Search Results

Search found 8416 results on 337 pages for 'stop'.

Page 233/337 | < Previous Page | 229 230 231 232 233 234 235 236 237 238 239 240  | Next Page >

  • Embedded quicktime video pause on click how to prevent?

    - by Marek
    I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Where does Eclipse save the list of files to open on startup?

    - by Grundlefleck
    Question: where does Eclipse store the list of files it opens on startup? Background: Having installed a plugin into Eclipse which promptly crashed, my Eclipse workspace is in a bit of a state. When started, the building workspace task pauses indefinitely at 20%. Before I uninstall the plugin I want to give it another chance. I have a feeling that the reason Eclipse is pausing is because of a file which was opened when it crashed, which it tries to reopen on startup. If I can stop this file from opening on startup there's a chance I may be able to coax the plugin to behave. The problem is I have no idea where that list of files is persisted between runs of Eclipse. ...a second before I posted this question, I realised I could just delete the file causing the problem (duh). However, the search has frustrated me enough to want to find the answer.

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Sending some byte at time

    - by user1417815
    I'm trying to figure out way to send some amount of text from the string ech time until it reach the end of the string, example: const char* the_string = "hello world, i'm happy to meet you all. Let be friends or maybe more, but nothing less" Output: hello world Output: , i'm happy to meet you all. Output: Let be friends or maybe more Output: , but nothing less stop: no more bytes to send. the problem i have searched google, but didn't understand the examples, i spent 4 days trying find a good way, also that sendt 5 bytes at time, but in case there is less, then send them until you are at the end of the string. please help me out guys, i will accept a C or C++ way, as long it works and well explained.

    Read the article

  • DAQ Triggers in Matlab

    - by RidePlanet
    I'm writing a program that detects the speed of a object by hall effect sensors that are run into MATLAB through a DAQ (MCC USB-1408FS) The problem that has arisen is that I'm using a non-stop scan technique to detect the state of one of 3 sensors. Unfortunately this means that unless the object is rotating past each sensor at the exact rate the program runs, I will see an instantaneous speed (done by comparing the time between two sensors) of zero. I need the sensors to signal the program to count when they are hit, instead of constantly scanning for the signal. How can this be done?

    Read the article

  • Basic iphone timer example

    - by Rob
    Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

    Read the article

  • how to deal with async calls in Ajax 4.0(using jquery?)

    - by dexter
    in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

    Read the article

  • problem in playing next song in the avaudioplayer

    - by Rajashekar
    Hello friends my delegate method looks like this. after the first song is played it goes into this method and plays the second song , however when the second song is done playing it stops. it does not go into the delegate method.i need to play all the songs continuously. i am not sure, why. can someone help me. (void)audioPlayerDidFinishPlaying:(AVAudioPlayer *)p successfully:(BOOL)flag { if (flag == NO) NSLog(@"Playback finished unsuccessfully"); else { //[player stop]; index++; NSLog(@"%d",index); path=[[NSBundle mainBundle] pathForResource:[songlist objectAtIndex:index] ofType:@"mp3"]; [player initWithContentsOfURL:[NSURL fileURLWithPath:path] error:NULL]; [songlabel2 setTitle:[songlist objectAtIndex:index]]; [endtime setText:[NSString stringWithFormat:@"%.2f",[player duration]/100]]; [player play]; } }

    Read the article

  • WP7 How to use a Storyboard

    - by Subby
    I wish to stop using the DispatcherTimer to show animations as that is extremely unpredictable. Instead, I want to start using a Storyboard as that is apparently the best and efficient way to animate controls. I have tried searching for Tutorials but have not, unfortunately, stumbled on one yet. Can anyone please advice me where I can begin? For example, "moving an image across the screen" and then "moving many images at the same time whilst rotating them". Any help is highly appreciated.

    Read the article

  • SQL: Interrupting a query

    - by NoozNooz42
    I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

    Read the article

  • How to have a javascript callback executed after an update panel postback?

    - by TNunes
    I'm using a jQuery tip plugin to show help tips when the user hovers certain elements of the page. I need to register the plugin events after the page is loaded using css selectors. The problem is I'm using an ASP.NET Update Panel and after the first postback, the tips stop working because the update panel replaces the page content but doesn't rebind the javascript events. I need a way to execute a javascript callback after the Update Panel refreshes its content, so I can rebind the javascript events to have the tips working again. Is there any way to do this?

    Read the article

  • Reboot windows machines at a certain time of day and automatically login with Python

    - by Tom
    I know how to reboot machines remotely, so that's the easy part. However, the complexity of the issue is trying to setup the following. I'd like to control machines on a network for after-hours use such that when users logoff and go home, or shutdown their computers, whatever, python or some combination of python + windows could restart their machines (for cleanliness) and automatically login, running a process for the night, then in the morning, stop said process and restart the machine so the user could easily login like normal. I've looked around, haven't had too terribly much luck, though it looks like one could do it with a changing of the registry. That sounds like a rough idea though, modifying the registry on a per-day basis. Is there an easier way?

    Read the article

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • Visual Studio C++ adds "junk" to my programs

    - by sub
    I have looked into the binaries produced by MSVC 2010 from my source code, and saw everything being filled with "junk". I don't know how to explain, but my executables are being added too much unnecessary information, like: Lots of Microsoft default error messages, I don't want them XML schema settings (Why!?) Other things not important for the execution of the main program How can I stop MSVC doing this? Do I have to switch to GCC? In all other programs (written in C++ too, from Word processors to games), this junk simply doesn't exist.

    Read the article

  • [ASP.NET MVC] Problem with View - it does not refresh after db update

    - by crocodillez
    Hi, I am working with small ASP.NET MVC project - online store. I have addToCart method which adds selected product to cart - it updates cart table in my db and showing cart view with its content. But I have problems. while db is updating correctly the view does not. I see that quantity of the product in my db is incremented correctly but quantity in view is not changed. I have to stop debugging my app in visual studia and restart it - then my view is showing correct data. What can be wrong?

    Read the article

  • Changing the context of a self-executing function

    - by TaylorMac
    This code is copied directly from: http://www.bennadel.com/blog/2264-Changing-The-Execution-Context-Of-Your-Self-Executing-Function-Blocks-In-JavaScript.htm // Set the singleton value to the return value of the self- // executing function block. var singleton = (function(){ // Declare a private variable. var message = "Stop playing with your context!"; this.getMessage = function(){ return( message ); }; // Return this object reference. return( this ); }).call( {} ); // alert the singleton message. alert( "Message:", singleton.getMessage()); ?My thought is that I can use this to better contain the variables and functions in my programs. However, when I try to run the code in a JSfiddle: http://jsfiddle.net/xSKHh/ It does not return the message. What am I missing?

    Read the article

  • Can EventMachine recognize all threads are completed?

    - by philipjkim
    I'm an EM newbie and writing two codes to compare synchronous and asynchronous IO. I'm using Ruby 1.8.7. The example for sync IO is: def pause_then_print(str) sleep 2 puts str end 5.times { |i| pause_then_print(i) } puts "Done" This works as expected, taking 10+ seconds until termination. On the other hand, the example for async IO is: require 'rubygems' require 'eventmachine' def pause_then_print(str) Thread.new do EM.run do sleep 2 puts str end end end EventMachine.run do EM.add_timer(2.5) do puts "Done" EM.stop_event_loop end EM.defer(proc do 5.times { |i| pause_then_print(i) } end) end 5 numbers are shown in 2.x seconds. Now I explicitly wrote code that EM event loop to be stopped after 2.5 seconds. But what I want is that the program terminates right after printing out 5 numbers. For doing that, I think EventMachine should recognize all 5 threads are done, and then stop the event loop. How can I do that? Also, please correct the async IO example if it can be more natural and expressive. Thanks in advance.

