Search Results

Search found 6346 results on 254 pages for 'turn a'.

Page 236/254 | < Previous Page | 232 233 234 235 236 237 238 239 240 241 242 243  | Next Page >

  • Using mcrypt to pass data across a webservice is failing

    - by adam
    Hi I'm writing an error handler script which encrypts the error data (file, line, error, message etc) and passes the serialized array as a POST variable (using curl) to a script which then logs the error in a central db. I've tested my encrypt/decrypt functions in a single file and the data is encrypted and decrypted fine: define('KEY', 'abc'); define('CYPHER', 'blowfish'); define('MODE', 'cfb'); function encrypt($data) { $td = mcrypt_module_open(CYPHER, '', MODE, ''); $iv = mcrypt_create_iv(mcrypt_enc_get_iv_size($td), MCRYPT_RAND); mcrypt_generic_init($td, KEY, $iv); $crypttext = mcrypt_generic($td, $data); mcrypt_generic_deinit($td); return $iv.$crypttext; } function decrypt($data) { $td = mcrypt_module_open(CYPHER, '', MODE, ''); $ivsize = mcrypt_enc_get_iv_size($td); $iv = substr($data, 0, $ivsize); $data = substr($data, $ivsize); if ($iv) { mcrypt_generic_init($td, KEY, $iv); $data = mdecrypt_generic($td, $data); } return $data; } echo "<pre>"; $data = md5(''); echo "Data: $data\n"; $e = encrypt($data); echo "Encrypted: $e\n"; $d = decrypt($e); echo "Decrypted: $d\n"; Output: Data: d41d8cd98f00b204e9800998ecf8427e Encrypted: ê÷#¯KžViiÖŠŒÆÜ,ÑFÕUW£´Œt?†÷>c×åóéè+„N Decrypted: d41d8cd98f00b204e9800998ecf8427e The problem is, when I put the encrypt function in my transmit file (tx.php) and the decrypt in my recieve file (rx.php), the data is not fully decrypted (both files have the same set of constants for key, cypher and mode). Data before passing: a:4:{s:3:"err";i:1024;s:3:"msg";s:4:"Oops";s:4:"file";s:46:"/Applications/MAMP/htdocs/projects/txrx/tx.php";s:4:"line";i:80;} Data decrypted: Mª4:{s:3:"err";i:1024@7OYªç`^;g";s:4:"Oops";s:4:"file";sôÔ8F•Ópplications/MAMP/htdocs/projects/txrx/tx.php";s:4:"line";i:80;} Note the random characters in the middle. My curl is fairly simple: $ch = curl_init($url); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, 'data=' . $data); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); $output = curl_exec($ch); Things I suspect could be causing this: Encoding of the curl request Something to do with mcrypt padding missing bytes I've been staring at it too long and have missed something really really obvious If I turn off the crypt functions (so the transfer tx-rx is unencrypted) the data is received fine. Any and all help much appreciated! Thanks, Adam

    Read the article

  • IE browser caching and the jQuery Form Plugin

    - by Harfleur
    Like so many lost souls before me, I'm floundering in the snake pit that is Ajax form submission and IE browser caching. I'm trying to write a simple script using the jQuery Form Plugin to Ajaxify Wordpress comments. It's working fine in Firefox, Chrome, Safari, et. al., but in IE, the response text is cached with the result that Ajax is pulling in the wrong comment. jQuery(this).ajaxSubmit({ success: function(data) { var response = $("<ol>"+data+"</ol>"); response.find('.commentlist li:last').hide().appendTo(jQuery('.commentlist')).slideDown('slow'); } }); ajaxSubmit sends the comment to wp-comments-post.php, which inelegantly spits back the entire page as a response. So, despite the fact that it's ugly as toads, I'm sticking the response text in a variable, using :last to isolate the most recent comment, and sliding it down in its place. IE, however, is returning the cached version of the page, which doesn't include the new comment. So ".commentlist li:last" selects the previous comment, a duplicate of which then uselessly slides down beneath the original. I've tried setting "cache: false" in the ajaxSubmit options, but it has no effect. I've tried setting a url option and tacking on a random number or timestamp, but it winds up being attached to the POST that submits the comment to the server rather than the GET that returns the response, and so has no effect. I'm not sure what else to try. Everything works fine in IE if I turn off browser caching, but that's obviously not something I can expect anyone viewing the page to do. Any help will be hugely appreciated. Thanks in advance! EDIT WITH A PROGRESS REPORT: A couple of people have suggested using PHP headers to prevent caching, and this does indeed work. The trouble is that wp-comments-post is spitting back the entire page when a new comment is submitted, and the only way I can see to add headers is to put them in the Wordpress post template, which disables caching on all posts at all times--not quite the behavior I'm looking for. Is there a way to set a php conditional--"if is_ajax" or something like that--that would keep the headers from being applied during regular pageloads, but plug them in if the page was called by an Ajax GET?

