Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 206/246 | < Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >

  • Android : start intent in setOnClickListener

    - by Derek
    I have a button, and this button is going to get the values from EditText, then using this value to start a new Intent protected void onCreate(Bundle savedInstanceState) { textDay = (EditText) findViewById(R.id.textDay); textMonth = (EditText) findViewById(R.id.textMonth); textYear = (EditText) findViewById(R.id.textYear); gen = (Button) findViewById(R.id.getGraph); gen.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { getthisIntent(); } public Intent getthisIntent(Context context) { day = textDay.getText(); month = textMonth.getText(); year = textYear.getText(); date = day + "/" + month + "/" + year; . .// Plot graph using AchartEngine, then return an Intent // . } } }); but i get the error "The method getthisIntent(Context) in the type new View.OnClickListener(){} is not applicable for the arguments ()" Can i get some help? or do i have another alternative solution, when i click the button, then the button pass the values to the new intent, and start it without having a new xxx.java file? Edit This is basically what I am doing now, i need to get the things inserted by user, and plot a graph, the only way i know how to plot graph using AchartEngine is create a new activity with define this public Intent getthisIntent(Context context) To be honest, i dont really know what the hell I am doing, please correct me...

    Read the article

  • Omit Properties from WebControl Serialization

    - by Laramie
    I have to serialize several objects inheriting from WebControl for database storage. These include several unecessary (to me) properties that I would prefer to omit from serialization. For example BackColor, BorderColor, etc. Here is an example of an XML serialization of one of my controls inheriting from WebControl. <Control xsi:type="SerializePanel"> <ID>grCont</ID> <Controls /> <BackColor /> <BorderColor /> <BorderWidth /> <CssClass>grActVid bwText</CssClass> <ForeColor /> <Height /> <Width /> ... </Control> I have been trying to create a common base class for my controls that inherits from WebControl and uses the "xxxSpecified" trick to selectively choose not to serialize certain properties. For example to ignore an empty BorderColor property, I'd expect [XmlIgnore] public bool BorderColorSpecified() { return !base.BorderColor.IsEmpty; } to work, but it's never called during serialization. I've also tried it in the class to be serialized as well as the base class. Since the classes themselves might change, I'd prefer not to have to create a custom serializer. Any ideas?

    Read the article

  • PC boot: dl register and drive number

    - by kikou
    I read somewhere in the internet that, before jumping to 0x7c00, the BIOS loads into %dl the "drive number" of the booted device. But what is this "drive number"? Each device attached to the computer is assigned a number by the BIOS? If so, how can I know which number is a given device assigned to? Reading GRUB's source code I found when %dl has bits 0x80 and 0x70 set, it overwrites the whole register with 0x80. Why is that? Here is the code: jmp 3f /* grub-setup may overwrite this jump */ testb $0x80, %dl jz 2f 3: /* Ignore %dl different from 0-0x0f and 0x80-0x8f. */ testb $0x70, %dl jz 1f 2: movb $0x80, %dl 1: By the way. Is there any detailed resource on the boot process of PC's in the web? Specially about what the BIOS does before giving the control to the bootloader and also the standard codes used to communicate with it (like that "drive numer"). I was hoping to write my own bootloader and everything I found is a bit too vague, not technical enough to the point of informing of the exact state of the computer when my bootloader starts to run.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • How to throw meaningful data in exceptions ?

    - by ZeroCool
    I would like to throw exceptions with meaningful explanation ! I thought of using variable arguments worked fine but lately I figured out it's impossible to extend the class in order to implement other exception types. So I figured out using an std::ostreamstring as a an internal buffer to deal with formatting ... but doesn't compile! I guess it has something to deal with copy constructors. Anyhow here is my piece of code: class Exception: public std::exception { public: Exception(const char *fmt, ...); Exception(const char *fname, const char *funcname, int line, const char *fmt, ...); //std::ostringstream &Get() { return os_ ; } ~Exception() throw(); virtual const char *what() const throw(); protected: char err_msg_[ERRBUFSIZ]; //std::ostringstream os_; }; The variable argumens constructor can't be inherited from! this is why I thought of std::ostringstream! Any advice on how to implement such approach ?

