Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 205/246 | < Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >

  • How to write a simple Lexer/Parser with antlr 2.7?

    - by Burkhard
    Hello, I have a complex grammar (in antlr 2.7) which I need to extend. Having never used antlr before, I wanted to write a very simple Lexer and Parser first. I found a very good explanation for antlr3 and tried to adapt it: header{ #include <iostream> using namespace std; } options { language="Cpp"; } class P2 extends Parser; /* This will be the entry point of our parser. */ eval : additionExp ; /* Addition and subtraction have the lowest precedence. */ additionExp : multiplyExp ( "+" multiplyExp | "-" multiplyExp )* ; /* Multiplication and addition have a higher precedence. */ multiplyExp : atomExp ( "*" atomExp | "/" atomExp )* ; /* An expression atom is the smallest part of an expression: a number. Or when we encounter parenthesis, we're making a recursive call back to the rule 'additionExp'. As you can see, an 'atomExp' has the highest precedence. */ atomExp : Number | "(" additionExp ")" ; /* A number: can be an integer value, or a decimal value */ number : ("0".."9")+ ("." ("0".."9")+)? ; /* We're going to ignore all white space characters */ protected ws : (" " | "\t" | "\r" | "\n") { newline(); } ; It does generate four files without errors: P2.cpp, P2.hpp, P2TokenTypes.hpp and P2TokenTypes.txt. But now what? How do I create a working programm with that? I tried to add these files to a VS2005-WinConsole-Project but it does not compile: p2.cpp(277) : fatal error C1010: unexpected end of file while looking for precompiled header. Did you forget to add '#include "stdafx.h"' to your source?

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • I expect to see in the browswer "http://path/some_page.html" but instead it identifies with "http:/

    - by indiehacker
    I am developing with app engine SDK. I have a feeling this is much too basic a question so apologies ahead of time... A simple submit button doesnt work instead of just showing an alert box as expected it continues on afterwards and redirects me to the latest http-request, and I think this is because I dont understand how to tell the browser to recognize the proper URLs. Why does my browser say I am at the most recent http-request http://localhost:8080/putProjectInDB rather than the somepage.html that was actually served to the browser that I am currently looking at? How can I get the browser to recognize and show in its url spot the normal expected http://somepage.html ? Just in case, here are details of the specific problem which you might be able to ignore for answering the question: This hasnt been mattered for me until I just wanted to put into my .html a simple button that changes some stuff of the page without needing the server. The below code after displaying the alert box redirects me to the last server request http://localhost:8080/putProjectInDB instead of just staying in the same html page. in header: function MyFormCommands() { alert('Some Text'); } in body: <form onSubmit="MyFormCommands()" ><input type=submit ></form >

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • Aligning messageformat on printing a JTable.

    - by DanielFH
    I'm using this for the moment to print out my table, and it works. But I'm not really happy with the layout of the messageformatting, I would like to have both pagenumber and date in the footer, and date format aligned to the left side of the table, and page to the right. How can I do that? Been reading some stuff about overriding the PrintTable method, but seems to get pretty complex from what I've read. Hope you can help me with this issue, thank you. :) import javax.print.attribute.HashPrintRequestAttributeSet; import javax.print.attribute.PrintRequestAttributeSet; import javax.print.attribute.standard.OrientationRequested; import javax.swing.JTable; import dk.beesys.rims.ui.WindowInventory; public class Print { private static Print INSTANCE; public static Print getInstance() { if (INSTANCE == null) { INSTANCE = new Print(); } return INSTANCE; } private Print(){ } public void printList(java.awt.event.ActionEvent ignore) { String strDate = MessageFormat.format("{0,date,short} {0,time,short}", new Date()); MessageFormat header = new MessageFormat("- {0} -"); MessageFormat footer = new MessageFormat("Printed: " + strDate); PrintRequestAttributeSet aset = new HashPrintRequestAttributeSet(); aset.add(OrientationRequested.LANDSCAPE); try { WindowInventory.getInstance().getTable().print(JTable.PrintMode.FIT_WIDTH, header, footer, true, aset, true); } catch (java.awt.print.PrinterException e) { System.err.format("Cannot print %s%n", e.getMessage()); } }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Symfony 1.4 - Don't save a blank password on a executeUpdate action.

    - by Twelve47
    I have a form to edit a UserProfile which is stored in mysql db. Which includes the following custom configuration: public function configure() { $this->widgetSchema['password']=new sfWidgetFormInputPassword(); $this->validatorSchema['password']->setOption('required', false); // you don't need to specify a new password if you are editing a user. } When the user tries to save the executeUpdate method is called to commit the changes. If the password is left blank, the password field is set to '', but I want it to retain the old password instead of overwriting it. What is the best (/most in the symfony ethos) way of doing this? My solution was to override the setter method on the model (which i had done anyway for password encryption), and ignore blank values. public function setPassword( $password ) { if ($password=='') return false; // if password is blank don't save it. return $this->_set('password', UserProfile ::encryptPassword( $password )); } It seems to work fine like this, but is there a better way? If you're wondering I cannot use sfDoctrineGuard for this project as I am dealing with a legacy database, and cannot change the schema.

    Read the article

  • JSR-299 (CDI) configuration at runtime

    - by nsn
    I need to configure different @Alternatives, @Decorators and @Injectors for different runtime environments (think testing, staging and production servers). Right now I use maven to create three wars, and the only difference between those wars are in the beans.xml files. Is there a better way to do this? I do have @Alternative @Stereotypes for the different environments, but even then I need to alter beans.xml, and they don't work for @Decorators (or do they?) Is it somehow possible to instruct CDI to ignore the values in beans.xml and use a custom configuration source? Because then I could for example read a system property or other environment variable. The application exclusively runs in containers that use Weld, so a weld-specific solution would be ok. I already tried to google this but can't seem to find good search terms, and I asked the Weld-Users-Forums, but to no avail. Someone over there suggested to write my own custom extension, but I can't find any API to actually change the container configuration at runtime. I think it would be possible to have some sort of @ApplicationScoped configuration bean and inject that into all @Decorators which could then decide themselves whether they should be active or not and then in order to configure @Alternatives write @Produces methods for every interface with multiple implementations and inject the config bean there too. But this seems to me like a lot of unnecessary work to essentially duplicate functionality already present in CDI?

    Read the article

  • How to store visited states in iterative deepening / depth limited search?

    - by colinfang
    Update: Search for the first solution. for a normal Depth First Search it is simple, just use a hashset bool DFS (currentState) = { if (myHashSet.Contains(currentState)) { return; } else { myHashSet.Add(currentState); } if (IsSolution(currentState) return true; else { for (var nextState in GetNextStates(currentState)) if (DFS(nextState)) return true; } return false; } However, when it becomes depth limited, i cannot simply do this bool DFS (currentState, maxDepth) = { if (maxDepth = 0) return false; if (myHashSet.Contains(currentState)) { return; } else { myHashSet.Add(currentState); } if (IsSolution(currentState) return true; else { for (var nextState in GetNextStates(currentState)) if (DFS(nextState, maxDepth - 1)) return true; } return false; } Because then it is not going to do a complete search (in a sense of always be able to find a solution if there is any) before maxdepth How should I fix it? Would it add more space complexity to the algorithm? Or it just doesn't require to memoize the state at all. Update: for example, a decision tree is the following: A - B - C - D - E - A | F - G (Goal) Starting from state A. and G is a goal state. Clearly there is a solution under depth 3. However, using my implementation under depth 4, if the direction of search happens to be A(0) -> B(1) -> C(2) -> D(3) -> E(4) -> F(5) exceeds depth, then it would do back track to A, however E is visited, it would ignore the check direction A - E - F - G

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • (Weak) ETags and Last-Modified

    - by Kai Moritz
    As far as I understand the specs, the ETag, which was introduced in RFC 2616 (HTTP/1.1) is a predecessor of the Last-Modified-Header, which is proposet to give the software-architect more controll over the cache-revalidating process. If both Cache-Validation-Headers (If-None-Match and If-Modified-Since) are present, according to RFC 2616, the client (i.e. the browser) should use the ETag when checking, if a resource has changed. According to section 14.26 of RFC 2616, the server MUST NOT respond with a 304 Not Modified, if the ETag presented in a If-None-Match-Header has changed, and the server has to ignore an additional If-Modified-Since-Header, if present. If the presented ETag matches, he MUST NOT perform the request, unless the Date in the Last-Modified-Header says so. (If the presented ETag matches, the server should respond with a 304 Not Modified in case of a GET- or HEAD-request...) This section leaves room for some speculations: A strong ETag is supposed to change ''everytime'', the resource changes. So, having to responde with something else as 304 Not Modified to a request with an unchanged ETag and an If-Modified-Since-Header, which dose not match is a bit of a contradiction, because the strong ETag says, that the resource was not modified. (Though, this is not that fatal, because the server can send the same unchanged resource again.) ... ... o.k. While I was writing this, the question was boiling down to this answer: The (small) contradiction stated above, was made because of Weak ETags. A resource marked with a Weak ETag may have changed, although the ETag has not. So, in case of a Weak ETag it would be wrong, to answer with 304 Not Modified, when the ETag has not changed, but the date presented in the If-Modified-Since does not match, right?

