Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 249/306 | < Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >

  • Syntax Error? When parsing XML value

    - by Ace Munim
    I don't know if I'm having a syntax error but the compiler is giving me TypeError: 'undefined' is not an object (evaluating 'xmlDoc.getElementsByTagName("icon")[i].childNodes') Its me giving me this problem when im parsing the XML from my server, my actual javascript code is like this var xmlDoc = Obj.responseXML; var count = 0; if(xmlDoc){ while(count <= xmlDoc.getElementsByTagName("item").length){ document.getElementById("flow").innerHTML += "<div class='item'><img class='content' src='" + xmlDoc.getElementsByTagName("icon")[i].childNodes[0].nodeValue.replace(/\s+$/g,' ') +"' /></div>"; count++; } }else{ alert("Unable to parse!"); } and my XML goes like this. <feed> <item> <title>Given Title</title> <icon> http://i178.photobucket.com/albums/w255/ace003_album/Logo-ETC-RGB-e1353503652739.jpg </icon> </item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> <item>...</item> </feed> i just want to parse the image link and to show it.

    Read the article

  • jQuery click event on image only fires once

    - by stephenreece@
    I created a view of thumbnails. When the user clicks, I want the real image to pop-up in a dialog. That works the first time, but once the jQuery 'click' fires on an thumbnail it never fires again unless I reload the entire page. I've tried rebinding the click events on the dialog close that that does not help. Here is my code: function LoadGalleryView() { $('img.gallery').each(function(){ BindImage($(this)); }); } function BindImage(image) { var src= image.attr('src'); var id= image.attr('id'); var popurl = src.replace("thumbs/", ""); image.hover(function(){ image.attr('style', 'height: 100%; width: 100%;'); }, function(){ image.removeAttr('style'); }); $('#'+id).live('click', function() { PopUpImage(popurl); }); } function CheckImage(img,html) { if ( img.complete ) { $('#galleryProgress').html(''); var imgwidth = img.width+35; var imgheight = img.height+65; $('<div id="viewImage" title="View"></div>').html(html).dialog( { bgiframe: true, autoOpen: true, modal: true, width: imgwidth, height: imgheight, position: 'center', closeOnEscape: true }); } else { $('#galleryProgress').html('<img src="images/ajax-loader.gif" /><br /><br />'); setTimeout(function(){CheckImage(img,html);},10); } } function PopUpImage(url) { var html = '<img src="'+url+'" />'; var img = new Image(); img.src = url; if ( ! img.complete ) { setTimeout(function(){CheckImage(img,html);},10); } } PopUpImage() only executes the first time an image is clicked and I cannot figure out how to rebind.

    Read the article

  • jQuery AJAX Redirection problem

    - by meosoft
    Hello please consider this: On page A I have a link that takes you to page B when JS is off, but when JS is on, I want to replace content on current page with content from the page B. Pages A and B are in fact the same script that is able to tell AJAX calls from regular ones and serve the content appropriately. Everything works fine, as long as there are no redirects involved. But, sometimes there is a 301 redirect and what seems to be happening is that client browser then makes a second request, which will return with a 200 OK. Only the second request is sent without a X-Requested-With header, therefore I cannot tell within my script wether it came from AJAX or not, and will send a complete page instead of just the content. I have tried checking for 301 status code in my error, success, and complete handlers but none of them worked. It seems to be handling the 301 behind the scenes. Could anyone help me with this? jQuery 1.4, PHP 5 Edit: People requested the code to this, which I didn't think was necessary but here goes: // hook up menu ajax loading $('#menu a').live("click", function(){ // update menu highlight if($(this).parents('#menu').size() > 0){ $("#menu>li").removeClass("current_page_item"); $(this).parent().addClass("current_page_item"); } // get the URL where we will be retrieving content from var url = $(this).attr('href'); window.location.hash = hash = url; $.ajax({ type: "GET", url: url, success: function(data){ // search for an ID that is only present if page is requested directly if($(data).find('#maincontent').size() > 0){ data = $(data).find('#maincontent .content-slide *').get(); } // the rest is just animating the content into view $("#scroller").html(data); $('.content-slide').each(setHeight); $('.content-slide').animate({ left: "0px" }, 1000, 'easeOutQuart', function(){ $('#home').css("left", "-760px").html(data); $('#scroller').css("left", "-760px"); $('.content-slide').each(setHeight); } ); } }); return false; });

    Read the article

  • Visual C++ overrides/mock objects for unit testing?

    - by Mark
    When I'm running unit tests, I want to be able to "stub out" or create a mock object, but I'm running into DLL Hell. For example: There are two DLL libraries built: A.dll and B.dll -- Classes in A.dll have calls to classes in B.dll so when A.dll was built, the link line was using B.lib for the defintions. My test driver (Foo.exe) is testing classes in A.dll, so it links against A.lib. However, I want to "stub out" some of the calls A.dll makes to B.dll with simple versions (return basic value, no DB look up, etc). I can't build an Override.dll that just overrides the needed methods (not entire classes) and replace B.dll because Foo.exe will A) complain that B.dll is missing if I just remove it and put Override.dll in it's place or B) if I rename Override.dll to B.dll, Foo.exe complains that there are unresolved symbols because Override.dll is not a complete implementation of B.dll. Is there a way to do this? Is there a way to statically link Foo.exe with A.lib, B.lib and Override.lib such that it will work without having to completely rebuild A.lib and B.lib to remove the __delcspec(dllexport)? Is there another option?

    Read the article

  • Hibernate 3.5.0 causes extreme performance problems

    - by user303396
    I've recently updated from hibernate 3.3.1.GA to hibernate 3.5.0 and I'm having a lot of performance issues. As a test, I added around 8000 entities to my DB (which in turn cause other entities to be saved). These entities are saved in batches of 20 so that the transactions aren't too large for performance reasons. When using hibernate 3.3.1.GA all 8000 entities get saved in about 3 minutes. When using hibernate 3.5.0 it starts out slower than with hibernate 3.3.1. But it gets slower and slower. At around 4,000 entities, it sometimes takes 5 minutes just to save a batch of 20. If I then go to a mysql console and manually type in an insert statement from the mysql general query log, half of them run perfect in 0.00 seconds. And half of them take a long time (maybe 40 seconds) or timeout with "ERROR 1205 (HY000): Lock wait timeout exceeded; try restarting transaction" from MySQL. Has something changed in hibernate's transaction management in version 3.5.0 that I should be aware of? The ONLY thing I changed to experience these unusable performance issues is replace the following hibernate 3.3.1.GA jar files: com.springsource.org.hibernate-3.3.1.GA.jar, com.springsource.org.hibernate.annotations-3.4.0.GA.jar, com.springsource.org.hibernate.annotations.common-3.3.0.ga.jar, com.springsource.javassist-3.3.0.ga.jar with the new hibernate 3.5.0 release hibernate3.jar and javassist-3.9.0.GA.jar. Thanks.

    Read the article

  • radio input replacement using jquery

    - by altvali
    It may seem a bit odd to ask this since there are several solutions out there but the fact is that all of them look pretty and none of what i've seem save the input value for form submission the right way. I'm looking for something that will replace all radio inputs with divs that get special classes when they are hovered or clicked, and an input type hidden for every group of radio inputs with the same name, hidden input that will be updated with the value corresponding to the div the user clicks on. Long sentence, i know. Here's what i've come up with: $('input:radio').each(function(){ if (this.style.display!='none') { var inputName = $(this).attr('name'); var inputValue = $(this).attr('value'); var isChecked = $(this).attr('checked'); if (!$('input:hidden[name='+inputName+']').length) // if the hidden input wasn't already created $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div><input type="hidden" name="'+inputName+'" value="'+inputValue+'" />'); else{ $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div>'); if (isChecked) $('input:hidden[name='+inputName+']').attr({'value':inputValue}); } //this bind doesn't work $("#"+inputName+"X"+inputValue).click(function(){ if($('input:hidden[name='+inputName+']').val()!=inputValue){ $('input:hidden[name='+inputName+']').attr({'value':inputValue}); $('div[id*='+inputName+'].inputRadioButton').removeClass('inputRadioButtonSelected'); } if (!$("#"+inputName+"X"+inputValue).hasClass('inputRadioButtonSelected')) $("#"+inputName+"X"+inputValue).addClass('inputRadioButtonSelected'); }); } }); Please tell me how to fix it. Thank you. Edit I've found the reason. It should normally work but some of my radio inputs generated by an e-commerce software had brackets in them (e.g. id[12] ) and jQuery was parsing that. The fix is adding var inputButton = document.getElementById(inputName+"X"+inputValue); before the bind and replacing $("#"+inputName+"X"+inputValue) with $(inputButton).

    Read the article

  • Which languages support class replacement?

    - by Alix
    Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

    Read the article

  • How do I reference my MainViewController from another class?

    - by todd412
    Hi, I am building an iPhone Utility app that uses UIImageView to display an animation. Within the MainViewController's viewDidLoad() method, I am creating an instance of a CustomClass, and then setting up the animations: - (void)viewDidLoad { [super viewDidLoad]; cc = [CustomClass new]; NSArray * imageArray = [[NSArray alloc] initWithObjects: [UIImage imageNamed:@"image-1-off.jpg"], [UIImage imageNamed:@"image-2-off.jpg"], [UIImage imageNamed:@"image-3-off.jpg"], [UIImage imageNamed:@"image-4-off.jpg"], nil]; offSequence = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, 320, 480)]; offSequence.animationImages = imageArray; offSequence.animationDuration = .8; offSequence.contentMode = UIViewContentModeBottomLeft; [self.view addSubview:offSequence]; [offSequence startAnimating]; } That works fine. However, I would like to be able to move all the above code that sets up the UIImageView into my CustomClass. The problem is in the second to last line: [self.view addSubview:offSequence]; I basically need to replace 'self' with a reference to the MainControllerView, so I can call addSubview from within my CustomClass. I tried creating an instance var of CustomClass called mvc and a setter method that takes a reference to the MainViewController as an argument as such: - (void) setMainViewController: (MainViewController *) the_mvc { mvc = the_mvc; } And then I called it within MainViewController like so: [cc setMainController:MainViewController:self]; But this yields all sorts of errors which I can post here, but it strikes me that I may be overcomplicating this. Is there an easier way to reference the MainViewController that instanatiated my CustomClass?

    Read the article

  • Dice Emulation - ImageView

    - by Michelle Harris
    I am trying to emulate dice using ImageView. When I click the button, nothing seems to happen. I have hard coded this example to replace the image with imageView4 for debugging purposes (I was making sure the random wasn't fail). Can anyone point out what I am doing wrong? I am new to Java, Eclipse and Android so I'm sure I've probably made more than one mistake. Java: import java.util.Random; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.Spinner; import android.widget.Toast; public class Yahtzee4Activity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner s = (Spinner) findViewById(R.id.spinner); ArrayAdapter adapter = ArrayAdapter.createFromResource( this, R.array.score_types, android.R.layout.simple_spinner_dropdown_item); adapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s.setAdapter(adapter); } public void onMyButtonClick(View view) { ImageView imageView1 = new ImageView(this); Random rand = new Random(); int rndInt = 4; //rand.nextInt(6) + 1; // n = the number of images, that start at index 1 String imgName = "die" + rndInt; int id = getResources().getIdentifier(imgName, "drawable", getPackageName()); imageView1.setImageResource(id); } } XML for the button: <Button android:id="@+id/button_roll" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/roll" android:onClick="onMyButtonClick" />

    Read the article

  • performSelector:withObject:afterDelay: not working from scrollViewDidZoom

    - by oldbeamer
    Hi all, I feel like I should know this but I've been stumped for hours now and I've run out of ideas. The theory is simple, the user manipulates the zoom and positioning in a scrollview using a pinch. If they hold that pinch for a short period of time then the scrollview records the zoom level and content offsets. So I thought I'd start a performSelector:withObject:withDelay on the scrollViewDidZoom delegate method. If it expires then I record the settings. I delete the scheduled call every time scrollViewDidZoom is called and when the pinch gesture finishes. This is what I have: - (void)scrollViewDidZoom:(UIScrollView *)scrollView{ NSLog(@"resetting timer"); [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(positionLock) object:nil]; [self performSelector:@selector(positionLock) withObject:nil afterDelay:0.4]; } -(void)positionLock{ NSLog(@"position locked "); } - (void)scrollViewDidEndZooming:(UIScrollView *)scrollView withView:(UIView *)view atScale:(float)scale{ NSLog(@"deleting timer"); [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(positionLock) object:nil]; } This is the output: 2010-05-19 22:43:01.931 resetting timer 2010-05-19 22:43:01.964 resetting timer 2010-05-19 22:43:02.231 resetting timer 2010-05-19 22:43:02.253 resetting timer 2010-05-19 22:43:02.269 resetting timer 2010-05-19 22:43:02.298 resetting timer 2010-05-19 22:43:05.399 deleting timer As you can see the delay between the last and second last events should have been more than enough for the delayed selector call to execute. If I replace performSelector:withObject:withDelay with plain old performSelector: I get this: 2010-05-19 23:08:30.333 resetting timer 2010-05-19 23:08:30.333 position locked 2010-05-19 23:08:30.366 resetting timer 2010-05-19 23:08:30.367 position locked 2010-05-19 23:08:30.688 deleting timer Which isn't what I want but serves to show that it's only the delay that's causing it to not function, not something to do with the selector not being declared in the header, being misspelt or any other reason. Any ideas as to why it's not working?

    Read the article

  • jQuery dynamic css loading weired behavior

    - by jimpsr
    The app I am working on requires dynamic loading of css and js, right now the solution is as follows: myapp.loadCss = function(css){ $("head").append("<link>"); cssDom = $("head").children(":last"); cssDom.attr({rel: "stylesheet", type: "text/css", href: css }); } myapp.loadJs = funciton(js){ ... //$.ajax call is used in synchronized mode to make sure the js is fully loaded } } When some widgets need to be load, the usual call with be myapp.loadCss('/widgets/widget1/css/example.css'); myapp.loadJs('/wiggets/widget1/js/example.js'); The weired thing is that once a while (1 out of 10 or 20), the newly created dom elements from example.js will not be able to get its css from example.css, it seems however my loadCss method does not load the css in a synchronized mode? I have tried to replace my loadCss with the the following code: myapp.loadCss(css){ $('<link href="' + css + '" rel="stylesheet" type="text/css" />').appendTo($('head')); } It seems to be OK then (I refreshed the webpage a hundred times for verification :-( ) But unfortunately this method failed in IE(IE7, not tested in IE6, 8) Is there any better solution for this?

    Read the article

  • Regular expression to match HTML table row ( <tr> ) NOT containing a specific value

    - by user1821136
    I'm using Notepad++ to clean up a long and messy HTML table. I'm trying to use regular expressions even if I'm a total noob. :) I need to remove all the table rows that doesn't contain a specific value (may I call that substring?). After having all the file contents unwrapped, I've been able to use the following regular expression to select, one by one, every table row with all its contents: <tr>.+?</tr> How can I improve the regular expression in order to select and replace only table rows containing, somewhere inside a part of them, that defined substring? I don't know if this does matter but the structure of every table row is the following (I've put there every HTML tag, the dots stand for standard content/values) <tr> <td> ... </td> <td> ... </td> <td> <a sfref="..." href="...">!! SUBSTRING I HAVE TO MATCH HERE !!</a> </td> <td> <img /> </td> <td> ... </td> <td> ... </td> <td> ... </td> <td> ... </td> </tr> Thanks in advance for your help!

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • jQuery cycle floats on top of other content

    - by Angie Dubis
    I tried to replace my Flash video with a jQuery cycle. The cycle works, but the images will not stay in the editable region I placed them in. Instead they are floating on top of other content. Any ideas? This is happening on the home page of massageeducator.com There are 2 cycles on the page. “Slideshow1” and “slideshow2”. “slideshow1” works perfectly. The only thing I did differently was set up “slideshow2” as a library item since it will appear on every page, but added function code manually. I tried adding code and images via the template and had the same issue. I also tried adding both the function code and slideshow to each page instead of library item - same problem. I have both slide shows pointing to the same jquery.cycle.lite.1.0.js. Should I rename this .js file and have each cycle point to a different file? I am new to jQuery so any help is appreciated. I can't seem to post my code due to the spam filters in here!

    Read the article

  • Generate syntax tree for simple math operations

    - by M28
    I am trying to generate a syntax tree, for a given string with simple math operators (+, -, *, /, and parenthesis). Given the string "1 + 2 * 3": It should return an array like this: ["+", [1, ["*", [2,3] ] ] ] I made a function to transform "1 + 2 * 3" in [1,"+",2,"*",3]. The problem is: I have no idea to give priority to certain operations. My code is: function isNumber(ch){ switch (ch) { case '0': case '1': case '2': case '3': case '4': case '5': case '6': case '7': case '8': case '9': case '.': return true; break; default: return false; break; } } function generateSyntaxTree(text){ if (typeof text != 'string') return []; var code = text.replace(new RegExp("[ \t\r\n\v\f]", "gm"), ""); var codeArray = []; var syntaxTree = []; // Put it in its on scope (function(){ var lastPos = 0; var wasNum = false; for (var i = 0; i < code.length; i++) { var cChar = code[i]; if (isNumber(cChar)) { if (!wasNum) { if (i != 0) { codeArray.push(code.slice(lastPos, i)); } lastPos = i; wasNum = true; } } else { if (wasNum) { var n = Number(code.slice(lastPos, i)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } wasNum = false; lastPos = i; } } } if (wasNum) { var n = Number(code.slice(lastPos, code.length)); if (isNaN(n)) { throw new Error("Invalid Number"); return []; } else { codeArray.push(n); } } })(); // At this moment, codeArray = [1,"+",2,"*",3] return syntaxTree; } alert('Returned: ' + generateSyntaxTree("1 + 2 * 3"));

    Read the article

  • Changing where a resource is pulled during runtime?

    - by Brandon
    I have a website that goes out to multiple clients. Sometimes a client will insist on minor changes. For reasons beyond my control, I have to comply no matter how minor the request. Usually this isn't a problem, I would just create a client specific version of the user control or page and overwrite the default one during build time or make a configuration setting to handle it. Now that I am localizing the site, I'm curious about the best way to go about making minor wording changes. Lets say I have a resource file called Resources.resx that has 300 resources in it. It has a resource called Continue. English value is "Continue", the French value is "Continuez". Now one client, for whatever reason, wants it to say "Next" and "Après" and the others want to keep it the same. What is the best way to accomodate a request like this? (This is just a simple example). The only two ways I can think of is to Create another Resources.resx specific to the client, and replace the .dll during build time. Since I'd be completely replacing the dll, the new resource file would have to contain all 300 strings. The obvious problem being that I now have 2 resource files, each with 300 strings to maintain. Create a custom user control/page and change it to use a custom resource file. e.g. SignIn.ascx would be replaced during the build and it would pull its resources from ClientName.resx instead of Resources.resx. Are there any other things I could try? Is there any way to change it so that the application will always look in a ClientResources.resx file for the overridden values before actually look at the specified resource file?

    Read the article

  • Alternative or succesor to GDBM

    - by Anon Guy
    We a have a GDBM key-value database as the backend to a load-balanced web-facing application that is in implemented in C++. The data served by the application has grown very large, so our admins have moved the GDBM files from "local" storage (on the webservers, or very close by) to a large, shared, remote, NFS-mounted filesystem. This has affected performance. Our performance tests (in a test environment) show page load times jumping from hundreds of milliseconds (for local disk) to several seconds (over NFS, local network), and sometimes getting as high as 30 seconds. I believe a large part of the problem is that the application makes lots of random reads from the GDBM files, and that these are slow over NFS, and this will be even worse in production (where the front-end and back-end have even more network hardware between them) and as our database gets even bigger. While this is not a critical application, I would like to improve performance, and have some resources available, including the application developer time and Unix admins. My main constraint is time only have the resources for a few weeks. As I see it, my options are: Improve NFS performance by tuning parameters. My instinct is we wont get much out of this, but I have been wrong before, and I don't really know very much about NFS tuning. Move to a different key-value database, such as memcachedb or Tokyo Cabinet. Replace NFS with some other protocol (iSCSI has been mentioned, but i am not familiar with it). How should I approach this problem?

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

  • Changing default compiler in Linux, using SCons

    - by ereOn
    On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

    Read the article

  • sql server mdf file database attachment

    - by jnsohnumr
    hello all i'm having a bear of a time getting visual studio 2010 (ultimate i think) to properly attach to my database. it was moved from original spot to #MYAPP#/#MYAPP#.Web/App_Data/#MDF_FILE#.mdf. I have three instances of sql server running on this machine. i have tried to replace the old mdf file with my new one and cannot get the connectionstring right for it. what i'm really wanting to do is to just open some DB instance, run a DB create script. Then I can have a DB that was generated via my edmx (generate database from model) in silverlight business application (c#) right now, when i go to server explorer in VS, choose add new connection, choose MS SQL Server Database FIle (SqlClient), choose my file location (app_data directory), use windows authentication, and hit the Test Connection button I get the following error: Unable to open the physical file "". Operating system error 5: "5(Access Denied.)". An attempt to attach to an auto-named database for file"" failed. A database with the same name exists, or specified file cannot be opened, or it is located on UNC share. The mdf file was created on the same machine by connecting to (local) on the sql server management studio, getting a new query, pasting in the SQL from the generated ddl file, adding a CREATE DATABASE [NcrCarDatabase]; GO before the pasted SQL, and executing the query. I then disconnected from the DB in management studio, closed management studio, navigated to the DATA directory for that instance, and copying the mdf and ldf files to my application's app_data folder. I am then trying to connect to the same file inside visual studio. I hope that gives more clarity to my problems :). Connection string is: Data Source=.\SQLEXPRESS;AttachDbFilename=C:\SourceCode\NcrCarDatabase\NcrCarDatabase.Web\App_Data\NcrCarDatabase.mdf;Integrated Security=True;Connect Timeout=30;User Instance=True

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

< Previous Page | 245 246 247 248 249 250 251 252 253 254 255 256  | Next Page >