    Read the article

  • Indexing table with duplicates MySQL/MSSQL with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In MSSQL you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • Adding text read from a file to an array list in java

    - by user1824856
    I am having trouble putting text read from a file into an array list. My text looks like this: 438;MIA;JFK;10:55;1092;447 638;JFK;MIA;19:45;1092;447 689;ATL;DFW;12:50;732;448 etc... My code looks like this: package filesexample; import java.io.*; import java.io.FileNotFoundException; import java.util.Scanner; import java.util.ArrayList; /** * * @author */ public class FilesExample { /** * @param args the command line arguments */ public static void main(String[] args) throws IOException { File file = new File ("/Schedule.txt"); try { Scanner scanner= new Scanner(file);; while (scanner.hasNextLine()) { String line = scanner.nextLine(); Scanner lineScanner= new Scanner(line); lineScanner.useDelimiter(";"); while(lineScanner.hasNext()){ String part = lineScanner.next(); System.out.print(part + " "); } System.out.println(); } }catch (FileNotFoundException e){ e.printStackTrace(); } } } Some help on getting started would be much appreciated thank you!

    Read the article

  • need an empty XML while unmarshalling a JAXB annotated class

    - by sswdeveloper
    I have a JAXB annotated class Customer as follows @XmlRootElement(namespace = "http://www.abc.com/customer") public class Customer{ private String name; private Address address; @XmlTransient private HashSet set = new HashSet<String>(); public String getName(){ return name; } @XmlElement(name = "Name", namespace = "http://www.abc.com/customer" ) public void setName(String name){ this.name = name; set.add("name"); } public String getAddress(){ return address; } @XmlElement(name = "Address", namespace = "http://www.abc.com/customer") public void setAddress(Address address){ this.address = address; set.add("address"); } public HashSet getSet(){ return set; } } I need to return an empty XML representing this to the user, so that he may fill the necesary values in the XML and send a request So what I require is : <Customer> <Name></Name> <Address></Address> </Customer> If i simply create an empty object Customer cust = new Customer() ; marshaller.marshall(cust,sw); all I get is the toplevel element since the other fields of the class are unset. What can I do to get such an empty XML? I tried adding the nillable=true annotation to the elements however, this returns me an XML with the xsi:nil="true" which then causes my unmarshaller to ignore this. How do I achieve this?

    Read the article

  • Legacy application creates dialogs in non-ui thread.

    - by Frater
    I've been working support for a while on a legacy application and I've noticed a bit of a problem. The system is an incredibly complex client/server with standard and custom frameworks. One of the custom frameworks built into the application involves validating workflow actions. It finds potential errors, separates them into warnings and errors, and passes the results back to the client. The main difference between warnings and errors is that warnings ask the user if they wish to ignore the error. The issue I have is that the dialog for this prompt is created on a non-ui thread, and thus we get cross-threading issues when the dialog is shown. I have attempted to invoke the showing of the dialog, however this fails because the window handle has not been created. (InvokeRequired returns false, which I assume in this case means it cannot find a decent handle in its parent tree, rather than that it doesn't require it.) Does anyone have any suggestions for how I can create this dialog and get the UI thread to set it up and call it?

    Read the article

  • Troubleshooting multiple GET variables In PHP

    - by V413HAV
    This may be a very simple question but I don't what's the wrong thing am doing here... To explain you clearly, I've set a real simple example below: <ul> <li><a href="test.php?link1=true">Link 1</a></li> <li><a href="test.php?link2=true">Link 2</a></li> <li><a href="test.php?link3=true">Link 3</a></li> </ul> <?php if(isset($_GET['link1'])) { if(($_GET['link1']) == 'true') { echo 'This Is Link 1'; } } if(isset($_GET['link2'])) { if(($_GET['link2']) == 'true') { echo 'This Is Link 2'; } } if(isset($_GET['link3'])) { if(($_GET['link3']) == 'true') { echo 'This Is Link 3'; } } ?> This is a test.php page, here I've set 3 different arguments for $_GET, and show contents accordingly, now everything works perfect, the only thing am not understanding is how to block this kind of url say if user clicks on link 1 the url will be : http://localhost/test.php?link1=true And the Output of this url is This is Link 1 Now if I change this url to : http://localhost/test.php?link3=true&link2=true&link1=true And the Output what I get is This Is Link 1This Is Link 2This Is Link 3 Now this is ok here, but it's very annoying if someone types this and see's forms one below the other, any way I can stop this tampering?