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Why does this javascript code have an infinite loop?

    - by asdas
    optionElements is a 2d array. Each element has an array of length 2. These are an integer number and an element. I have a select list called linkbox, and i want to add all of the elements to the select list. The order I want them to go in is important, and is determined by the number each element has. It should be smallest to highest. So think of it like this: optionElements is: [ [5, <option>], [3, <option], [4, <option], [1, <option], [2, <option]] and it would add them to link box in order of those numbers. BUT that is not what happens. It is an infinite loop after the first time. I added the x constraint just to stop it from freezing my browser but you can ignore it. var b; var smallest; var samllestIndex; var x = 0; while(optionElements.length > 0 && ++x < 100) { smallestIndex = 0; smallest = optionElements[0][0]; b = 0; while( ++b < optionElements.length) { if(optionElements[b][0] > smallest) { smallestIndex = b; smallest = optionElements[b][0]; } } linkbox.appendChild(optionElements[smallestIndex][1]); optionElements.unshift(optionElements[smallestIndex]); } can someone point out to me where my problem is?

    Read the article

  • need an empty XML while unmarshalling a JAXB annotated class

    - by sswdeveloper
    I have a JAXB annotated class Customer as follows @XmlRootElement(namespace = "http://www.abc.com/customer") public class Customer{ private String name; private Address address; @XmlTransient private HashSet set = new HashSet<String>(); public String getName(){ return name; } @XmlElement(name = "Name", namespace = "http://www.abc.com/customer" ) public void setName(String name){ this.name = name; set.add("name"); } public String getAddress(){ return address; } @XmlElement(name = "Address", namespace = "http://www.abc.com/customer") public void setAddress(Address address){ this.address = address; set.add("address"); } public HashSet getSet(){ return set; } } I need to return an empty XML representing this to the user, so that he may fill the necesary values in the XML and send a request So what I require is : <Customer> <Name></Name> <Address></Address> </Customer> If i simply create an empty object Customer cust = new Customer() ; marshaller.marshall(cust,sw); all I get is the toplevel element since the other fields of the class are unset. What can I do to get such an empty XML? I tried adding the nillable=true annotation to the elements however, this returns me an XML with the xsi:nil="true" which then causes my unmarshaller to ignore this. How do I achieve this?

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • jQuery validate plugin radio with optional text

    - by timborden
    I'm trying to figure out how to validate a form element with a mix of radio inputs and a text input: <label>Question?</label> <input type="radio" class="mandatory" name="questions[1][]" value="1" />answer 1<br/> <input type="radio" class="mandatory" name="questions[1][]" value="2" />answer 2<br/> <input class="ignore" type="radio" id="questions[1][]" />Other (please specify)<br/> <input class="optional mandatory" type="text" name="questions[1][]" value="" /> I've figured out how to get the form to behave as expected (select and unselect) with the following code: $("input.optional").focus(function () { var this_name = $(this).attr("name"); $("input:radio").filter(function() {return $(this).attr('name') == this_name; }).attr('checked', false); $("input").filter(function() {return $(this).attr('id') == this_name; }).attr('checked', true); }); $(':radio').click(function () { var this_name = $(this).attr("name"); $("input").filter(function() {return $(this).attr('id') == this_name; }).attr('checked', false); $("input.optional").filter(function() {return $(this).attr('name') == this_name; }).val(''); }); I was hoping I could use the class "mandatory" to validate the mix of radio and text inputs: $("form .manditory").each(function () { $(this).rules("add", {required: true}); }); But it's not working as expected. With the radio (id="questions[1][]") selected, and the text input containing content, the form element is still flagged as invalid. Suggestions...maybe a better approach? Thanks in advance. UPDATE Sorry, I should have clarified that I'm using the validate plugin: $("form").validate({ ... });

    Read the article

  • Regular Expressions .NET

    - by Fosa
    I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • Update list dom only if list displayed