    Read the article

  • Paypal IPN: how get the POSTs from this class?

    - by sineverba
    I'm using this Class <?php class paypalIPN { //sandbox: private $paypal_url = 'https://www.sandbox.paypal.com/cgi-bin/webscr'; //live site: //private $paypal_url = 'https://www.paypal.com/cgi-bin/webscr'; private $data = null; public function __construct() { $this->data = new stdClass; } public function isa_dispute() { //is it some sort of dispute. return $this->data->txn_type == "new_case"; } public function validate() { // parse the paypal URL $response = ""; $url_parsed = parse_url($this->paypal_url); // generate the post string from the _POST vars aswell as load the // _POST vars into an arry so we can play with them from the calling // script. $post_string = ''; foreach ($_POST as $field=>$value) { $this->data->$field = $value; $post_string .= $field.'='.urlencode(stripslashes($value)).'&'; } $post_string.="cmd=_notify-validate"; // append ipn command $ch = curl_init(); curl_setopt($ch, CURLOPT_URL, $this->paypal_url); //curl_setopt($ch, CURLOPT_VERBOSE, 1); //keep the peer and server verification on, recommended //(can switch off if getting errors, turn to false) curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, FALSE); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, FALSE); curl_setopt($ch, CURLOPT_RETURNTRANSFER,1); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_POSTFIELDS, $post_string); $response = curl_exec($ch); if (curl_errno($ch)) { die("Curl Error: " . curl_errno($ch) . ": " . curl_error($ch)); } curl_close($ch); return $response; if (preg_match("/VERIFIED/", $response)) { // Valid IPN transaction. return $this->data; } else { return false; } } } ANd i recall in this mode: public function get_ipn() { $ipn = new paypalIPN(); $result = $ipn->validate(); $logger = new Log('/error.log'); $logger->write(print_r($result)); } But I obtain only "VERIFIED" or "1" (whitout or with the print_r function). I just tried also to return directly the raw curl response with return $response; or return $this->response; or also return $this->parse_string; but everytime I receive only "1" or "VERIFIED"....... Thank you very much

    Read the article

  • android error NoSuchElementException

    - by Alexander
    I have returned a cursor string but it contains a delimiter. The delimiter is . I have the string quest.setText(String.valueOf(c.getString(1)));I want to turn the into a new line. What is the best method to achieve this task in android. I understand there is a way to get the delimeter. I want this to achieved for each record. I can itterate through record like so. Cursor c = db.getContact(2); I tried using a string tokenizer but it doesnt seem to work. Here is the code for the tokenizer. I tested it in just plain java and it works without errors. String question = c.getString(1); // quest.setText(String.valueOf(c.getString(1))); //quest.setText(String.valueOf(question)); StringTokenizer st = new StringTokenizer(question,"<ENTER>"); //DisplayContact(c); // StringTokenizer st = new StringTokenizer(question, "=<ENTER>"); while(st.hasMoreTokens()) { String key = st.nextToken(); String val = st.nextToken(); System.out.println(key + "\n" + val); } I then tried running it in android. Here is the error log 06-06 22:31:55.251: E/AndroidRuntime(537): FATAL EXCEPTION: main 06-06 22:31:55.251: E/AndroidRuntime(537): java.util.NoSuchElementException 06-06 22:31:55.251: E/AndroidRuntime(537): at java.util.StringTokenizer.nextToken(StringTokenizer.java:208) 06-06 22:31:55.251: E/AndroidRuntime(537): at alex.android.test.database.quiz.TestdatabasequizActivity$1.onClick(TestdatabasequizActivity.java:95) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.view.View.performClick(View.java:3511) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.view.View$PerformClick.run(View.java:14105) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Handler.handleCallback(Handler.java:605) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Handler.dispatchMessage(Handler.java:92) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Looper.loop(Looper.java:137) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.app.ActivityThread.main(ActivityThread.java:4424) 06-06 22:31:55.251: E/AndroidRuntime(537): at java.lang.reflect.Method.invokeNative(Native Method) 06-06 22:31:55.251: E/AndroidRuntime(537): at java.lang.reflect.Method.invoke(Method.java:511) 06-06 22:31:55.251: E/AndroidRuntime(537): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:784) 06-06 22:31:55.251: E/AndroidRuntime(537): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:551) 06-06 22:31:55.251: E/AndroidRuntime(537): at dalvik.system.NativeStart.main(Native Method) This is the database query public Cursor getContact(long rowId) throws SQLException { Cursor mCursor = db.query(true, DATABASE_TABLE, new String[] {KEY_ROWID, question, possibleAnsOne,possibleAnsTwo, possibleAnsThree,realQuestion,UR}, KEY_ROWID + "=" + rowId, null, null, null, null, null); if (mCursor != null) { mCursor.moveToFirst(); }