    Read the article

  • How to detect the root recursive call?

    - by ahmadabdolkader
    Say we're writing a simple recursive function fib(n) that calculates the nth Fibonacci number. Now, we want the function to print that nth number. As the same function is being called repeatedly, there has to be a condition that allows only the root call to print. The question is: how to write this condition without passing any additional arguments, or using global/static variables. So, we're dealing with something like this: int fib(int n) { if(n <= 0) return 0; int fn = 1; if(n > 2) fn = fib(n-2) + fib(n-1); if(???) cout << fn << endl; return fn; } int main() { fib(5); return 0; } I thought that the root call differs from all children by returning to a different caller, namely the main method in this example. I wanted to know whether it is possible to use this property to write the condition and how. Update: please note that this is a contrived example that only serves to present the idea. This should be clear from the tags. I'm not looking for standard solutions. Thanks.

    Read the article

  • Mobile detection - Meta tag and max-device-width vs. php user agent?

    - by nimmbl
    Which form of mobile detection should I use and why? <meta name="viewport" content="width=320,initial-scale=1,maximum-scale=1.0,user-scalable=no" /> <link media="only screen and (max-device-width: 480px) and (min-device-width: 320px)" href="css/mobile.css" type= "text/css" rel="stylesheet"> <link media="handheld, only screen and (max-device-width: 319px)" href="css/mobile_simple.css" type="text/css" rel="stylesheet" /> Or include('mobile_device_detect.php'); $mobile = mobile_device_detect(); And why on earth would this: <?php if(strpos($_SERVER['HTTP_USER_AGENT'], 'iPhone') !== false) { ?> <meta name="viewport" content="width=320,initial-scale=1,maximum-scale=1.0,user-scalable=no" /> <link media="screen" href="css/mobile.css" type= "text/css" rel="stylesheet"> <?php } else { ?> <link media="screen" href="css/mobile_simple.css" type= "text/css" rel="stylesheet"> <?php } ?> ignore this css? body { background: -webkit-gradient(linear, left top, left bottom, from(#555), to(#000)); }

    Read the article

  • Change Sequence to Choice

    - by Gordon
    In my Schema File I defined a Group with a Sequence of possible Elements. <group name="argumentGroup"> <sequence> <element name="foo" type="double" /> <element name="bar" type="string" /> <element name="baz" type="integer" /> </sequence> </group> I then reference this Group like this: <element name="arguments"> <complexType> <group ref="my:argumentGroup"/> </complexType> </element> Is it possible to reference the Group at some other point but restrict it so it's a Choice instead of a Sequence. The position where I want to reuse it would only allow one of the Elements within. <element name="argument" minOccurs="0" maxOccurs="1"> <complexType> <group name="my:argumentGroup"> <! -- Somehow change argumentGroup sequence to choice here --> </group> <complexType> </element>

    Read the article

  • Should constant contructor aguments be passed by reference or value?

    - by Mike
    When const values are passed to an object construct should they be passed by reference or value? If you pass by value and the arguments are immediately fed to initializes are two copies being made? Is this something that the compiler will automatically take care of. I have noticed that all textbook examples of constructors and intitializers pass by value but this seems inefficient to me. class Point { public: int x; int y; Point(const int _x, const int _y) : x(_x), y(_y) {} }; int main() { const int a = 1, b = 2; Point p(a,b); Point q(3,5); cout << p.x << "," << p.y << endl; cout << q.x << "," << q.y << endl; } vs. class Point { public: int x; int y; Point(const int& _x, const int& _y) : x(_x), y(_y) {} }; Both compile and do the same thing but which is correct?

