Search Results

Search found 11597 results on 464 pages for 'complete graph'.

Page 194/464 | < Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201  | Next Page >

  • Doctrine inserts when it should update

    - by Goran Juric
    I am trying to use do the most simple update query but Doctrine issues an INSERT statement instead of an UPDATE. $q = Doctrine_Query::create() ->from('Image i') ->where('id = ?'); $image = $q->fetchOne($articleId, Doctrine_Core::HYDRATE_RECORD); $image->copyright = "some text"; $image->save(); I have also tried using the example from the manual, but still a new record gets inserted: $userTable = Doctrine_Core::getTable('User'); $user = $userTable->find(2); if ($user !== false) { $user->username = 'Jack Daniels'; $user->save(); } edit: This example from the manual works: $user = new User(); $user->assignIdentifier(1); $user->username = 'jwage'; $user->save(); The funny thing is that I use this on another model and there it works OK. Maybe I have to fetch the whole array graph for this to work (I have another model in a one to many relationship)?

    Read the article

  • Get the tags of a document in Subversion

    - by Onno
    I was wondering if there is a way to easily see the tags of a specific file in Subversion using the command line and/or TortoiseSVN. Most version control system allow you to see easily access the tags/labels of a file. When using TortoiseSVN I can do this when I access the "Revision Graph". This however is a operation that takes around 44 minutes. I consider this very hard work just to know what tags have been created for the file. Is there another way to do it? Or is there no way to instantaneously access tag information. Thanks, Onno

    Read the article

  • Should I create subclass NSManagedObject or not?

    - by TP
    Hi, I have spent a few days learning and writing NSCoding and finally got it working. However, it took very long to archive and unarchive the (quite complex) object graph, which is unacceptable. After searching the internet for some time, I think the better way is to use core data. Do you recommend that 1) I should rewrite all my classes as subclasses of NSManagedObject or 2) should I create an instance variable of NSManagedObject in each of my class so that any changes to the class also updates its core data representation? Doing either way will need significant changes to the exiting classes and I think I have to update lots of unit test cases as well if it changes the way the classes are initialized. What do you recommend? I really don't want to head to the wrong approach again... Thanks!

    Read the article

  • Facebook Api - Local development, Testserver, Liveserver ... How?

    - by Thijs Kaspers
    I'm working on a new website that uses the Facebook API for users to login and several implementations of the graph Api. My workflow usually is: Development on localhost Development using MAMP/XAMPP or similar software Push to server - testing domain A team of people can test the changes for a few days to see if everything works as planned. Push to server - live domain Changes are live for public Facebook uses the site URL in the appsettings and for security reasons, they will only redirect to that url... Problem is.. I have localhost and 2 different domains. How can I make this work? Ofcourse I could edit the hostsfile, but that only fixes it for localhost.. Still no solution for the testdomain. Please tell me this is somehow possible! I'm getting more and more depressed with the Facebook API.

    Read the article

  • open flash chart help needed

    - by Carlos Barbosa
    def reparto_de_ventas_por_marca #obtener los montos de las ventas en el periodo comprendido y sumarlas @ventas = Venta.find(:all) @marcas = Marca.find(:all) title = Title.new("Ingresos de este mes: #{@total}") pie = Pie.new pie.start_angle = 35 pie.animate = true pie.tooltip = '#val# de #total#<br>#percent# de 100%' pie.colours = ["#245a9c", "#fff"] pie.values = [ @marcas.each do |result| PieValue.new(result.ventas.count, result.name) end ] chart = OpenFlashChart.new chart.title = title chart.add_element(pie) chart.x_axis = nil render :text => chart.to_s end It just doesn't works i need to get the values to create a graph with flash chart. any help will be appreciated.

    Read the article

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • Sequencing 2 lines of JQUERY

    - by nobosh
    I have the following lines of JQUERY: // When dragging ends stop: function(event, ui) { // Replace the placeholder with the original $placeholder.after( $this.show() ).remove(); // Run a custom stop function specitifed in the settings settings.stop.apply(this); }, I don't want settings.stop.apply(this); to run UNTIL the line above is $placeholder.after( $this.show() ).remove();, right now what's happening is the settings.stop is running to early. With JQUERY, how can I Sequence these two lines to not proceed until the first is complete? Thanks

    Read the article

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • c++ to vb.net , problem with callback function

