Search Results

Search found 21828 results on 874 pages for 'program x'.

Page 232/874 | < Previous Page | 228 229 230 231 232 233 234 235 236 237 238 239  | Next Page >

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • interaction between javascript (desktop application) and C#

    - by Roman Dorevich
    Hello. I am writing for my desktop some application for handling some services. I wrote in C# an application that calculates something (lets call it cl.exe) I created a .bat file that starts the cl.exe. I want to call that .bat file from my javascript so I WShell.Run(**.bat). 2 question: The javascript program will not continue till the cl.exe will end ? (It is synchronized ?) The cl.exe returns a value. How can the javascript take it (It is a javascript program that call .bat file that wrapp the execution of the cl.exe) ? Thanks

    Read the article

  • delete pointer to 2d array c ++

    - by user1848054
    i have this pointer to 2d array of Robot class Robot ***rob; and this is here the code for the constructor !! and the program works fine !!! but now i am trying to build a destructor to delete this pointer !! and it keeps on crashing the program !! my question is , how to delete this pointer to 2d array of robots ? RobotsWorld::RobotsWorld(int x , int y) { X=x;Y=y; // returns the limitation of the matrix rob = new Robot**[x]; for(int i = 0; i < x; i++) { rob[i] = new Robot*[y]; for(int j = 0; j < y; j++) { rob[i][j] = NULL; } } }

    Read the article

  • C# SerialPort - Problems mixing ports with different baud rates.

    - by GrandAdmiral
    Greetings, I have two devices that I would like to connect over a serial interface, but they have incompatible connections. To get around this problem, I connected them both to my PC and I'm working on a C# program that will route traffic on COM port X to COM port Y and vice versa. The program connects to two COM ports. In the data received event handler, I read in incoming data and write it to the other COM port. To do this, I have the following code: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); } } } That code worked fine as long as the outgoing COM port operated at a higher baud rate than the incoming COM port. If the incoming COM port was faster than the outgoing COM port, I started missing data. I had to correct the code like this: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); while (outPort.BytesToWrite > 0); //<-- Change to fix problem } } } I don't understand why I need that fix. I'm new to C# (this is my first program), so I'm wondering if there is something I am missing. The SerialPort defaults to a 2048 byte write buffer and my commands are less than ten bytes. The write buffer should have the ability to buffer the data until it can be written to a slower COM port. In summary, I'm receiving data on COM X and writing the data to COM Y. COM X is connected at a faster baud rate than COM Y. Why doesn't the buffering in the write buffer handle this difference? Why does it seem that I need to wait for the write buffer to drain to avoid losing data? Thanks!

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • VS2010 - Add template to New Project window

    - by gbogumil
    I am trying to add a new project template for an often used pattern. Starting from the class library template I have done the following (it still does not show up in the new project window): opened the .vstemplate file changed name and description to 'hard coded' values (my template). The values in there pulled from the csharpui.dll resources. changed the TemplateID, DefaultName, and ProjectItems included. saved these to the ProjectemplatesCache folder and as a zip in the ProjectTemplates folder. restarted VS2010 and checked the new project location which should have shown my new template. specifically, the folders I saved to were.. C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplatesCache\CSharp\Windows\1033\HostComm.zip (the zip is the folder name, not a zip file) and C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplates\CSharp\Windows\1033 (this folder has a HostComm.zip file in it) Has anyone else done this? Can it be done? If it can then what did I miss?

    Read the article

  • BufferedReader.readLine() gives error java.net.SocketException: Software caused connection abort: re

    - by javatcp
    I am trying to code my program such that until the buffered reader gets something in readLine() from my tcp client it should keep running in the while loop checking but I get this error as soon as the program executes Mar 31, 2010 11:03:36 PM deswash.DESWashView$5 run SEVERE: null java.net.SocketException: Software caused connection abort: recv failed at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(SocketInputStream.java:129) at sun.nio.cs.StreamDecoder.readBytes(StreamDecoder.java:264) at sun.nio.cs.StreamDecoder.implRead(StreamDecoder.java:306) at sun.nio.cs.StreamDecoder.read(StreamDecoder.java:158) at java.io.InputStreamReader.read(InputStreamReader.java:167) at java.io.BufferedReader.fill(BufferedReader.java:136) at java.io.BufferedReader.readLine(BufferedReader.java:299) at java.io.BufferedReader.readLine(BufferedReader.java:362) at deswash.DESWashView$5.run(DESWashView.java:448) the second line in the following code throws the error while(running){ String temp = in.readLine(); if(!(temp.equals(null))){ int inid = Integer.parseInt(temp); stationList.add(inid); } }