    Read the article

  • Why C++ is (one of) the best language to learn at first [closed]

    - by AlexV
    C++ is one of the most used programming language in the world since like 25+ years. My first job as programmer was in C++ and I coded in C++ everyday for nearly 4 years. Now I do mostly PHP, but I will forever cherish this C++ background. C++ has helped me understand many "under the hood" features/behaviors/restrictions of many other (and different) programming languages like PHP and Delphi. I'm a full time programmer for 6+ years now and since I have a quite varied programming background I often get questions by "newbies" as where to start to become a "good" programmer. I think C++ is one of the best language to start with because it gives you a real usefull experience that will last and will teach you how things work under the hood. It's not the easier one to learn for a newbie, but in my opinion it's the one who will reward the most in long term. I would like to know your opinion on this matter to add to my arguments when I guide "newbies". After this introduction, here's my question : Why C++ is for you (one of) the best language to learn at first. Since it's subjective, I've marked this question as community wiki.

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • PHP Header redirection problem within page called by cURL

    - by Das123
    I have a site that uses cURL to access some pages, stores the returned results in variables, and then uses these variables within its own page. The script works well except where the target cURL page has a header('Location: ...') command inside it. It seems to just ignore this header command. The cURL command is as follows... //Load result page into variable so portions can be allocated to correct variables $ch = curl_init(); curl_setopt($ch, CURLOPT_URL, $url); # URL to post to curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1 ); # return into a variable curl_setopt($ch, CURLOPT_HEADER, 0); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $postfields); $loaded_result = curl_exec( $ch ); # run! curl_close($ch); I've tried changing the CURLOPT_HEADER to 1 but it doesn't do anything. So how can I allow script redirection within the target urls using cURL to grab the results? By the way, the pages work fine if accessed other than via cURL but iFrames are not an option in this instance.

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Java: refactoring static constants

    - by akf
    We are in the process of refactoring some code. There is a feature that we have developed in one project that we would like to now use in other projects. We are extracting the foundation of this feature and making it a full-fledged project which can then be imported by its current project and others. This effort has been relatively straight-forward but we have one headache. When the framework in question was originally developed, we chose to keep a variety of constant values defined as static fields in a single class. Over time this list of static members grew. The class is used in very many places in our code. In our current refactoring, we will be elevating some of the members of this class to our new framework, but leaving others in place. Our headache is in extracting the foundation members of this class to be used in our new project, and more specifically, how we should address those extracted members in our existing code. We know that we can have our existing Constants class subclass this new project's Constants class and it would inherit all of the parent's static members. This would allow us to effect the change without touching the code that uses these members to change the class name on the static reference. However, the tight coupling inherent in this choice doesn't feel right. before: public class ConstantsA { public static final String CONSTANT1 = "constant.1"; public static final String CONSTANT2 = "constant.2"; public static final String CONSTANT3 = "constant.3"; } after: public class ConstantsA extends ConstantsB { public static final String CONSTANT1 = "constant.1"; } public class ConstantsB { public static final String CONSTANT2 = "constant.2"; public static final String CONSTANT3 = "constant.3"; } In our existing code branch, all of the above would be accessible in this manner: ConstantsA.CONSTANT2 I would like to solicit arguments about whether this is 'acceptable' and/or what the best practices are.

    Read the article

  • Indexing table with duplicates MySQL/SQL Server with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In SQL Server you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • Compile time error: cannot convert from specific type to a generic type

    - by Water Cooler v2
    I get a compile time error with the following relevant code snippet at the line that calls NotifyObservers in the if construct. public class ExternalSystem<TEmployee, TEventArgs> : ISubject<TEventArgs> where TEmployee : Employee where TEventArgs : EmployeeEventArgs { protected List<IObserver<TEventArgs>> _observers = null; protected List<TEmployee> _employees = null; public virtual void AddNewEmployee(TEmployee employee) { if (_employees.Contains(employee) == false) { _employees.Add(employee); string message = FormatMessage("New {0} hired.", employee); if (employee is Executive) NotifyObservers(new ExecutiveEventArgs { e = employee, msg = message }); else if (employee is BuildingSecurity) NotifyObservers(new BuildingSecurityEventArgs { e = employee, msg = message }); } } public void NotifyObservers(TEventArgs args) { foreach (IObserver<TEventArgs> observer in _observers) observer.EmployeeEventHandler(this, args); } } The error I receive is: The best overloaded method match for 'ExternalSystem.NotifyObservers(TEventArgs)' has some invalid arguments. Cannot convert from 'ExecutiveEventArgs' to 'TEventArgs'. I am compiling this in C# 3.0 using Visual Studio 2008 Express Edition.

    Read the article

  • Passing an arbritrary JavaScript object in Xul

    - by Tom Brito
    I'm following this example to pass an object to a window, but when it as an argument it's with "undefined" value. This is my first window (obs. dump is the way to print to console when debug options are turned on): <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window id="windowID" width="400" height="300" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script> <![CDATA[ function onClickMe(event) { dump("begin\n"); try { var args = { param1: true, param2: 42 }; args.wrappedJSObject = args; var watcher = Components.classes["@mozilla.org/embedcomp/window-watcher;1"].getService(Components.interfaces.nsIWindowWatcher); watcher.openWindow(null, "chrome://XulWindowArgTest/content/about.xul", "windowName", "chrome", args); } catch (e) { dump("error: " + e + "\n"); } dump("end\n"); } ]]> </script> <button label="Click me !" oncommand="onClickMe();" /> </window> and my second window: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul" onload="onload()"> <script> <![CDATA[ function onload() { dump('arg = ' + window.arguments[0].wrappedJSObject + "\n"); } ]]> </script> <label value="test" /> </window> when the second window loads, it calls the onload and prints: arg = undefined Any idea how to fix it?

    Read the article

  • How to add additional condition to the JOIN generated by include?

    - by KandadaBoggu
    I want to add additional criteria to the LEFT OUTER JOIN generated by the :include option in ActiveRecord finder. class Post has_many :comments end class Comment belongs_to :post has_many :comment_votes end class CommentVote belongs_to :comment end Now lets say I want to find last 10 posts with their associated comments and the up comment votes. Post.find.all(:limit => 10, :order => "created_at DESC", :include => [{:comments => :comment_votes]) I cant add the condition to check for up votes as it will ignore the posts without the up votes. So the condition has to go the ON clause of the JOIN generated for the comment_votes. I am wishing for a syntax such as: Post.find.all(:limit => 10, :order => "created_at DESC", :include => [{:comments => [:comment_votes, :on => "comment_votes.vote > 0"]) Have you faced such problems before? Did you managed to solve the problem using the current finder? I hope to hear some interesting ideas from the community. PS: I can write a join SQL to get the expected result and stitch the results together. I want to make sure there is no other alternative before going down that path.

    Read the article

  • How do I stop Ant from hanging after executing a java program that attempted to interrupt a thread (and failed) and continued?

    - by Zugwalt
    I have Ant build and execute a java program. This program tries to do something that sometimes hangs, so we execute it in a thread. actionThread.start(); try { actionThread.join(10000); } catch (InterruptedException e) { System.out.println("InterruptedException: "+e.getMessage()); } if (actionThread.isAlive()) { actionThread.interrupt(); System.out.println("Thread timed out and never died"); } The ant call looks like this: <java fork="true" failonerror="yes" classname="myPackage.myPathName" classpath="build"> <arg line=""/> <classpath> <pathelement location="bin" /> <fileset dir="lib"> <include name="**/*.jar"/> </fileset> </classpath> </java> And when this runs I see the "Thread timed out and never died" statement, and I also see the main program finish execution, but then Ant just hangs. Presumably it is waiting for the child threads to finish, but they never will. How can I have Ant be done once it is done executing main() and just kill or ignore dead threads?

    Read the article

< Previous Page | 202 203 204 205 206 207 208 209 210 211 212 213  | Next Page >