    - by johan
    I'm having a hard time here trying to find a solution for my problem. I'm trying to convert a client API funktion from C++ to VB.NET, and i think have some problems with the callback function. parts of the C++ code: typedef struct{ BYTE m_bRemoteChannel; BYTE m_bSendMode; BYTE m_nImgFormat; // =0 cif ; = 1 qcif char *m_sIPAddress; char *m_sUserName; char *m_sUserPassword; BOOL m_bUserCheck; HWND m_hShowVideo; }CLIENT_VIDEOINFO, *PCLIENT_VIDEOINFO; CPLAYER_API LONG __stdcall MP4_ClientStart(PCLIENT_VIDEOINFO pClientinfo,void(CALLBACK *ReadDataCallBack)(DWORD nPort,UCHAR *pPacketBuffer,DWORD nPacketSize)); void CALLBACK ReadDataCallBack(DWORD nPort,UCHAR *pPacketBuffer,DWORD nPacketSize) { TRACE("%d\n",nPacketSize); } ..... aa5.m_sUserName = "123"; aa5.m_sUserPassword="w"; aa5.m_bUserCheck = TRUE; MP4_ClientSetTTL(64); nn1 = MP4_ClientStart(&aa5,ReadDataCallBack); if (nn1 == -1) { MessageBox("error"); return; } SDK description: MP4_ClientStart This function starts a connection. The format of the call is: LONG __stdcall MP4_ClientStart(PCLIENT_VIDEOINFO pClientinfo, void(*ReadDataCallBack)(DWORD nChannel,UCHAR *pPacketBuffer,DWORD nPacketSize)) Parameters pClientinfo holds the information. of this connection. nChannel holds the channel of card. pPacketBuffer holds the pointer to the receive buffer. nPacketSize holds the length of the receive buffer. Return Values If the function succeeds the return value is the context of this connection. If the function fails the return value is -1. Remarks typedef struct{ BYTE m_bRemoteChannel; BYTE m_bSendMode; BYTE m_bImgFormat; char *m_sIPAddress; char *m_sUserName; char *m_sUserPassword; BOOL m_bUserCheck; HWND m_hShowVideo; } CLIENT_VIDEOINFO, * PCLIENT_VIDEOINFO; m_bRemoteChannel holds the channel which the client wants to connect to. m_bSendMode holds the network mode of the connection. m_bImgFormat : Image format, 0 is main channel video, 1 is sub channel video m_sIPAddress holds the IP address of the server. m_sUserName holds the user’s name. m_sUserPassword holds the user’s password. m_bUserCheck holds the value whether sends the user’s name and password or not. m_hShowVideo holds Handle for this video window. If m_hShowVideo holds NULL, the client can be record only without decoder. If m_bUserCheck is FALSE, we will send m_sUserName and m_sUserPassword as NULL, else we will send each 50 bytes. The length of m_sIPAddress and m_sUserName must be more than 50 bytes. ReadDataCallBack: When the library receives a packet from a server, this callback is called. My VB.Net code: Imports System.Runtime.InteropServices Public Class Form1 Const WM_USER = &H400 Public Structure CLIENT_VIDEOINFO Public m_bRemoteChannel As Byte Public m_bSendMode As Byte Public m_bImgFormat As Byte Public m_sIPAddress As String Public m_sUserName As String Public m_sUserPassword As String Public m_bUserCheck As Boolean Public m_hShowVideo As Long 'hWnd End Structure Public Declare Function MP4_ClientSetNetPort Lib "hikclient.dll" (ByVal dServerPort As Integer, ByVal dClientPort As Integer) As Boolean Public Declare Function MP4_ClientStartup Lib "hikclient.dll" (ByVal nMessage As UInteger, ByVal hWnd As System.IntPtr) As Boolean <DllImport("hikclient.dll")> Public Shared Function MP4_ClientStart(ByVal Clientinfo As CLIENT_VIDEOINFO, ByRef ReadDataCallBack As CALLBACKdel) As Long End Function Public Delegate Sub CALLBACKdel(ByVal nPort As Long, <MarshalAs(UnmanagedType.LPArray)> ByRef pPacketBuffer As Byte(), ByVal nPacketSize As Long) Public Sub CALLBACK(ByVal nPort As Long, <MarshalAs(UnmanagedType.LPArray)> ByRef pPacketBuffer As Byte(), ByVal nPacketSize As Long) End Sub Public mydel As New CALLBACKdel(AddressOf CALLBACK) Private Sub Form1_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load Dim Clientinfo As New CLIENT_VIDEOINFO() Clientinfo.m_bRemoteChannel = 0 Clientinfo.m_bSendMode = 0 Clientinfo.m_bImgFormat = 0 Clientinfo.m_sIPAddress = "193.168.1.100" Clientinfo.m_sUserName = "1" Clientinfo.m_sUserPassword = "a" Clientinfo.m_bUserCheck = False Clientinfo.m_hShowVideo = Me.Handle 'Nothing MP4_ClientSetNetPort(850, 850) MP4_ClientStartup(WM_USER + 1, Me.Handle) MP4_ClientStart(Clientinfo, mydel) End Sub End Class here is some other examples of the code in: C# http://blog.csdn.net/nenith1981/archive/2007/09/17/1787692.aspx VB ://read.pudn.com/downloads70/sourcecode/graph/250633/MD%E5%AE%A2%E6%88%B7%E7%AB%AF%28VB%29/hikclient.bas__.htm ://read.pudn.com/downloads70/sourcecode/graph/250633/MD%E5%AE%A2%E6%88%B7%E7%AB%AF%28VB%29/Form1.frm__.htm Delphi ://read.pudn.com/downloads91/sourcecode/multimedia/streaming/349759/Delphi_client/Unit1.pas__.htm

