Search Results

Search found 11597 results on 464 pages for 'complete graph'.

Page 194/464 | < Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201  | Next Page >

  • PHP Doxygen Collaboration Diagrams

    - by Shabbyrobe
    I've started playing around with doxygen to generate documentation from my PHP code. I notice there are two diagrams in the generated output - inheritance and collaboration. I know about the inheritance one, but the collaboration one has piqued my interest since reading the manual: If the COLLABORATION_GRAPH and HAVE_DOT tags are set to YES then doxygen will generate a graph for each documented class showing the direct and indirect implementation dependencies (inheritance, containment, and class references variables) of the class with other documented classes. The impression I get from that description is that composition relationships should be represented by the collaboration diagram as well, but it always seems to just be identical to the inheritance one. Is there something I can do to hint to Doxygen the things I would like to appear in this diagram? Does it just not work with PHP?

    Read the article

  • Sequencing 2 lines of JQUERY

    - by nobosh
    I have the following lines of JQUERY: // When dragging ends stop: function(event, ui) { // Replace the placeholder with the original $placeholder.after( $this.show() ).remove(); // Run a custom stop function specitifed in the settings settings.stop.apply(this); }, I don't want settings.stop.apply(this); to run UNTIL the line above is $placeholder.after( $this.show() ).remove();, right now what's happening is the settings.stop is running to early. With JQUERY, how can I Sequence these two lines to not proceed until the first is complete? Thanks

    Read the article

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • c++ to vb.net , problem with callback function

    - by johan
    I'm having a hard time here trying to find a solution for my problem. I'm trying to convert a client API funktion from C++ to VB.NET, and i think have some problems with the callback function. parts of the C++ code: typedef struct{ BYTE m_bRemoteChannel; BYTE m_bSendMode; BYTE m_nImgFormat; // =0 cif ; = 1 qcif char *m_sIPAddress; char *m_sUserName; char *m_sUserPassword; BOOL m_bUserCheck; HWND m_hShowVideo; }CLIENT_VIDEOINFO, *PCLIENT_VIDEOINFO; CPLAYER_API LONG __stdcall MP4_ClientStart(PCLIENT_VIDEOINFO pClientinfo,void(CALLBACK *ReadDataCallBack)(DWORD nPort,UCHAR *pPacketBuffer,DWORD nPacketSize)); void CALLBACK ReadDataCallBack(DWORD nPort,UCHAR *pPacketBuffer,DWORD nPacketSize) { TRACE("%d\n",nPacketSize); } ..... aa5.m_sUserName = "123"; aa5.m_sUserPassword="w"; aa5.m_bUserCheck = TRUE; MP4_ClientSetTTL(64); nn1 = MP4_ClientStart(&aa5,ReadDataCallBack); if (nn1 == -1) { MessageBox("error"); return; } SDK description: MP4_ClientStart This function starts a connection. The format of the call is: LONG __stdcall MP4_ClientStart(PCLIENT_VIDEOINFO pClientinfo, void(*ReadDataCallBack)(DWORD nChannel,UCHAR *pPacketBuffer,DWORD nPacketSize)) Parameters pClientinfo holds the information. of this connection. nChannel holds the channel of card. pPacketBuffer holds the pointer to the receive buffer. nPacketSize holds the length of the receive buffer. Return Values If the function succeeds the return value is the context of this connection. If the function fails the return value is -1. Remarks typedef struct{ BYTE m_bRemoteChannel; BYTE m_bSendMode; BYTE m_bImgFormat; char *m_sIPAddress; char *m_sUserName; char *m_sUserPassword; BOOL m_bUserCheck; HWND m_hShowVideo; } CLIENT_VIDEOINFO, * PCLIENT_VIDEOINFO; m_bRemoteChannel holds the channel which the client wants to connect to. m_bSendMode holds the network mode of the connection. m_bImgFormat : Image format, 0 is main channel video, 1 is sub channel video m_sIPAddress holds the IP address of the server. m_sUserName holds the user’s name. m_sUserPassword holds the user’s password. m_bUserCheck holds the value whether sends the user’s name and password or not. m_hShowVideo holds Handle for this video window. If m_hShowVideo holds NULL, the client can be record only without decoder. If m_bUserCheck is FALSE, we will send m_sUserName and m_sUserPassword as NULL, else we will send each 50 bytes. The length of m_sIPAddress and m_sUserName must be more than 50 bytes. ReadDataCallBack: When the library receives a packet from a server, this callback is called. My VB.Net code: Imports System.Runtime.InteropServices Public Class Form1 Const WM_USER = &H400 Public Structure CLIENT_VIDEOINFO Public m_bRemoteChannel As Byte Public m_bSendMode As Byte Public m_bImgFormat As Byte Public m_sIPAddress As String Public m_sUserName As String Public m_sUserPassword As String Public m_bUserCheck As Boolean Public m_hShowVideo As Long 'hWnd End Structure Public Declare Function MP4_ClientSetNetPort Lib "hikclient.dll" (ByVal dServerPort As Integer, ByVal dClientPort As Integer) As Boolean Public Declare Function MP4_ClientStartup Lib "hikclient.dll" (ByVal nMessage As UInteger, ByVal hWnd As System.IntPtr) As Boolean <DllImport("hikclient.dll")> Public Shared Function MP4_ClientStart(ByVal Clientinfo As CLIENT_VIDEOINFO, ByRef ReadDataCallBack As CALLBACKdel) As Long End Function Public Delegate Sub CALLBACKdel(ByVal nPort As Long, <MarshalAs(UnmanagedType.LPArray)> ByRef pPacketBuffer As Byte(), ByVal nPacketSize As Long) Public Sub CALLBACK(ByVal nPort As Long, <MarshalAs(UnmanagedType.LPArray)> ByRef pPacketBuffer As Byte(), ByVal nPacketSize As Long) End Sub Public mydel As New CALLBACKdel(AddressOf CALLBACK) Private Sub Form1_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load Dim Clientinfo As New CLIENT_VIDEOINFO() Clientinfo.m_bRemoteChannel = 0 Clientinfo.m_bSendMode = 0 Clientinfo.m_bImgFormat = 0 Clientinfo.m_sIPAddress = "193.168.1.100" Clientinfo.m_sUserName = "1" Clientinfo.m_sUserPassword = "a" Clientinfo.m_bUserCheck = False Clientinfo.m_hShowVideo = Me.Handle 'Nothing MP4_ClientSetNetPort(850, 850) MP4_ClientStartup(WM_USER + 1, Me.Handle) MP4_ClientStart(Clientinfo, mydel) End Sub End Class here is some other examples of the code in: C# http://blog.csdn.net/nenith1981/archive/2007/09/17/1787692.aspx VB ://read.pudn.com/downloads70/sourcecode/graph/250633/MD%E5%AE%A2%E6%88%B7%E7%AB%AF%28VB%29/hikclient.bas__.htm ://read.pudn.com/downloads70/sourcecode/graph/250633/MD%E5%AE%A2%E6%88%B7%E7%AB%AF%28VB%29/Form1.frm__.htm Delphi ://read.pudn.com/downloads91/sourcecode/multimedia/streaming/349759/Delphi_client/Unit1.pas__.htm

    Read the article

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • Programming Language Choices for High Integrity Systems

    - by Finbarr
    What programming languages are a good choice for High Integrity Systems? An example of a bad choice is Java as there is a considerable amount of code that is inaccessible to the programmer. I am looking for examples of strongly typed, block structured languages where the programmer is responsible for 100% of the code, and there is as little interference from things like a JVM as possible. Compilers will obviously be an issue. Language must have a complete and unambiguous definition.

    Read the article

  • Facebook Api - Local development, Testserver, Liveserver ... How?

    - by Thijs Kaspers
    I'm working on a new website that uses the Facebook API for users to login and several implementations of the graph Api. My workflow usually is: Development on localhost Development using MAMP/XAMPP or similar software Push to server - testing domain A team of people can test the changes for a few days to see if everything works as planned. Push to server - live domain Changes are live for public Facebook uses the site URL in the appsettings and for security reasons, they will only redirect to that url... Problem is.. I have localhost and 2 different domains. How can I make this work? Ofcourse I could edit the hostsfile, but that only fixes it for localhost.. Still no solution for the testdomain. Please tell me this is somehow possible! I'm getting more and more depressed with the Facebook API.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • can QuickGraph support these requirements? (includes database persistence support)

    - by Greg
    Hi, Would QuickGraph be able to help me out with my requirements below? (a) want to model a graph of nodes and directional relationships between nodes - for example to model web pages/files linked under a URL, or modeling IT infrastructure and dependencies between hardware/software. The library would include methods such as * Node.GetDirectParents() //i.e. there could be more than one direct parent for a node * Node.GetRootParents() //i.e. traverse the tree to the top root parent(s) for the given node * Node.GetDirectChildren() * Node.GetAllChildren() (b) have to persist the data to a database - so it should support SQL Server and ideally SQLite as well. If it does support these requirement then I'd love to hear: any pointers to any parts of QuickGraph to dig into? what is the best concept re it's usage in terms of how to use database persistence - is it a simpler design to assume every search/method works directly on the database, or does QuickGraph support smarts to be able to work in memory and the "save" to database all changes at an appropriate point in time (e.g. like ADO.net does with DataTable etc) Thanks in advance

    Read the article

  • How to remove control chars from UTF8 string

    - by Mimefilt
    Hi there, i have a VB.NET program that handles the content of documents. The programm handles high volumes of documents as "batch"(2Million documents;total 1TB volume) Some of this documents may contain control chars or chars like f0e8(http://www.fileformat.info/info/unicode/char/f0e8/browsertest.htm). Is there a easy and especially fast way to remove that chars?(except space,newline,tab,...) If the answer is regex: Has anyone a complete regex for me? Thanks!

    Read the article

  • Problem with displaying graphs on a Qt canvas

    - by Michal Nowotka
    Let's say I'm a Qt newbie. I want a good Qt library for displaying simple graphs. I've found the quanava library. But there is a problem. When I compiled a basic example it looks like graph edges are not painted properly when moving nodes. I don't have any idea where is a bug but this code seems to be rather simple. I think this is a problem with paint method in NodeItem class. Maybe someone has already solved this problem because this library is quite popular.

    Read the article

  • Are we using IoC effectively?

    - by Juliet
    So my company uses Castle Windsor IoC container, but in a way that feels "off": All the data types are registered in code, not the config file. All data types are hard-coded to use one interface implementation. In fact, for nearly all given interfaces, there is and will only ever be one implementation. All registered data types have a default constructor, so Windsor doesn't instantiate an object graph for any registered types. The people who designed the system insist the IoC container makes the system better. We have 1200+ public classes, so its a big system, the kind where you'd expect to find a framework like Windsor. But I'm still skeptical. Is my company using IoC effectively? Is there an advantage to new'ing objects with Windsor than new'ing objects with the new keyword?

    Read the article

  • uiimage oncomplete iphone

    - by dubbeat
    Is there such a thing as an "on load complete" for images in iphone? I want to be able to destroy a UIActivity indicator once and image is loaded. What the general best practice for doing this?

    Read the article

  • jquery - lose click() event after ajax call???

    - by niczoom
    At the following webpage liamharding.com/pgi.php I have an option panel on the left side of the page which opens and closes upon clicking the panels 'arrow', this works fine until you select a market (for testing use one of the 'Random Walk' markets and click 'Show/Refesh Graphs'), this then makes an ajax call using get_graph(forexName, myCount, divIsNew) function. Once this call is completed a graph(s) is displayed and then my options panels click() event does not work? The ajax call returns the data in a variable ajax_data, the problem happens when I perform the following code var jq_ajax_data = $("<div/>").html(ajax_data); . I need to wrap it in a so I can extract data from it using jQuery. If this line of code is commented out the click() event works fine ?? Hope somebody can help, I have spent a lot of time but cant find what the problem is.

    Read the article

  • Should I create subclass NSManagedObject or not?

    - by TP
    Hi, I have spent a few days learning and writing NSCoding and finally got it working. However, it took very long to archive and unarchive the (quite complex) object graph, which is unacceptable. After searching the internet for some time, I think the better way is to use core data. Do you recommend that 1) I should rewrite all my classes as subclasses of NSManagedObject or 2) should I create an instance variable of NSManagedObject in each of my class so that any changes to the class also updates its core data representation? Doing either way will need significant changes to the exiting classes and I think I have to update lots of unit test cases as well if it changes the way the classes are initialized. What do you recommend? I really don't want to head to the wrong approach again... Thanks!

    Read the article

  • How can i resolve the N+1 Selects problem ?

    - by Maxime ARNSTAMM
    Hello everyone, I have trouble understanding how to avoid the n+1 select in jpa or hibernate. From what i read, there's the 'left join fetch', but i'm not sure if it still works with more than one list (oneToMany).. Could someone explain it to me, or give me a link with a clear complete explanation please ? I'm sorry if this is a noob question, but i can't find a real clear article or doc on this issue. Thanks

    Read the article

< Previous Page | 190 191 192 193 194 195 196 197 198 199 200 201  | Next Page >