    Read the article

  • Bacula windows client could not connect to Bacula director

    - by pr0f-r00t
    I have a Bacula server on my Linux Debian squeeze host (Bacula version 5.0.2) and a Bacula client on Windows XP SP3. On my network each client can see each other, can share files and can ping. On my local server I could run bconsole and the server responds but when I run bconsole or bat on my windows client the server does not respond. Here are my configuration files: bacula-dir.conf: # # Default Bacula Director Configuration file # # The only thing that MUST be changed is to add one or more # file or directory names in the Include directive of the # FileSet resource. # # For Bacula release 5.0.2 (28 April 2010) -- debian squeeze/sid # # You might also want to change the default email address # from root to your address. See the "mail" and "operator" # directives in the Messages resource. # Director { # define myself Name = nima-desktop-dir DIRport = 9101 # where we listen for UA connections QueryFile = "/etc/bacula/scripts/query.sql" WorkingDirectory = "/var/lib/bacula" PidDirectory = "/var/run/bacula" Maximum Concurrent Jobs = 1 Password = "Cv70F6pf1t6pBopT4vQOnigDrR0v3L" # Console password Messages = Daemon DirAddress = 127.0.0.1 # DirAddress = 72.16.208.1 } JobDefs { Name = "DefaultJob" Type = Backup Level = Incremental Client = nima-desktop-fd FileSet = "Full Set" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = File Priority = 10 Write Bootstrap = "/var/lib/bacula/%c.bsr" } # # Define the main nightly save backup job # By default, this job will back up to disk in /nonexistant/path/to/file/archive/dir Job { Name = "BackupClient1" JobDefs = "DefaultJob" } #Job { # Name = "BackupClient2" # Client = nima-desktop2-fd # JobDefs = "DefaultJob" #} # Backup the catalog database (after the nightly save) Job { Name = "BackupCatalog" JobDefs = "DefaultJob" Level = Full FileSet="Catalog" Schedule = "WeeklyCycleAfterBackup" # This creates an ASCII copy of the catalog # Arguments to make_catalog_backup.pl are: # make_catalog_backup.pl <catalog-name> RunBeforeJob = "/etc/bacula/scripts/make_catalog_backup.pl MyCatalog" # This deletes the copy of the catalog RunAfterJob = "/etc/bacula/scripts/delete_catalog_backup" Write Bootstrap = "/var/lib/bacula/%n.bsr" Priority = 11 # run after main backup } # # Standard Restore template, to be changed by Console program # Only one such job is needed for all Jobs/Clients/Storage ... # Job { Name = "RestoreFiles" Type = Restore Client=nima-desktop-fd FileSet="Full Set" Storage = File Pool = Default Messages = Standard Where = /nonexistant/path/to/file/archive/dir/bacula-restores } # job for vmware windows host Job { Name = "nimaxp-fd" Type = Backup Client = nimaxp-fd FileSet = "nimaxp-fs" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = Default Write Bootstrap = "/var/bacula/working/rsys-win-www-1-fd.bsr" #Change this } # job for vmware windows host Job { Name = "arg-michael-fd" Type = Backup Client = nimaxp-fd FileSet = "arg-michael-fs" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = Default Write Bootstrap = "/var/bacula/working/rsys-win-www-1-fd.bsr" #Change this } # List of files to be backed up FileSet { Name = "Full Set" Include { Options { signature = MD5 } # # Put your list of files here, preceded by 'File =', one per line # or include an external list with: # # File = <file-name # # Note: / backs up everything on the root partition. # if you have other partitions such as /usr or /home # you will probably want to add them too. # # By default this is defined to point to the Bacula binary # directory to give a reasonable FileSet to backup to # disk storage during initial testing. # File = /usr/sbin } # # If you backup the root directory, the following two excluded # files can be useful # Exclude { File = /var/lib/bacula File = /nonexistant/path/to/file/archive/dir File = /proc File = /tmp File = /.journal File = /.fsck } } # List of files to be backed up FileSet { Name = "nimaxp-fs" Enable VSS = yes Include { Options { signature = MD5 } File = "C:\softwares" File = C:/softwares File = "C:/softwares" } } # List of files to be backed up FileSet { Name = "arg-michael-fs" Enable VSS = yes Include { Options { signature = MD5 } File = "C:\softwares" File = C:/softwares File = "C:/softwares" } } # # When to do the backups, full backup on first sunday of the month, # differential (i.e. incremental since full) every other sunday, # and incremental backups other days Schedule { Name = "WeeklyCycle" Run = Full 1st sun at 23:05 Run = Differential 2nd-5th sun at 23:05 Run = Incremental mon-sat at 23:05 } # This schedule does the catalog. It starts after the WeeklyCycle Schedule { Name = "WeeklyCycleAfterBackup" Run = Full sun-sat at 23:10 } # This is the backup of the catalog FileSet { Name = "Catalog" Include { Options { signature = MD5 } File = "/var/lib/bacula/bacula.sql" } } # Client (File Services) to backup Client { Name = nima-desktop-fd Address = localhost FDPort = 9102 Catalog = MyCatalog Password = "_MOfxEuRzxijc0DIMcBqtyx9iW1tzE7V6" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # Client file service for vmware windows host Client { Name = nimaxp-fd Address = nimaxp FDPort = 9102 Catalog = MyCatalog Password = "Ku8F1YAhDz5EMUQjiC9CcSw95Aho9XbXailUmjOaAXJP" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # Client file service for vmware windows host Client { Name = arg-michael-fd Address = 192.168.0.61 FDPort = 9102 Catalog = MyCatalog Password = "b4E9FU6s/9Zm4BVFFnbXVKhlyd/zWxj0oWITKK6CALR/" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # # Second Client (File Services) to backup # You should change Name, Address, and Password before using # #Client { # Name = nima-desktop2-fd # Address = localhost2 # FDPort = 9102 # Catalog = MyCatalog # Password = "_MOfxEuRzxijc0DIMcBqtyx9iW1tzE7V62" # password for FileDaemon 2 # File Retention = 30 days # 30 days # Job Retention = 6 months # six months # AutoPrune = yes # Prune expired Jobs/Files #} # Definition of file storage device Storage { Name = File # Do not use "localhost" here Address = localhost # N.B. Use a fully qualified name here SDPort = 9103 Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" Device = FileStorage Media Type = File } # Definition of DDS tape storage device #Storage { # Name = DDS-4 # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # password for Storage daemon # Device = DDS-4 # must be same as Device in Storage daemon # Media Type = DDS-4 # must be same as MediaType in Storage daemon # Autochanger = yes # enable for autochanger device #} # Definition of 8mm tape storage device #Storage { # Name = "8mmDrive" # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # Device = "Exabyte 8mm" # MediaType = "8mm" #} # Definition of DVD storage device #Storage { # Name = "DVD" # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # Device = "DVD Writer" # MediaType = "DVD" #} # Generic catalog service Catalog { Name = MyCatalog # Uncomment the following line if you want the dbi driver # dbdriver = "dbi:sqlite3"; dbaddress = 127.0.0.1; dbport = dbname = "bacula"; dbuser = ""; dbpassword = "" } # Reasonable message delivery -- send most everything to email address # and to the console Messages { Name = Standard # # NOTE! If you send to two email or more email addresses, you will need # to replace the %r in the from field (-f part) with a single valid # email address in both the mailcommand and the operatorcommand. # What this does is, it sets the email address that emails would display # in the FROM field, which is by default the same email as they're being # sent to. However, if you send email to more than one address, then # you'll have to set the FROM address manually, to a single address. # for example, a '[email protected]', is better since that tends to # tell (most) people that its coming from an automated source. # mailcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula: %t %e of %c %l\" %r" operatorcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula: Intervention needed for %j\" %r" mail = root@localhost = all, !skipped operator = root@localhost = mount console = all, !skipped, !saved # # WARNING! the following will create a file that you must cycle from # time to time as it will grow indefinitely. However, it will # also keep all your messages if they scroll off the console. # append = "/var/lib/bacula/log" = all, !skipped catalog = all } # # Message delivery for daemon messages (no job). Messages { Name = Daemon mailcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula daemon message\" %r" mail = root@localhost = all, !skipped console = all, !skipped, !saved append = "/var/lib/bacula/log" = all, !skipped } # Default pool definition Pool { Name = Default Pool Type = Backup Recycle = yes # Bacula can automatically recycle Volumes AutoPrune = yes # Prune expired volumes Volume Retention = 365 days # one year } # File Pool definition Pool { Name = File Pool Type = Backup Recycle = yes # Bacula can automatically recycle Volumes AutoPrune = yes # Prune expired volumes Volume Retention = 365 days # one year Maximum Volume Bytes = 50G # Limit Volume size to something reasonable Maximum Volumes = 100 # Limit number of Volumes in Pool } # Scratch pool definition Pool { Name = Scratch Pool Type = Backup } # # Restricted console used by tray-monitor to get the status of the director # Console { Name = nima-desktop-mon Password = "-T0h6HCXWYNy0wWqOomysMvRGflQ_TA6c" CommandACL = status, .status } bacula-fd.conf on client: # # Default Bacula File Daemon Configuration file # # For Bacula release 5.0.3 (08/05/10) -- Windows MinGW32 # # There is not much to change here except perhaps the # File daemon Name # # # "Global" File daemon configuration specifications # FileDaemon { # this is me Name = nimaxp-fd FDport = 9102 # where we listen for the director WorkingDirectory = "C:\\Program Files\\Bacula\\working" Pid Directory = "C:\\Program Files\\Bacula\\working" # Plugin Directory = "C:\\Program Files\\Bacula\\plugins" Maximum Concurrent Jobs = 10 } # # List Directors who are permitted to contact this File daemon # Director { Name = Nima-desktop-dir Password = "Cv70F6pf1t6pBopT4vQOnigDrR0v3L" } # # Restricted Director, used by tray-monitor to get the # status of the file daemon # Director { Name = nimaxp-mon Password = "q5b5g+LkzDXorMViFwOn1/TUnjUyDlg+gRTBp236GrU3" Monitor = yes } # Send all messages except skipped files back to Director Messages { Name = Standard director = Nima-desktop = all, !skipped, !restored } I have checked my firewall and disabled the firewall but it doesn't work.