    Read the article

  • How can I create a Base64-Encoded string from an GDI+ Image in C++?

    - by Schnapple
    I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

    Read the article

  • Problems with creating and using of delegate-protocols

    - by Flocked
    Hello, I have the problem that I have created a delegate protocol, but the necessary methods are not executed, although I have implemented the protocol in my header file. Here are the detailed explanation: I created an instance of my ViewController (TimeLineViewController), which will be displayed. This ViewController contains a UITableView, which in turn receives the individual Cells / Rows from one instance of my TableViewCell. So the ViewController creates an instance of TableCellView. The TableViewCell contains a UITextView, which contains web links. Now I want, that not safari opens the links, but my own built-in browser. Unfortunately TableViewCell can not open a new ViewController with a WebView, so I decided to create a delegate protocol. The whole thing looks like this: WebViewTableCellDelegate.h: @protocol WebViewTableCellDelegate -(void)loadWeb; @end Then I created a instance WebViewDelegate in the TableViewCell: id <WebViewTableCellDelegate> _delegate; In the .m of the TableViewCell: @interface UITextView (Override) @end @class WebView, WebFrame; @protocol WebPolicyDecisionListener; @implementation UITextView (Override) - (void)webView:(WebView *)webView decidePolicyForNavigationAction:(NSDictionary *)actionInformation request:(NSURLRequest *)request frame:(WebFrame *)frame decisionListener:(id < WebPolicyDecisionListener >)listener { NSLog(@"request: %@", request); [_delegate loadWeb]; } @end - (void)setDelegate:(id <WebViewTableCellDelegate>)delegate{ _delegate = delegate;} And in my TimeLineViewController I implemented the protocol with < and the loadWeb-metode: - (void)loadWeb{ WebViewController *web = [[WebViewController alloc] initWithNibName:nil bundle:nil]; web.modalTransitionStyle = UIModalTransitionStyleFlipHorizontal; [self presentModalViewController: web animated:YES]; [web release]; } And when the instance of the TableViewCell will be created in the TimelineViewController: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *MyIdentifier = @"MyIdentifier"; MyIdentifier = @"tableCell"; TableViewCell *cell = (TableViewCell *)[tableView dequeueReusableCellWithIdentifier:MyIdentifier]; if(cell == nil) { [[NSBundle mainBundle] loadNibNamed:@"TableViewCell" owner:self options:nil]; cell = tableCell;} [cell setDelegate:self]; //… } It is the first time I created a own delegate-protocol, so maybe there are stupid mistakes. Also I´m learnung Objective-C and programming generally only for 4 weeks. Thanks for your help! EDIT: I think i found the problem, but I dont know how to resolve it. I try to use [_delegate loadWeb]; in the subclass of the UITextView (because that is the only way i can react on the weblinks) and the subclass can´t use [_delegate loadWeb];. I tried this in a other methode and it worked.

    Read the article

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • Helping linqtosql datacontext use implicit conversion between varchar column in the database and tab

    - by user213256
    I am creating an mssql database table, "Orders", that will contain a varchar(50) field, "Value" containing a string that represents a slightly complex data type, "OrderValue". I am using a linqtosql datacontext class, which automatically types the "Value" column as a string. I gave the "OrderValue" class implicit conversion operators to and from a string, so I can easily use implicit conversion with the linqtosql classes like this: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // use implicit converstion to turn the string representation of the order // value into the complex data type. OrderValue value = order.Value; // adjust one of the fields in the complex data type value.Shipping += 10; // use implicit conversion to store the string representation of the complex // data type back in the linqtosql order object order.Value = value; // save changes db.SubmitChanges(); However, I would really like to be able to tell the linqtosql class to type this field as "OrderValue" rather than as "string". Then I would be able to avoid complex code and re-write the above as: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // The Value field is already typed as the "OrderValue" type rather than as string. // When a string value was read from the database table, it was implicity converted // to "OrderValue" type. order.Value.Shipping += 10; // save changes db.SubmitChanges(); In order to achieve this desired goal, I looked at the datacontext designer and selected the "Value" field of the "Order" table. Then, in properties, I changed "Type" to "global::MyApplication.OrderValue". The "Server Data Type" property was left as "VarChar(50) NOT NULL" The project built without errors. However, when reading from the database table, I was presented with the following error message: Could not convert from type 'System.String' to type 'MyApplication.OrderValue'. at System.Data.Linq.DBConvert.ChangeType(Object value, Type type) at Read_Order(ObjectMaterializer1 ) at System.Data.Linq.SqlClient.ObjectReaderCompiler.ObjectReader2.MoveNext() at System.Linq.Buffer1..ctor(IEnumerable1 source) at System.Linq.Enumerable.ToArray[TSource](IEnumerable`1 source) at Example.OrdersProvider.GetOrders() at ... etc From the stack trace, I believe this error is happening while reading the data from the table. When presented with converting a string to my custom data type, even though the implicit conversion operators are present, the DBConvert class gets confused and throws an error. Is there anything I can do to help it not get confused and do the implicit conversion? Thanks in advance, and apologies if I have posted in the wrong forum. cheers / Ben

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • User has many computers, computers have many attributes in different tables, best way to JOIN?

    - by krismeld
    I have a table for users: USERS: ID | NAME | ---------------- 1 | JOHN | 2 | STEVE | a table for computers: COMPUTERS: ID | USER_ID | ------------------ 13 | 1 | 14 | 1 | a table for processors: PROCESSORS: ID | NAME | --------------------------- 27 | PROCESSOR TYPE 1 | 28 | PROCESSOR TYPE 2 | and a table for harddrives: HARDDRIVES: ID | NAME | ---------------------------| 35 | HARDDRIVE TYPE 25 | 36 | HARDDRIVE TYPE 90 | Each computer can have many attributes from the different attributes tables (processors, harddrives etc), so I have intersection tables like this, to link the attributes to the computers: COMPUTER_PROCESSORS: C_ID | P_ID | --------------| 13 | 27 | 13 | 28 | 14 | 27 | COMPUTER_HARDDRIVES: C_ID | H_ID | --------------| 13 | 35 | So user JOHN, with id 1 owns computer 13 and 14. Computer 13 has processor 27 and 28, and computer 13 has harddrive 35. Computer 14 has processor 27 and no harddrive. Given a user's id, I would like to retrieve a list of that user's computers with each computers attributes. I have figured out a query that gives me a somewhat of a result: SELECT computers.id, processors.id AS p_id, processors.name AS p_name, harddrives.id AS h_id, harddrives.name AS h_name, FROM computers JOIN computer_processors ON (computer_processors.c_id = computers.id) JOIN processors ON (processors.id = computer_processors.p_id) JOIN computer_harddrives ON (computer_harddrives.c_id = computers.id) JOIN harddrives ON (harddrives.id = computer_harddrives.h_id) WHERE computers.user_id = 1 Result: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | HARDDRIVE TYPE 25 | But this has several problems... Computer 14 doesnt show up, because it has no harddrive. Can I somehow make an OUTER JOIN to make sure that all computers show up, even if there a some attributes they don't have? Computer 13 shows up twice, with the same harddrive listet for both. When more attributes are added to a computer (like 3 blocks of ram), the number of rows returned for that computer gets pretty big, and it makes it had to sort the result out in application code. Can I somehow make a query, that groups the two returned rows together? Or a query that returns NULL in the h_name column in the second row, so that all values returned are unique? EDIT: What I would like to return is something like this: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | NULL | 14 | 27 | PROCESSOR TYPE 1 | NULL | NULL | Or whatever result that make it easy to turn it into an array like this [13] => [P_NAME] => [0] => PROCESSOR TYPE 1 [1] => PROCESSOR TYPE 2 [H_NAME] => [0] => HARDDRIVE TYPE 25 [14] => [P_NAME] => [0] => PROCESSOR TYPE 1

    Read the article

  • jQuery: form input values turns up undefined

    - by Seerumi
    Having problem with this bit of code qith jQuery. it should pick the values from current form and then submit them, but when I try to get them with jQuery they always turn up undefined. I know the SQL results are fine since they show correctly in HTML table, so it must be my inferior javascript skills. New with jQuery and I'm at loss :( PHP/HTML: echo "<table>\n" while ($row = odbc_fetch_array($query)) { echo "<form class='catForm'>\n"; echo "<input type=hidden class='catID' name='catID' value='".$row['running_id']."'/>\n"; echo "<tr>\n"; echo "<td>".$row['running_id']."</td>\n"; echo "<td>".$row['site_id']."</td>\n"; echo "<td>".$row['main_category']."</td>\n"; echo "<td>".$row['map_name']."</td>\n"; echo "<td><input type=textfield class='bCatID' value='".$row['mapping_id']."' size=6/></td>\n"; echo "<td><input type=submit class='saveCat' value='Save'/></td>\n"; echo "<td><input type=submit class='killCat' value='Delete' /></td>\n"; echo "</tr>\n"; echo "</form>\n"; } echo "</table>"; jQuery: $(".catForm").submit(function () { var id = $(this).find('.catID').val(); var bCatID = $(this).find('.bCatID').val(); var dataString = 'id='+id+'&bCatID='+bCatID; $.ajax({ type: "POST", url: 'adminUI/bin/updateSCategories.php', dataType : 'json', data: dataString, success: function(data) { if (data.error == true) $('.failure').html("Error, save failed.").show().fadeOut(2000); if (data.error == false) $('.success').html("Saved succesfully").show().fadeOut(2000); }, error: function(XMLHttpRequest, textStatus, errorThrown) { $('.failure').html("Error, save failed.").show().fadeOut(2000); } }); return false; }); RESULT: id: undefined bCatID: undefined

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • How to handle very frequent updates to a Lucene index

    - by fsm
    I am trying to prototype an indexing/search application which uses very volatile indexing data sources (forums, social networks etc), here are some of the performance requirements, Very fast turn-around time (by this I mean that any new data (such as a new message on a forum) should be available in the search results very soon (less than a minute)) I need to discard old documents on a fairly regular basis to ensure that the search results are not dated. Last but not least, the search application needs to be responsive. (latency on the order of 100 milliseconds, and should support at least 10 qps) All of the requirements I have currently can be met w/o using Lucene (and that would let me satisfy all 1,2 and 3), but I am anticipating other requirements in the future (like search relevance etc) which Lucene makes easier to implement. However, since Lucene is designed for use cases far more complex than the one I'm currently working on, I'm having a hard time satisfying my performance requirements. Here are some questions, a. I read that the optimize() method in the IndexWriter class is expensive, and should not be used by applications that do frequent updates, what are the alternatives? b. In order to do incremental updates, I need to keep committing new data, and also keep refreshing the index reader to make sure it has the new data available. These are going to affect 1 and 3 above. Should I try duplicate indices? What are some common approaches to solving this problem? c. I know that Lucene provides a delete method, which lets you delete all documents that match a certain query, in my case, I need to delete all documents which are older than a certain age, now one option is to add a date field to every document and use that to delete documents later. Is it possible to do range queries on document ids (I can create my own id field since I think that the one created by lucene keeps changing) to delete documents? Is it any faster than comparing dates represented as strings? I know these are very open questions, so I am not looking for a detailed answer, I will try to treat all of your answers as suggestions and use them to inform my design. Thanks! Please let me know if you need any other information.

    Read the article

  • Maximum nametable char count exceeded

    - by doc
    I'm having issues with the maximum nametable char count quota, I followed a couple of answers here and it solved the problem for a while, but now I'm having the same issue. My Server side config is as follows: <system.serviceModel> <bindings> <netTcpBinding> <binding name="GenericBinding" maxBufferPoolSize="2147483647" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> <security mode="None" /> </binding> </netTcpBinding> </bindings> <behaviors> <serviceBehaviors> <behavior> <serviceMetadata httpGetEnabled="false" /> <serviceDebug includeExceptionDetailInFaults="true" /> <dataContractSerializer maxItemsInObjectGraph="1000000" /> </behavior> </serviceBehaviors> </behaviors> <services> <service name="REMWCF.RemWCFSvc"> <endpoint address="" binding="netTcpBinding" contract="REMWCF.IRemWCFSvc" bindingConfiguration="GenericBinding" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:9081/RemWCFSvc" /> </baseAddresses> </host> </service> </services> </system.serviceModel> I also have the same tcp binding on the devenv configuration. Have I reached the limit of contracts supported? Is there a way to turn off that quota? EDIT Error Message: Error: Cannot obtain Metadata from net.tcp://localhost:9081/RemWCFSvc/mex If this is a Windows (R) Communication Foundation service to which you have access, please check that you have enabled metadata publishing at the specified address. For help enabling metadata publishing, please refer to the MSDN documentation at http://go.microsoft.com/fwlink/?LinkId=65455.WS-Metadata Exchange Error URI: net.tcp://localhost:9081/RemWCFSvc/mex Metadata contains a reference that cannot be resolved: 'net.tcp://localhost:9081/RemWCFSvc/mex'. There is an error in the XML document. The maximum nametable character count quota (16384) has been exceeded while reading XML data. The nametable is a data structure used to store strings encountered during XML processing - long XML documents with non-repeating element names, attribute names and attribute values may trigger this quota. This quota may be increased by changing the MaxNameTableCharCount property on the XmlDictionaryReaderQuotas object used when creating the XML reader. I'm getting that error when trying to run the WCF (which is hosted in a windows service app).

    Read the article

  • jquery - targetting a select using $this

    - by Maureen
    I am trying to get individual selects (which have the same class as other selects) to respond to a .change function, however it only works on one of the selects. If you test out this code it will make more sense. Try to add a few "ON/OFF events", and then select "Specified Time" in the various selects. You'll see only the first one responds. Any ideas? Thanks! Please see the following code: $(document).ready(function() { var neweventstring = '<div class="event">Turns <select name="ONOFF"><option value="On">ON</option><option value="Off">OFF</option></select> at: <select name="setto" class="setto"><option>Select Time</option><option value="Sunrise">Sunrise</option><option value="Sunset">Sunset</option><option value="specifiedtime">Specified Time</option></select></div>'; $('#addmondaysevent').click(function () { $('#monday .events').append(neweventstring); }); $('.setto').change(function() { alert('The function is called'); if($("option:selected", this).val() =="specifiedtime"){ alert('If returns true'); $(this).css("background-color", "#cc0000"); $(this).after('<div class="specifictime"><input type="text" value="00" style="width:30px"/> : <input type="text" value="00" style="width:30px"> <select name="ampm"><option value="AM" selected>AM</option><option value="PM">PM</option></select></div>') } }); }); And my HTML: <div id="monday"> <h2>Mondays</h2> <div class="events"> <div class="event"> Turn <select name="ONOFF"> <option value="On">ON</option> <option value="Off">OFF</option> </select> at: <select name="setto" class="setto"> <option>Select Time</option> <option value="Sunrise">Sunrise</option> <option value="Sunset">Sunset</option> <option value="specifiedtime">Specified Time</option> </select> </div> [<a id="addmondaysevent">Add an ON/OFF event</a>] </div> </div>

    Read the article

  • .NET Free memory usage (how to prevent overallocation / release memory to the OS)

    - by Ronan Thibaudau
    I'm currently working on a website that makes large use of cached data to avoid roundtrips. At startup we get a "large" graph (hundreds of thouthands of different kinds of objects). Those objects are retrieved over WCF and deserialized (we use protocol buffers for serialization) I'm using redgate's memory profiler to debug memory issues (the memory didn't seem to fit with how much memory we should need "after" we're done initializing and end up with this report Now what we can gather from this report is that: 1) Most of the memory .NET allocated is free (it may have been rightfully allocated during deserialisation, but now that it's free, i'd like for it to return to the OS) 2) Memory is fragmented (which is bad, as everytime i refresh the cash i need to redo the memory hungry deserialisation process and this, in turn creates large object that may throw an OutOfMemoryException due to fragmentation) 3) I have no clue why the space is fragmented, because when i look at the large object heap, there are only 30 instances, 15 object[] are directly attached to the GC and totally unrelated to me, 1 is a char array also attached directly to the GC Heap, the remaining 15 are mine but are not the cause of this as i get the same report if i comment them out in code. So my question is, what can i do to go further with this? I'm not really sure what to look for in debugging / tools as it seems my memory is fragmented, but not by me, and huge amounts of free spaces are allocated by .net , which i can't release. Also please make sure you understand the question well before answering, i'm not looking for a way to free memory within .net (GC.Collect), but to free memory that is already free in .net , to the system as well as to defragment said memory. Note that a slow solution is fine, if it's possible to manually defragment the large heap i'd be all for it as i can call it at the end of RefreshCache and it's ok if it takes 1 or 2 second to run. Thanks for your help! A few notes i forgot: 1) The project is a .net 2.0 website, i get the same results running it in a .net 4 pool, idem if i run it in a .net 4 pool and convert it to .net 4 and recompile. 2) These are results of a release build, so debug build can not be the issue. 3) And this is probably quite important, i do not get these issues at all in the webdev server, only in IIS, in the webdev i get memory consumption rather close to my actual consumption (well more, but not 5-10X more!)

    Read the article

  • Objective-C++ Memory Problem

    - by Stephen Furlani
    Hello, I'm having memory woes. I've got a C++ Library (Equalizer from Eyescale) and they use the Traversal Visitor Pattern to allow you to add new functionality to their classes. I've finally figured out how it works, and I've got a Visitor that just returns the properties from one of the objects. (since I don't know how they're allocated). so. My little code does this: VisitorResult AGLContextVisitor::visit( Channel* channel ) { // Search through Nodes, Pipes until we get to the right window. // Add some code to make sure we find the right one? // Not executing the following code as C++ in gdb? eq::Window* w = channel->getWindow(); OSWindow* osw = w->getOSWindow(); AGLWindow* aw = (AGLWindow *)osw; AGLContext agl_ctx = aw->getAGLContext(); this->setContext(agl_ctx); return TRAVERSE_PRUNE; } So here's the problem. eq::Window* w = channel->getWindow(); (gdb) print w 0x0 BUT If I do this: (gdb) set objc-non-blocking-mode off (gdb) print w=channel->getWindow() 0x300effb9 // an honest memory location, and sets w as verified in the Debugger window of XCode. It does the same thing for osw. I don't get it. Why would something work in (gdb) but not in the code? The file is completely a cpp file, but it seems to be running in objc++, since I need to turn blocking off. Help!? I feel like I'm missing some memory-management basic thing here, either with C++ or Obj-C. [edit] channel-getWindow() is supposed to do this: /** @return the parent window. @version 1.0 */ Window* getWindow() { return _window; } The code also executes fine if I run it from a C++-only application. [edit] No... I tried creating a simple stand-alone program since I was tired of running it as a plugin. Messy to debug. And no, it doesn't run in the C++ program either. So I'm really at a loss as to what I'm doing wrong. Thanks, -- Stephen Furlani

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • ANSI C as core of a C# project? Is this possible?

    - by Nektarios
    I'm writing a NON-GUI app which I want to be cross platform between OS X and Windows. I'm looking at the following architecture, but I don't know if it will work on the windows side: (Platform specific entry point) - ANSI C main loop = ANSI C model code doing data processing / logic = (Platform specific helpers) So the core stuff I'm planning to write in regular ANSI C, because A) it should be platform independent, B) I'm extremely comfortable with C, C) It can do the job and do it well (Platform specific entry point) can be written in whatever necessary to get the job done, this is a small amount of code, doesn't matter to me. (Platform specific helpers) is the sticky thing. This is stuff like parsing XML, accessing databases, graphics toolkit stuff, whatever. Things that aren't easy in C. Things that modern languages/frameworks will give for free. On OS X this code will be written in Objective-C interfacing with Cocoa. On Windows I'm thinking my best bet is to use C# So on Windows my architecture (simplified) looks like (C# or C?) - ANSI C - C# Is this possible? Some thoughts/suggestions so far.. 1) Compile my C core as a .dll -- this is fine, but seems there's no way to call my C# helpers unless I can somehow get function pointers and pass them to my core, but that seems unlikely 2) Compile a C .exe and a C# .exe and have them talk via shared memory or some kind of IPC. I'm not entirely opposed to this but it obviously introduces a lot of complexity so it doesn't seem ideal 3) Instead of C# use C++, it gets me some nice data management stuff and nice helper code. And I can mix it pretty easily. And the work I do could probably easily port to Linux. But I really don't like C++, and I don't want this to turn in to a 3rd-party-library-fest. Not that it's a huge deal, but it's 2010.. anything for basic data management should be built in. And targetting Linux is really not a priority. Note that no "total" alternatives are OK as suggested in other similar questions on SO I've seen; java, RealBasic, mono.. this is an extremely performance intensive application doing soft realtime for game/simulation purposes, I need C & friends here to do it right (maybe you don't, but I do)

    Read the article

  • How to design service that can provide interface as JAX-WS web service, or via JMS, or as local meth

    - by kevinegham
    Using a typical JEE framework, how do I develop and deploy a service that can be called as a web service (with a WSDL interface), be invoked via JMS messages, or called directly from another service in the same container? Here's some more context: Currently I am responsible for a service (let's call it Service X) with the following properties: Interface definition is a human readable document kept up-to-date manually. Accepts HTTP form-encoded requests to a single URL. Sends plain old XML responses (no schema). Uses Apache to accept requests + a proprietary application server (not servlet or EJB based) containing all logic which runs in a seperate tier. Makes heavy use of a relational database. Called both by internal applications written in a variety of languages and also by a small number of third-parties. I want to (or at least, have been told to!): Switch to a well-known (pref. open source) JEE stack such as JBoss, Glassfish, etc. Split Service X into Service A and Service B so that we can take Service B down for maintenance without affecting Service A. Note that Service B will depend on (i.e. need to make requests to) Service A. Make both services easier for third parties to integrate with by providing at least a WS-I style interface (WSDL + SOAP + XML + HTTP) and probably a JMS interface too. In future we might consider a more lightweight API too (REST + JSON? Google Protocol Buffers?) but that's a nice to have. Additional consideration are: On a smaller deployment, Service A and Service B will likely to running on the same machine and it would seem rather silly for them to use HTTP or a message bus to communicate; better if they could run in the same container and make method calls to each other. Backwards compatibility with the existing ad-hoc Service X interface is not required, and we're not planning on re-using too much of the existing code for the new services. I'm happy with either contract-first (WSDL I guess) or (annotated) code-first development. Apologies if my terminology is a bit hazy - I'm pretty experienced with Java and web programming in general, but am finding it quite hard to get up to speed with all this enterprise / SOA stuff - it seems I have a lot to learn! I'm also not very used to using a framework rather than simply writing code that calls some packages to do things. I've got as far as downloading Glassfish, knocking up a simple WSDL file and using wsimport + a little dummy code to turn that into a WAR file which I've deployed.

    Read the article

  • What's special about mouse capture and middle mouse button in WPF?

    - by Scott Bilas
    When I call CaptureMouse() in response to a MouseDown from the middle mouse button, it will capture and then release the mouse. Huh? I've tried using Preview events, setting Handled=true, doesn't make a difference. Am I not understanding mouse capture in WPF? Here's some minimal sample code that reproduces the problem. // TestListBox.cs using System.Diagnostics; using System.Windows.Controls; namespace Local { public class TestListBox : ListBox { public TestListBox() { MouseDown += (_, e) => { Debug.WriteLine("+MouseDown"); Debug.WriteLine(" Capture: " + CaptureMouse()); Debug.WriteLine("-MouseDown"); }; MouseUp += (_, e) => { Debug.WriteLine("+MouseUp"); ReleaseMouseCapture(); Debug.WriteLine("-MouseUp"); }; GotMouseCapture += (_, e) => Debug.WriteLine("GotMouseCapture"); LostMouseCapture += (_, e) => Debug.WriteLine("LostMouseCapture"); } } } Generating a default WPF app that has this for its main window will use the test class: <Window x:Class="Local.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:local="clr-namespace:Local" Title="MainWindow" Height="350" Width="525"> <local:TestListBox> <ListBoxItem>1</ListBoxItem> <ListBoxItem>2</ListBoxItem> <ListBoxItem>3</ListBoxItem> <ListBoxItem>4</ListBoxItem> </local:TestListBox> </Window> Upon clicking the middle button down, I get this output: +MouseDown GotMouseCapture LostMouseCapture Capture: True -MouseDown So I'm calling CaptureMouse, which in turn grabs and then releases capture, yet returns true that capture was successfully acquired. What's going on here? Is it possible that this is something with my Logitech mouse driver doing something goofy, trying to initiate 'ultrascroll' or something?

    Read the article

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

< Previous Page | 232 233 234 235 236 237 238 239 240 241 242 243  | Next Page >