    Read the article

  • Post to a page wall that I'm not admin

    - by Jirico
    I created an app to post to pages the user chooses. How can I direct the message to a page Wall on behalf of the user? From my tests the post is sent, but the page can't see it and the page is not notified either. I have OAuth extended Permissions of publish_stream, what else do I need to my post not being invisible? I will try to clarify the problem in details: 1- I send a post to a Facebook page that is not mine, I'm just a normal user, via application that ask for publish_stream, read_stream permissions. 2- I verify the page logging as admin but no notification is delivered and I can't see the post on my Wall. 3-If I log as the sender user I can see the post on page Wall, it looks like the post is private and just the sender user can see It. If I try to recover the post via Graph API using the same user it returns false. 4- Only the users who has the app installed can see the post on page wall.

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Problem with displaying graphs on a Qt canvas

    - by Michal Nowotka
    Let's say I'm a Qt newbie. I want a good Qt library for displaying simple graphs. I've found the quanava library. But there is a problem. When I compiled a basic example it looks like graph edges are not painted properly when moving nodes. I don't have any idea where is a bug but this code seems to be rather simple. I think this is a problem with paint method in NodeItem class. Maybe someone has already solved this problem because this library is quite popular.

    Read the article

  • Portable PHP IDE / Editor

    - by Shishant
    Hello, There are a lot of IDE posts here but not for portable. Can anybody help me find a good portable PHP IDE? I am looking for this features: FTP Sitemanager Syntax Highlighting Auto-complete (Optional) I am fine even with a paid version. I tried aptana on my usb but the experience was not good.

    Read the article

  • Programming Language Choices for High Integrity Systems

    - by Finbarr
    What programming languages are a good choice for High Integrity Systems? An example of a bad choice is Java as there is a considerable amount of code that is inaccessible to the programmer. I am looking for examples of strongly typed, block structured languages where the programmer is responsible for 100% of the code, and there is as little interference from things like a JVM as possible. Compilers will obviously be an issue. Language must have a complete and unambiguous definition.

    Read the article

  • can QuickGraph support these requirements? (includes database persistence support)

    - by Greg
    Hi, Would QuickGraph be able to help me out with my requirements below? (a) want to model a graph of nodes and directional relationships between nodes - for example to model web pages/files linked under a URL, or modeling IT infrastructure and dependencies between hardware/software. The library would include methods such as * Node.GetDirectParents() //i.e. there could be more than one direct parent for a node * Node.GetRootParents() //i.e. traverse the tree to the top root parent(s) for the given node * Node.GetDirectChildren() * Node.GetAllChildren() (b) have to persist the data to a database - so it should support SQL Server and ideally SQLite as well. If it does support these requirement then I'd love to hear: any pointers to any parts of QuickGraph to dig into? what is the best concept re it's usage in terms of how to use database persistence - is it a simpler design to assume every search/method works directly on the database, or does QuickGraph support smarts to be able to work in memory and the "save" to database all changes at an appropriate point in time (e.g. like ADO.net does with DataTable etc) Thanks in advance

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • jquery - lose click() event after ajax call???

    - by niczoom
    At the following webpage liamharding.com/pgi.php I have an option panel on the left side of the page which opens and closes upon clicking the panels 'arrow', this works fine until you select a market (for testing use one of the 'Random Walk' markets and click 'Show/Refesh Graphs'), this then makes an ajax call using get_graph(forexName, myCount, divIsNew) function. Once this call is completed a graph(s) is displayed and then my options panels click() event does not work? The ajax call returns the data in a variable ajax_data, the problem happens when I perform the following code var jq_ajax_data = $("<div/>").html(ajax_data); . I need to wrap it in a so I can extract data from it using jQuery. If this line of code is commented out the click() event works fine ?? Hope somebody can help, I have spent a lot of time but cant find what the problem is.

    Read the article

  • Cucumber : Size of features

    - by David Lyod
    Im new to testing with cucumber and have a question regarding the size of a 'Feature'. Assume you can add a collection of items to a list and do the usual CRUD , is it preferred to create one feature for this complete set of CRUD actions or a feature for each? What is the preferred/accepted method ? At what point does an action become a feature itself ?

    Read the article

< Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201  | Next Page >