    Read the article

  • MIDL2003 Error in VC6 project

    - by graham.reeds
    While bug fixing I tracked a problem to an old vc6 compiled dll that hasn't been touched in nearly 3 years. After checking out the most recent source I am getting the following error when trying to compile. Processing C:\PROGRAM FILES\MICROSOFT SDK\INCLUDE\msxml.idl msxml.idl .\ocidl.idl(1524) : error MIDL2003 : redefinition : IErrorLog .\ocidl.idl(1541) : error MIDL2003 : redefinition : IPropertyBag Google gives lots of suggestions regarding Visual Studio 2002 - 2003 errors but I can't find anything that relates to Visual Studio 6 or can be applied to my problem. I did find this page but following it's advice didn't fix my problem. Does anyone have any suggestions on how to fix this? (I am presuming that it did work once.) Other items of interest: I have the February 2003 Platform SDK installed, and looking at the add/remove program page I have Micrsoft XML Parser and SDK, MSXML 4.0 SP2 and MSXML 6.0 Parser too.

    Read the article

  • RAR password recovery on GPU using ATI Stream processor

    - by Wajdy Essam
    Hello, I'm newbie in GPU programming , and i work on brute force RAR Password Recovery on ATI Stream Processor using brook+ language, but i see that the kernel written in brook+ language doesn't allow any calling to normal functions (except kernel functions) , my questions is : 1) how to use unrar.dll (to unrar archive files) API in this situation? and is this the only way to program RAR password recovery? 2) what about crack and ElcomSoft software that use GPU , how they work ? 3) what exactly the role for the function work inside GPU (ATI Stream processor or CUDA) in this program? 4) is nVidia/CUDA technology is easier/more flexible than ATI/brook+ language ?

    Read the article

< Previous Page | 228 229 230 231 232 233 234 235 236 237 238 239  | Next Page >