    Read the article

  • Java Pack No Resize

    - by ikurtz
    i am learning Java at the moment and have the following question: i am adding my controls to JFrame and then pack() before displaying. this runs the application and all is very nice. i was wondering is there a way to stop the user from resizing the application window? also is there a way to for the image in JLabel to expand as the user changes the application window? at the moment i have it as: constraints.fill = GridBagConstraints.BOTH; constraints.anchor = GridBagConstraints.CENTER; and it only centers the image, i would like to be able to expand/shrink the image. thanks.

    Read the article

  • eliminating noise/spikes

    - by tgv
    I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

    Read the article

  • Alert Box Running First?

    - by corymathews
    I have some jQuery/JS below. The first thing to run is the alert box at the end. $(document).ready(function() { $("#id1 img , .msg").stop().animate( { width: '300px', height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); $(".msg").animate( { width: '50px', height: '50px' }, { duration: 498, easing: 'easeOutSine' }); $("#id1 img").animate( { width: '50px', height: '50px' }, { duration: 500, easing: 'easeOutSine' }); $("#id1 img , .msg").animate( { width: '300px',height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); alert('eh?'); }); I do have a easing plugin. If I run this the alert will show, and then the first animate will happen in the background but not be shown. It will just appear at the final size. Shouldn't the alert run at the end of all the animation? Can anyone explain why this is happening?

    Read the article

  • jquery animate() problem

    - by meo
    $('#somediv').stop(false, true).animate({marginLeft: '-=' + e.width() + 'px'}, options.speed, function(){ options.onNewSlide() }) e.with() returns 640 opctions.speed contains 800 options.onNewSlide() contains a a custom callback function It works fine in firefox. But i debugged it with jquery.lint because it was throwing some random error in IE. lint tells me: When I called animate(...) with your args, an error was thrown! TypeError: c.speed is not a function { message="c.speed is not a function", more...} You passed: [Object { marginLeft="-=640px"}, 800, function()] and it indicates me the line i have posted. I have checked the jquery doc, but my syntax seams ok. Do you know what i am doing wrong?

    Read the article

  • Core Animation cross-dissolve between one string (or image) and another when changing bound value?

    - by danwood
    I have an NSTextView and an NSImageView that is bound to a NSString and an NSImage in my code. I would like to have the displayed string and image cross-dissolve when I change the string and image in code. Any way to do this? Do I need to stop using bindings? (And if I do, is there any trick to getting the string and the image to cross-dissolve when I change the value, or do I have to do something weird like fade it out and fade a new one back in?)

    Read the article

  • Problem with sockets in C#

    - by depo
    Socket socket = new Socket(ipe.AddressFamily, SocketType.Stream, ProtocolType.Tcp); ... socket.SetSocketOption(SocketOptionLevel.Socket, SocketOptionName.ReceiveTimeout, 1000); ... socket.Send(bytesSent, bytesSent.Length, 0); ... bytes = socket.Receive(bytesReceived, bytesReceived.Length, 0); After socket has sent the data, server does not respond so that program waits for response. How to stop receiving data after 1000 miliseconds? ?

    Read the article

  • Using Session to limit form submission by time

    - by user1733850
    I have spent over 2 hours scouring the net trying to figure this out. I am trying to stop multiple form submission any faster than 60 seconds. Here is what I am using. session_start(); if (!isset($_SESSION['last_submit'])) $_SESSION['last_submit'] = time(); if (time()-$_SESSION['last_submit'] < 60) die('Post limit exceeded. Please wait at least 60 seconds'); else $_SESION['last_submit'] = time(); I found this bit here on the site but haven't been able to figure anything else out as far as getting it to work. I have this bit of code on my page at the beginning that does the DB query with the previous pages POST results. Do I need to set $last_submit to a certain value? Any help is appreciated.

    Read the article

< Previous Page | 229 230 231 232 233 234 235 236 237 238 239 240  | Next Page >