Search Results

Search found 11597 results on 464 pages for 'complete graph'.

Page 195/464 | < Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >

  • Read / write program in java using JChooser

    - by Casper Marcussen
    Hello everyone Didn't want to bother people in here, but since i am under a time pressure, i am desperate to get help. My questions is how to link the file choosen from a JChooser to a file, and how to converte it to stringm being able to display and edit it in a TextArea. i hav ethe GUI set up using swing, but the link between actionListener and the Jchooser is not complete Any help would be much appreciated code: http://pastebin.com/p3fb17Wi

    Read the article

  • Facebook Api - Local development, Testserver, Liveserver ... How?

    - by Thijs Kaspers
    I'm working on a new website that uses the Facebook API for users to login and several implementations of the graph Api. My workflow usually is: Development on localhost Development using MAMP/XAMPP or similar software Push to server - testing domain A team of people can test the changes for a few days to see if everything works as planned. Push to server - live domain Changes are live for public Facebook uses the site URL in the appsettings and for security reasons, they will only redirect to that url... Problem is.. I have localhost and 2 different domains. How can I make this work? Ofcourse I could edit the hostsfile, but that only fixes it for localhost.. Still no solution for the testdomain. Please tell me this is somehow possible! I'm getting more and more depressed with the Facebook API.

    Read the article

  • Is there a .NET BCL class to help with hand-rolled property path binding?

    - by Wayne
    WPF and Silverlight have a data binding model whereby I can provide a Binding with a Path which comprises a dot-notation of property accessors down from a DataContext to a specific value inside a complex object graph (eg. MyDataContext.RootProperty.SubProperty.Thing.Value) I have a (non-UI) requirement to accept such a path expressed as a simple string, and to use reflection on an object which is (hopefully) of a type which exposes the right property getters and setters in order to read and/or write values to those properties. Before I go off and start writing the parser and reflection code, is there a handy Framework 3.5 BCL class to help with this?

    Read the article

  • Are we using IoC effectively?

    - by Juliet
    So my company uses Castle Windsor IoC container, but in a way that feels "off": All the data types are registered in code, not the config file. All data types are hard-coded to use one interface implementation. In fact, for nearly all given interfaces, there is and will only ever be one implementation. All registered data types have a default constructor, so Windsor doesn't instantiate an object graph for any registered types. The people who designed the system insist the IoC container makes the system better. We have 1200+ public classes, so its a big system, the kind where you'd expect to find a framework like Windsor. But I'm still skeptical. Is my company using IoC effectively? Is there an advantage to new'ing objects with Windsor than new'ing objects with the new keyword?

    Read the article

  • Brilliant features of C++

    - by John
    (Following Features to remove from C++ and Desired features for C++, I thought why not complete the trio...) What C++ features would you not change? What features are elegantly and brilliantly implemented and still look better than other popular languages?

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Calendar event correct PHP script

    - by Marin
    Hello everybody! I need somebody(If you have time:) ) to help me find a good Calendar event script that functions:)Please help me.Thank you in advance:) Ps:I am looking for a complete web application which will run on a WAMP environment and has a GUI based installer or minimal command line installation requirements

    Read the article

  • Where is shared_ptr?

    - by Jake
    I am so frustrated right now after several hours trying to find where shared_ptr is located. None of the examples I see show complete code to include the headers for shared_ptr (and working). Simply stating "std" "tr1" and "" is not helping at all! I have downloaded boosts and all but still it doesn't show up! Can someone help me by telling exactly where to find it? Thanks for letting me vent my frustrations!

    Read the article

  • Recursive function MultiThreading to perform one task at a time.

    - by Ajay
    Hi, I am writing a program to crawl the websites. The crawl function is a recursive one and may consume more time to complete, So I used Multi Threading to perform the crawl for multiple websites. What exactly I need is, after completion crawling one website it call next one (which should be in Queqe) instead multiple websites crawling at a time. I am using C# and ASP.NET.

    Read the article

  • exploratory SPARQL queries?

    - by significance
    whenever i start using sql i tend to throw a couple of exploratory statements at the database in order to understand what is avaliable, and what form the data takes. eg. show tables describe table select * from table could anyone help me understand the way to complete a similar exploration of an rdf datastore using a SPARQL endpoint? Thanks :)

    Read the article

  • How to pass arguments to Go program?

    - by oraz
    I can't see arguments for main() in package main. How to pass arguments from command line in Go? A complete program, possibly created by linking multiple packages, must have one package called main, with a function func main() { ... } defined. The function main.main() takes no arguments and returns no value.

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • Twitter API - oauth gem - not getting callback

    - by haries
    I redirect the user of my application to Twitter for oauth style authentication using my app's request_token. The user is able to enter username and password on Twitter's page BUT then, instead of calling back my application, Twitter displays a page You've successfully granted access to MyAppName! Simply return to MyAppName and enter the following PIN to complete the process. 123456 Why is this happening? I have set the callback url in my app's settings. Thanks

    Read the article

  • IIS 6.0 not sending Expired header though I have turned it on

    - by Umair
    My website is hosted on Windows server 2003, IIS 6.0. The website is developed on ASP.net, with Microsoft Framework 3.5 I have set the content expiry to 12 hours for the complete site using the following settings : IIS Manager-Site-Properties-HTTP Headers-Enable Content Expiration-Expire After-12 Hours(s) The Problem is that when i load the site, Expiry header is not being sent with the site. can any one please help me with this.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Recreating iPhone stock application with nested views

    - by john
    I am trying to create an app similar to the Yahoo Stocks app that comes on the iPhone, with the split-screen interface (table on the top, graph on the bottom). I'm struggling with the view hierarchy. What is the easiest way to implement a split-screen type of application. I basically want two views nested in a parent view. My problem is a little bit more complex because I want functionality like having a uipagecontrol (does this require another viewcontroller, or is simply implemented in the initial view controller)? To what degree do I need to use IB? I would prefer to do this all in Xcode. Thanks in advance!

    Read the article

  • UIPickerView didSelectRow delay

    - by Rob Bonner
    Hello all, I have a UIPickerView implemented in one of my pages that depends on the didSelectRow delegate method. An odd behavior I have noticed is when the user moves a wheel and leaves it between selections, then the wheel will move very slowly to the closest selection. The didSelectRow event will not fire until this is complete, sometimes 3 seconds later. Is there a way to speed this up, or detect when the wheel is being moved, so I can freeze my interface during this time?

    Read the article

  • Retrieving information with Python's urllib from a page that is done via __doPostBack()?

    - by Omar
    I'm trying to parse a page that has different sections that are loaded with a Javascript __doPostBack() function. An example of a link is: javascript:__doPostBack('ctl00$cphMain$ucOemSchPicker$dlSch$ctl03$btnSch','') As soon as this is clicked, the browser doesn't fetch a new URL but a section of webpage is updated to reflect new information. What would I pass into a urllib function to complete the operation?

    Read the article

  • match strings in python

    - by mesun
    Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition def constrainedMatchPair(firstMatch,secondMatch,length):

    Read the article

< Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >