, with d3.js

    - by user2934073
    Suppose I have this CSV file Day,What 2013-10-27,Apple 2013-10-27,Cake 2013-10-27,Apple 2013-10-28,Apple 2013-10-28,Apple 2013-10-28,Blueberry 2013-10-28,Orange I would like to drawn with D3.js a time-series graph. All I need to do is to display the sum of the number of rows for each day. As an example, the 27 of November should have 3 as value, the 28th should have 4. Is there a way I can archive it? I've been trying to create a new dataset out of the CSV one with no positive results. var dataset; d3.csv("data.csv", function(d) { return { Day: new Date(d.Day), What: d.What }; }, function(error, rows) { dataset = rows; // I SUPPOSE THE FUNCTION THAT GENERATE THE NEW DATASET SHOULD GO THERE });

    Read the article

  • Javascript expando objects

    - by xyz
    What are expando objects in javascripts? For what purpose we need this ? Any complete example will be appreciated I found 1 article here Javascript: The red-headed stepchild of web development Thanks

    Read the article

  • Restoring older firmware through XCode?

    - by Moshe
    I'm trying to restore iPhone OS 3.1.3 to a 3GS that has been upgraded to iOS 4. iTunes refuses to complete the install. What needs to be done? I am currently using the GM XCode. Should I be using the latest public stable version instead? Update: XCode reports that "The baseband cannot be rolled back".

    Read the article

  • Removing the transperancy from image while keeping the actual image

    - by KPL
    Hello people, I have three images,and , they are not square or rectangular in shape. They are just like face of anyone. So,basically, my images are in the size 196x196 or anything like that, but complete square or rectangle with the face in the middle and transperant background in the rest of the portion. Now, I want to remove the transperant background too and just keep the faces. Don't know if this is possible and mind you, this isn't a programming question.

    Read the article

  • memory problem with metapost

    - by yCalleecharan
    Hi, I'm using gnuplot to plot a graph to the mp format and then I'm converting it to eps via the command: mpost --sprologues=3 -soutputtemplate=\"%j-%c.eps\" myfigu.mp But I don't get the eps output; instead I get this message: This is MetaPost, version 1.208 (kpathsea version 3.5.7dev) (mem=mpost 2009.12.12) 6 MAY 2010 23:16 **myfigu.mp (./myfigu.mp ! MetaPost capacity exceeded, sorry [main memory size=3000000]. _wc-withpen .currentpen.withcolor.currentcolor gpdraw-...ptpath[(EXPR0)]_sms((EXPR1),(EXPR2))_wc .else:_ac.contour.ptpath[(... l.48052 gpdraw(0,517.1a,166.4b) ; If you really absolutely need more capacity, you can ask a wizard to enlarge me. How do I tweak in order to get more memory. The file from which I'm plotting has two columns of 189,200 values each. These values are of type long double (output from a C program). The text file containing these two column values is about 6 MB. Thanks a lot...

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 186 187 188 189 190 191 192 193 194 195 196 197  | Next Page >