    - by Nikolaj Borisik
    Sometimes we use one store for few views(list, carousel,dataviews) and when we refresh(load, filter) store data, dom of all view that use this store will be rebuild, but some views is not displayed in this time, and may be will not show with these data. How we can refresh list dom only if it displayed, not every time when it store refresh? Issue examle Ext.define("Test.view.Main", { extend: 'Ext.tab.Panel', config: { tabBarPosition: 'bottom', items: [ ] }, constructor : function(){ this.callParent(arguments); var store = Ext.create('Ext.data.Store',{ data :[ {title : 'One'}, {title : 'Two'}, {title : 'Three'} ] }), firstList = Ext.create('Ext.List',{ title : 'tab1', store : store, itemTpl : '{title}', onItemDisclosure : function(){ store.add({title : 'Four'}); } }), secondList = Ext.create('Ext.List',{ title : 'tab2' , store : store, itemTpl : '{title}' }), thirdList = Ext.create('Ext.List',{ title : 'tab3', store : store, itemTpl : '{title}' }); this.add([ firstList, secondList, thirdList ]) ; } }); When tap on item in the first list, in store will be added new item. And dom of all list will be change although second and third list not displayed I see one option. Create one main store and create separate stores for each views. And when view show fill it store from Main store. But it look not good. Any other ideas?

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Mobile detection - Meta tag and max-device-width vs. php user agent?

    - by nimmbl
    Which form of mobile detection should I use and why? <meta name="viewport" content="width=320,initial-scale=1,maximum-scale=1.0,user-scalable=no" /> <link media="only screen and (max-device-width: 480px) and (min-device-width: 320px)" href="css/mobile.css" type= "text/css" rel="stylesheet"> <link media="handheld, only screen and (max-device-width: 319px)" href="css/mobile_simple.css" type="text/css" rel="stylesheet" /> Or include('mobile_device_detect.php'); $mobile = mobile_device_detect(); And why on earth would this: <?php if(strpos($_SERVER['HTTP_USER_AGENT'], 'iPhone') !== false) { ?> <meta name="viewport" content="width=320,initial-scale=1,maximum-scale=1.0,user-scalable=no" /> <link media="screen" href="css/mobile.css" type= "text/css" rel="stylesheet"> <?php } else { ?> <link media="screen" href="css/mobile_simple.css" type= "text/css" rel="stylesheet"> <?php } ?> ignore this css? body { background: -webkit-gradient(linear, left top, left bottom, from(#555), to(#000)); }

    Read the article

  • Change Sequence to Choice

    - by Gordon
    In my Schema File I defined a Group with a Sequence of possible Elements. <group name="argumentGroup"> <sequence> <element name="foo" type="double" /> <element name="bar" type="string" /> <element name="baz" type="integer" /> </sequence> </group> I then reference this Group like this: <element name="arguments"> <complexType> <group ref="my:argumentGroup"/> </complexType> </element> Is it possible to reference the Group at some other point but restrict it so it's a Choice instead of a Sequence. The position where I want to reuse it would only allow one of the Elements within. <element name="argument" minOccurs="0" maxOccurs="1"> <complexType> <group name="my:argumentGroup"> <! -- Somehow change argumentGroup sequence to choice here --> </group> <complexType> </element>

    Read the article

  • Node.js/Express Partials problem: Can't be nested too deep?

    - by heorling
    I'm learning Node.js, Express, haml.js and liking it. I've run into a prety annoying problem though. I'm pretty new to this but have been getting nice results so far. I'm writing a jquery heavy web app that relies on a table containing divs. The divs slide around, switch back and fourth and are resized etc to my hearts content. What I'm looking for a way to switch (template?) the divs. Since I've been building in express and mimicking the chat example it would make sense to use partials. The rub is that I've been using inexplicit divs in haml, held within a td. The divs are cunstructed as follows: %tr %td .class1.class2.class3.classetc Which has worked fine cross browser. Parsing the classes works great for the js code to pass arguments around, fetch values etc. What I'd like to be able to do is something like: %tr %td .class1.class2.class3.classetc %ul#messages != this.partial('message.html.haml', { collection: messages }) Any combination I've tried with this has failed however. And I might have tried them all. If I could put a partial into that div I'd probably be set. And you can nest them as long as you use #ids instead of .classes. But if you use more than one class it breaks! I think that's the most accurate way of summing it up. How do you do this? I've checked out various templating solutions like mu.js and micro template like by John Resig. I earlier checked out this thread on templating engines. It's very possible I'm making some fundamental mistake here, I'm new to this. What's a good way to do this?

    Read the article

< Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >