Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 204/246 | < Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • cmd.exe Command Line Parsing of Environment Variables

    - by Artefacto
    I can't figure how to have cmd.exe not interpret something like %PATH% as an environment variable. Given this program: #include<stdio.h> #include<windows.h> int main(int argc, char *argv[]) { int i; printf("cmd line: %s\n", GetCommandLine()); for (i = 0; i < argc; i++) { printf("%d: %s\n", i, argv[i]); } return 0; } I have these different outputs according to the position of the arguments: >args "k\" o" "^%PATH^%" cmd line: args "k\" o" "%PATH%" 0: args 1: k" o 2: %PATH% >args "^%PATH^%" "k\" o" cmd line: args "^%PATH^%" "k\" o" 0: args 1: ^%PATH^% 2: k" o I guess it's because cmd.exe doesn't recognize the escaped \" and sees the escaped double quote as closing the first, leaving in the first case %PATH% unquoted. I say this, because if I don't quote the argument, it always works: >args ^%PATH^% "k\" o" cmd line: args %PATH% "k\" o" 0: args 1: %PATH% 2: k" o but then I can have no spaces...

    Read the article

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • How to implement a collection (list, map?) of complicated strings in Java?

    - by Alex Cheng
    Hi all. I'm new here. Problem -- I have something like the following entries, 1000 of them: args1=msg args2=flow args3=content args4=depth args6=within ==> args5=content args1=msg args2=flow args3=content args4=depth args6=within args7=distance ==> args5=content args1=msg args2=flow args3=content args6=within ==> args5=content args1=msg args2=flow args3=content args6=within args7=distance ==> args5=content args1=msg args2=flow args3=flow ==> args4=flowbits args1=msg args2=flow args3=flow args5=content ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args5=content args1=msg args2=flow args4=depth ==> args3=content args1=msg args2=flow args4=depth args5=content ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within args7=distance ==> args3=content I'm doing some sort of suggestion method. Say, args1=msg args2=flow args3=flow == args4=flowbits If the sentence contains msg, flow, and another flow, then I should return the suggestion of flowbits. How can I go around doing it? I know I should scan (whenever a character is pressed on the textarea) a list or array for a match and return the result, but, 1000 entries, how should I implement it? I'm thinking of HashMap, but can I do something like this? <"msg,flow,flow","flowbits" Also, in a sentence the arguments might not be in order, so assuming that it's flow,flow,msg then I can't match anything in the HashMap as the key is "msg,flow,flow". What should I do in this case? Please help. Thanks a million!

    Read the article

  • Is this a correct way to stop Execution Task

    - by Yan Cheng CHEOK
    I came across code to stop execution's task. private final ExecutorService executor = Executors.newSingleThreadExecutor(); public void stop() { executor.shutdownNow(); try { executor.awaitTermination(100, TimeUnit.DAYS); } catch (InterruptedException ex) { log.error(null, ex); } } public Runnable getRunnable() { return new Runnable() { public void run() { while (!Thread.currentThread().isInterrupted()) { // What if inside fun(), someone try to clear the interrupt flag? // Say, through Thread.interrupted(). We will stuck in this loop // forever. fun(); } } }; } I realize that, it is possible for Runnable to be in forever loop, as Unknown fun may Thread.sleep, clear the interrupt flag and ignore the InterruptedException Unknown fun may Thread.interrupted, clear the interrupt flag. I was wondering, is the following way correct way to fix the code? private final ExecutorService executor = Executors.newSingleThreadExecutor(); private volatile boolean flag = true; public void stop() { flag = false; executor.shutdownNow(); try { executor.awaitTermination(100, TimeUnit.DAYS); } catch (InterruptedException ex) { log.error(null, ex); } } public Runnable getRunnable() { return new Runnable() { public void run() { while (flag && !Thread.currentThread().isInterrupted()) { // What if inside fun(), someone try to clear the interrupt flag? // Say, through Thread.interrupted(). We will stuck in this loop // forever. fun(); } } }; }

    Read the article

  • Oracle User definied aggregate function for varray of varchar

    - by baju
    I am trying to write some aggregate function for the varray and I get this error code when I'm trying to use it with data from the DB: ORA-00600 internal error code, arguments: [kodpunp1], [], [], [], [], [], [], [], [], [], [], [] [koxsihread1], [0], [3989], [45778], [], [], [], [], [], [], [], [] Code of the function is really simple(in fact it does nothing ): create or replace TYPE "TEST_VECTOR" as varray(10) of varchar(20) ALTER TYPE "TEST_VECTOR" MODIFY LIMIT 4000 CASCADE create or replace type Test as object( lastVector TEST_VECTOR, STATIC FUNCTION ODCIAggregateInitialize(sctx in out Test) return number, MEMBER FUNCTION ODCIAggregateIterate(self in out Test, value in TEST_VECTOR) return number, MEMBER FUNCTION ODCIAggregateMerge(self IN OUT Test, ctx2 IN Test) return number, MEMBER FUNCTION ODCIAggregateTerminate(self IN Test, returnValue OUT TEST_VECTOR, flags IN number) return number ); create or replace type body Test is STATIC FUNCTION ODCIAggregateInitialize(sctx in out Test) return number is begin sctx := Test(TEST_VECTOR()); return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateIterate(self in out Test, value in TEST_VECTOR) return number is begin self.lastVector := value; return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateMerge(self IN OUT Test, ctx2 IN Test) return number is begin return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateTerminate(self IN Test, returnValue OUT TEST_VECTOR, flags IN number) return number is begin returnValue := self.lastVector; return ODCIConst.Success; end; end; create or replace FUNCTION test_fn (input TEST_VECTOR) RETURN TEST_VECTOR PARALLEL_ENABLE AGGREGATE USING Test; Next I create some test data: create table t1_test_table( t1_id number not null, t1_value TEST_VECTOR not null, Constraint PRIMARY_KEY_1 PRIMARY KEY (t1_id) ) Next step is to put some data to the table insert into t1_test_table (t1_id,t1_value) values (1,TEST_VECTOR('x','y','z')) Now everything is prepared to perform queries: Select test_fn(TEST_VECTOR('y','x')) from dual Query above work well Select test_fn(t1_value) from t1_test_table where t1_id = 1 Version of Oracle DBMS I use: 11.2.0.3.0 Does anyone tried do such a thing? What can be the reason that it does not work? How to solve it? Thanks in advance for help.

    Read the article

  • Symfony 1.4 - Don't save a blank password on a executeUpdate action.

    - by Twelve47
    I have a form to edit a UserProfile which is stored in mysql db. Which includes the following custom configuration: public function configure() { $this->widgetSchema['password']=new sfWidgetFormInputPassword(); $this->validatorSchema['password']->setOption('required', false); // you don't need to specify a new password if you are editing a user. } When the user tries to save the executeUpdate method is called to commit the changes. If the password is left blank, the password field is set to '', but I want it to retain the old password instead of overwriting it. What is the best (/most in the symfony ethos) way of doing this? My solution was to override the setter method on the model (which i had done anyway for password encryption), and ignore blank values. public function setPassword( $password ) { if ($password=='') return false; // if password is blank don't save it. return $this->_set('password', UserProfile ::encryptPassword( $password )); } It seems to work fine like this, but is there a better way? If you're wondering I cannot use sfDoctrineGuard for this project as I am dealing with a legacy database, and cannot change the schema.

    Read the article

  • Slightly different execution times between python2 and python3

    - by user557634
    Hi. Lastly I wrote a simple generator of permutations in python (implementation of "plain changes" algorithm described by Knuth in "The Art... 4"). I was curious about the differences in execution time of it between python2 and python3. Here is my function: def perms(s): s = tuple(s) N = len(s) if N <= 1: yield s[:] raise StopIteration() for x in perms(s[1:]): for i in range(0,N): yield x[:i] + (s[0],) + x[i:] I tested both using timeit module. My tests: $ echo "python2.6:" && ./testing.py && echo "python3:" && ./testing3.py python2.6: args time[ms] 1 0.003811 2 0.008268 3 0.015907 4 0.042646 5 0.166755 6 0.908796 7 6.117996 8 48.346996 9 433.928967 10 4379.904032 python3: args time[ms] 1 0.00246778964996 2 0.00656183719635 3 0.01419159912 4 0.0406293644678 5 0.165960511097 6 0.923101452814 7 6.24257639835 8 53.0099868774 9 454.540967941 10 4585.83498001 As you can see, for number of arguments less than 6, python 3 is faster, but then roles are reversed and python2.6 does better. As I am a novice in python programming, I wonder why is that so? Or maybe my script is more optimized for python2? Thank you in advance for kind answer :)

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Invoke Command When "ENTER" Key Is Pressed In XAML

    - by bitxwise
    I want to invoke a command when ENTER is pressed in a TextBox. Consider the following XAML: <UserControl ... xmlns:i="clr-namespace:System.Windows.Interactivity;assembly=System.Windows.Interactivity" ...> ... <TextBox> <i:Interaction.Triggers> <i:EventTrigger EventName="KeyUp"> <i:InvokeCommandAction Command="{Binding MyCommand}" CommandParameter="{Binding Text}" /> </i:EventTrigger> </i:Interaction.Triggers> </TextBox> ... </UserControl> and that MyCommand is as follows: public ICommand MyCommand { get { return new DelegateCommand<string>(MyCommandExecute); } } private void MyCommandExecute(string s) { ... } With the above, my command is invoked for every key press. How can I restrict the command to only invoke when the ENTER key is pressed? I understand that with Expression Blend I can use Conditions but those seem to be restricted to elements and can't consider event arguments. I have also come across SLEX which offers its own InvokeCommandAction implementation that is built on top of the Systems.Windows.Interactivity implementation and can do what I need. Another consideration is to write my own trigger, but I'm hoping there's a way to do it without using external toolkits.

    Read the article

  • How to write a simple Lexer/Parser with antlr 2.7?

    - by Burkhard
    Hello, I have a complex grammar (in antlr 2.7) which I need to extend. Having never used antlr before, I wanted to write a very simple Lexer and Parser first. I found a very good explanation for antlr3 and tried to adapt it: header{ #include <iostream> using namespace std; } options { language="Cpp"; } class P2 extends Parser; /* This will be the entry point of our parser. */ eval : additionExp ; /* Addition and subtraction have the lowest precedence. */ additionExp : multiplyExp ( "+" multiplyExp | "-" multiplyExp )* ; /* Multiplication and addition have a higher precedence. */ multiplyExp : atomExp ( "*" atomExp | "/" atomExp )* ; /* An expression atom is the smallest part of an expression: a number. Or when we encounter parenthesis, we're making a recursive call back to the rule 'additionExp'. As you can see, an 'atomExp' has the highest precedence. */ atomExp : Number | "(" additionExp ")" ; /* A number: can be an integer value, or a decimal value */ number : ("0".."9")+ ("." ("0".."9")+)? ; /* We're going to ignore all white space characters */ protected ws : (" " | "\t" | "\r" | "\n") { newline(); } ; It does generate four files without errors: P2.cpp, P2.hpp, P2TokenTypes.hpp and P2TokenTypes.txt. But now what? How do I create a working programm with that? I tried to add these files to a VS2005-WinConsole-Project but it does not compile: p2.cpp(277) : fatal error C1010: unexpected end of file while looking for precompiled header. Did you forget to add '#include "stdafx.h"' to your source?

    Read the article

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • Scala path dependent return type from parameter

    - by Rich Oliver
    In the following code using 2.10.0M3 in Eclipse plugin 2.1.0 for 2.10M3. I'm using the default setting which is targeting JVM 1.5 class GeomBase[T <: DTypes] { abstract class NewObjs { def newHex(gridR: GridBase, coodI: Cood): gridR.HexRT } class GridBase { selfGrid => type HexRT = HexG with T#HexTr def uniformRect (init: NewObjs) { val hexCood = Cood(2 ,2) val hex: HexRT = init.newHex(selfGrid, hexCood)// won't compile } } } Error message: Description Resource Path Location Type type mismatch; found: GeomBase.this.GridBase#HexG with T#HexTr required: GridBase.this.HexRT (which expands to) GridBase.this.HexG with T#HexTr GeomBase.scala Why does the compiler think the method returns the type projection GridBase#HexG when it should be this specific instance of GridBase? Edit transferred to a simpler code class in responce to comments now getting a different error message. package rStrat class TestClass { abstract class NewObjs { def newHex(gridR: GridBase): gridR.HexG } class GridBase { selfGrid => def uniformRect (init: NewObjs) { val hex: HexG = init.newHex(this) //error here } class HexG { val test12 = 5 } } } . Error line 11:Description Resource Path Location Type type mismatch; found : gridR.HexG required: GridBase.this.HexG possible cause: missing arguments for method or constructor TestClass.scala /SStrat/src/rStrat line 11 Scala Problem Update I've switched to 2.10.0M4 and updated the plug-in to the M4 version on a fresh version of Eclipse and switched to JVM 1.6 (and 1.7) but the problems are unchanged.

    Read the article

  • How to store visited states in iterative deepening / depth limited search?

    - by colinfang
    Update: Search for the first solution. for a normal Depth First Search it is simple, just use a hashset bool DFS (currentState) = { if (myHashSet.Contains(currentState)) { return; } else { myHashSet.Add(currentState); } if (IsSolution(currentState) return true; else { for (var nextState in GetNextStates(currentState)) if (DFS(nextState)) return true; } return false; } However, when it becomes depth limited, i cannot simply do this bool DFS (currentState, maxDepth) = { if (maxDepth = 0) return false; if (myHashSet.Contains(currentState)) { return; } else { myHashSet.Add(currentState); } if (IsSolution(currentState) return true; else { for (var nextState in GetNextStates(currentState)) if (DFS(nextState, maxDepth - 1)) return true; } return false; } Because then it is not going to do a complete search (in a sense of always be able to find a solution if there is any) before maxdepth How should I fix it? Would it add more space complexity to the algorithm? Or it just doesn't require to memoize the state at all. Update: for example, a decision tree is the following: A - B - C - D - E - A | F - G (Goal) Starting from state A. and G is a goal state. Clearly there is a solution under depth 3. However, using my implementation under depth 4, if the direction of search happens to be A(0) -> B(1) -> C(2) -> D(3) -> E(4) -> F(5) exceeds depth, then it would do back track to A, however E is visited, it would ignore the check direction A - E - F - G

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Aligning messageformat on printing a JTable.

    - by DanielFH
    I'm using this for the moment to print out my table, and it works. But I'm not really happy with the layout of the messageformatting, I would like to have both pagenumber and date in the footer, and date format aligned to the left side of the table, and page to the right. How can I do that? Been reading some stuff about overriding the PrintTable method, but seems to get pretty complex from what I've read. Hope you can help me with this issue, thank you. :) import javax.print.attribute.HashPrintRequestAttributeSet; import javax.print.attribute.PrintRequestAttributeSet; import javax.print.attribute.standard.OrientationRequested; import javax.swing.JTable; import dk.beesys.rims.ui.WindowInventory; public class Print { private static Print INSTANCE; public static Print getInstance() { if (INSTANCE == null) { INSTANCE = new Print(); } return INSTANCE; } private Print(){ } public void printList(java.awt.event.ActionEvent ignore) { String strDate = MessageFormat.format("{0,date,short} {0,time,short}", new Date()); MessageFormat header = new MessageFormat("- {0} -"); MessageFormat footer = new MessageFormat("Printed: " + strDate); PrintRequestAttributeSet aset = new HashPrintRequestAttributeSet(); aset.add(OrientationRequested.LANDSCAPE); try { WindowInventory.getInstance().getTable().print(JTable.PrintMode.FIT_WIDTH, header, footer, true, aset, true); } catch (java.awt.print.PrinterException e) { System.err.format("Cannot print %s%n", e.getMessage()); } }

    Read the article

  • Java Generic Type and Reflection

    - by Tom Tucker
    I have some tricky generic type problem involving reflection. Here's the code. public @interface MyConstraint { Class<? extends MyConstraintValidator<?>> validatedBy(); } public interface MyConstraintValidator<T extends Annotation> { void initialize(T annotation); } /** @param annotation is annotated with MyConstraint. */ public void run(Annotation annotation) { Class<? extends MyConstraintValidator<? extends Annotation>> validatorClass = annotation.annotationType().getAnnotation(MyConstraint.class).validatedBy(); validatorClass.newInstance().initialize(annotation) // will not compile! } The run() method above will not compile because of the following error. The method initialize(capture#10-of ? extends Annotation) in the type MyConstraintValidator<capture#10-of ? extends Annotation> is not applicable for the arguments (Annotation) If I remove the wild cards, then it compiles and works fine. What would be the propert way to declare the type parameter for the vairable validatorClass? Thanks.

    Read the article

  • MAC : How to check if the file is still being copied in cpp?

    - by Peda Pola
    In my current project, we had a requirement to check if the file is still copying. We have already developed a library which will give us OS notification like file_added , file_removed , file_modified, file_renamed on a particular folder along with the corresponding file path. The problem here is that, lets say if you add 1 GB file, it is giving multiple notification such as file_added , file_modified, file_modified as the file is being copied. Now i decided to surpass these notifications by checking if the file is copying or not. Based on that i will ignore events. I have written below code which tells if the file is being copied or not which takes file path as input parameter. Details:- In Mac, while file is being copied the creation date is set as some date less than 1970. Once it is copied the date is set to current date. Am using this technique. Based on this am deciding that file is being copied. Problem:- when we copy file in the terminal it is failing. Please advice me any approach. bool isBeingCopied(const boost::filesystem::path &filePath) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; bool isBeingCopied = false; if([[[[NSFileManager defaultManager] attributesOfItemAtPath:[NSString stringWithUTF8String:filePath.string().c_str()] error:nil] fileCreationDate] timeIntervalSince1970] < 0) { isBeingCopied = true; } [pool release]; return isBeingCopied; }

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Core jQuery event modification problem

    - by DSKVR
    I am attempting to overwrite a core jQuery event, in this case the keydown event. My intention is to preventDefault() functionality of Left(37), Up(38), Right(39) and Down(40) to maintain the consistency of hot keys in my web application. I am using the solution provided here for the conditional charCode preventDefault problem. For some reason, my function overwrite is simply not firing, and I cannot put my finger on the problem. I am afraid that over the past 30 minutes this issue has resulted in some hair loss. Anybody have the remedy? /* Modify Keydown Event to prevent default PageDown and PageUp functionality */ (function(){ var charCodes = new Array(37,38,39,40); var original = jQuery.fn.keydown; jQuery.fn.keydown = function(e){ var key=e.charCode ? e.charCode : e.keyCode ? e.keyCode : 0; alert('now why is my keydown mod not firing?'); if($.inArray(key,charCodes)) { alert('is one of them, do not scroll page'); e.preventDefault(); return false; } original.apply( this, arguments ); } })();

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • jQuery validate plugin radio with optional text

    - by timborden
    I'm trying to figure out how to validate a form element with a mix of radio inputs and a text input: <label>Question?</label> <input type="radio" class="mandatory" name="questions[1][]" value="1" />answer 1<br/> <input type="radio" class="mandatory" name="questions[1][]" value="2" />answer 2<br/> <input class="ignore" type="radio" id="questions[1][]" />Other (please specify)<br/> <input class="optional mandatory" type="text" name="questions[1][]" value="" /> I've figured out how to get the form to behave as expected (select and unselect) with the following code: $("input.optional").focus(function () { var this_name = $(this).attr("name"); $("input:radio").filter(function() {return $(this).attr('name') == this_name; }).attr('checked', false); $("input").filter(function() {return $(this).attr('id') == this_name; }).attr('checked', true); }); $(':radio').click(function () { var this_name = $(this).attr("name"); $("input").filter(function() {return $(this).attr('id') == this_name; }).attr('checked', false); $("input.optional").filter(function() {return $(this).attr('name') == this_name; }).val(''); }); I was hoping I could use the class "mandatory" to validate the mix of radio and text inputs: $("form .manditory").each(function () { $(this).rules("add", {required: true}); }); But it's not working as expected. With the radio (id="questions[1][]") selected, and the text input containing content, the form element is still flagged as invalid. Suggestions...maybe a better approach? Thanks in advance. UPDATE Sorry, I should have clarified that I'm using the validate plugin: $("form").validate({ ... });

    Read the article

  • Questions regarding detouring by modifying the virtual table

    - by Elliott Darfink
    I've been practicing detours using the same approach as Microsoft Detours (replace the first five bytes with a jmp and an address). More recently I've been reading about detouring by modifying the virtual table. I would appreciate if someone could shed some light on the subject by mentioning a few pros and cons with this method compared to the one previously mentioned! I'd also like to ask about patched vtables and objects on the stack. Consider the following situation: // Class definition struct Foo { virtual void Call(void) { std::cout << "FooCall\n"; } }; // If it's GCC, 'this' is passed as the first parameter void MyCall(Foo * object) { std::cout << "MyCall\n"; } // In some function Foo * foo = new Foo; // Allocated on the heap Foo foo2; // Created on the stack // Arguments: void ** vtable, uint offset, void * replacement PatchVTable(*reinterpret_cast<void***>(foo), 0, MyCall); // Call the methods foo->Call(); // Outputs: 'MyCall' foo2.Call(); // Outputs: 'FooCall' In this case foo->Call() would end up calling MyCall(Foo * object) whilst foo2.Call() call the original function (i.e Foo::Call(void) method). This is because the compiler will try to decide any virtual calls during compile time if possible (correct me if I'm wrong). Does that mean it does not matter if you patch the virtual table or not, as long as you use objects on the stack (not heap allocated)?

    Read the article

  • I getting undefined using JSON in jQuery why?

    - by YoniGeek
    Im learning some JSON, Im trying to list some data about dogs from twitter...but I can't really present the data...I believe that the error is inside map-method...something I'm missing...thanks for yr help <body> <h1>U almost there!!</h1> <script src="jquery-1.7.1.js"> </script> <script> // PubSub (function( $ ) { var o = $( {} ); $.each({ trigger: 'publish', on: 'subscribe', off: 'unsubscribe' }, function( key, val ) { jQuery[val] = function() { o[key].apply( o, arguments ); }; }); })( jQuery ); $.getJSON('http://search.twitter.com/search.json?q=dogs&callback=?', function( info) { $.publish( 'twitter/info', info ); }); // ... $.subscribe( 'twitter/info', function( e, info ) { $('body').html( $.map( info, function( obj) { // <--- here it's error, something Im missing right? return '<li>' + obj.text + '</li>'; }).join('') ); }); </script> </body> </html>

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

< Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >