Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 250/306 | < Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • Manually Trigger or Prevent Javascript Lazy Loading in Website from Bookmarklet

    - by stwhite
    One of the problems with using a bookmarklet for grabbing images on a page is that if a website uses lazy loading, the bookmarklet won't detect the image because it will have a placeholder, e.g. "grey.gif" and not the actual source of the image. Javascript on page load, is run to replace these urls. I'm looking for a solution to retrieve those images that are not being displayed by either triggering or preventing Lazy Loading from running. This bookmarklet isn't limited to one specific domain. So far some ideas I've had are: Ping the domain and retrieve the page html if no images are found the first time around: Problem: this then requires parsing the actual html. Problem: with lazy loading, a few images will always show, just none below the fold. Scroll page to initiate lazy loading when bookmarklet is clicked, then scroll back to top. Trigger Lazy Loading from inside bookmarklet using script. Lazy Loader adds the "original" attribute, potentially could check if attribute exists w/ value. Problem: ???

    Read the article

  • What shall be the code in xaml which makes a particular image to act as a button?

    - by Abhi
    Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

    Read the article

  • Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

    - by Alexei Andreev
    So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

    Read the article

  • Writing csv file in asp.net

    - by Keith
    Hello, I'm trying to export data to a csv file, as there are chinese characters in the data i had to use unicode.. but after adding the preamble for unicode, the commas are not recognized as delimiters and all data are now written to the first column. I'm not sure what is wrong. Below is my code which i wrote in a .ashx file. DataView priceQuery = (DataView)context.Session["priceQuery"]; String fundName = priceQuery.Table.Rows[0][0].ToString().Trim().Replace(' ', '_'); context.Response.Clear(); context.Response.ClearContent(); context.Response.ClearHeaders(); context.Response.ContentType = "text/csv"; context.Response.ContentEncoding = System.Text.Encoding.Unicode; context.Response.AddHeader("Content-Disposition", "attachment; filename=" + fundName + ".csv"); context.Response.BinaryWrite(System.Text.Encoding.Unicode.GetPreamble()); String output = fundName + "\n"; output += "Price, Date" + "\n"; foreach (DataRow row in priceQuery.Table.Rows) { string price = row[2].ToString(); string date = ((DateTime)row[1]).ToString("dd-MMM-yy"); output += price + "," + date + "\n"; } context.Response.Write(output);

    Read the article

  • Powershell finding services using a cmdlet dll

    - by bartonm
    I need to upgrade a dll assemblies, written in C#, in our installation. Before I replace the DLL file, I want to check if the file has a lock and if so display a message. How do I implement this in powershell? I was thinking iterate through Get-Process checking dependencies. Solved. I iterated through list looking a file path match. function IsCaradigmPowershellDLLFree() { # The list of DLLs to check for locks by running processes. $DllsToCheckForLocks = "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.dll", "$env:ProgramFiles\Caradigm Platform\System 3.0\Platform\PowerShell\Caradigm.Platform.Powershell.InternalPlatformSetup.dll"; # Assume true, then check all process dependencies $result = $true; # Iterate through each process and check module dependencies foreach ($p in Get-Process) { # Iterate through each dll used in a given process foreach ($m in Get-Process -Name $p.ProcessName -Module -ErrorAction SilentlyContinue) { # Check if dll dependency match any DLLs in list foreach ($dll in $DllsToCheckForLocks) { # Compare the fully-qualified file paths, # if there's a match then a lock exists. if ( ($m.FileName.CompareTo($dll) -eq 0) ) { $pName = $p.ProcessName.ToString() Write-Error "$dll is locked by $pName. This dll must be have zero locked prior to upgrade. Stop this service to release this lock on $m1." $result = $false; } } } } return $result; }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • PostgreSQL: return select count(*) from old_ids;

    - by Alexander Farber
    Hello, please help me with 1 more PL/pgSQL question. I have a PHP-script run as daily cronjob and deleting old records from 1 main table and few further tables referencing its "id" column: create or replace function quincytrack_clean() returns integer as $BODY$ begin create temp table old_ids (id varchar(20)) on commit drop; insert into old_ids select id from quincytrack where age(QDATETIME) > interval '30 days'; delete from hide_id where id in (select id from old_ids); delete from related_mks where id in (select id from old_ids); delete from related_cl where id in (select id from old_ids); delete from related_comment where id in (select id from old_ids); delete from quincytrack where id in (select id from old_ids); return select count(*) from old_ids; end; $BODY$ language plpgsql; And here is how I call it from the PHP script: $sth = $pg->prepare('select quincytrack_clean()'); $sth->execute(); if ($row = $sth->fetch(PDO::FETCH_ASSOC)) printf("removed %u old rows\n", $row['count']); Why do I get the following error? SQLSTATE[42601]: Syntax error: 7 ERROR: syntax error at or near "select" at character 9 QUERY: SELECT select count(*) from old_ids CONTEXT: SQL statement in PL/PgSQL function "quincytrack_clean" near line 23 Thank you! Alex

    Read the article

  • Trying to use jquery ui in google chrome extension in the content level

    - by user135697
    The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

    Read the article

  • Calc_Anniversary Function with a Loop

    - by Rachel Ann Arndt
    Name: Calc_Anniversary Input: Pay_Date, Hire_Date, Termination_Date Output: "Y" if is the anniversary of the employee's Hire_Date, "N" if it is not, and "T" if he has been terminated before his anniversary. Description: Create local variables to hold the month and day of the employee's Date_of_Hire, Termination_Date, and of the processing date using the TO_CHAR function. First check to see if he was terminated before his anniversary. The anniversary could be on any day during the pay period, so there will be a loop to check all 14 days in the pay period to see if one was his anniversary. CREATE OR replace FUNCTION Calc_anniversary( incoming_anniversary_date IN VARCHAR2) RETURN BOOLEAN IS hiredate VARCHAR2(20); terminationdate VARCHAR(20); employeeid VARCHAR2(38); paydate NUMBER := 0; BEGIN SELECT Count(arndt_raw_time_sheet_data.pay_date) INTO paydate FROM arndt_raw_time_sheet_data; WHILE paydate <= 14 LOOP SELECT To_char(employee_id, '999'), To_char(hire_date, 'DD-MON'), To_char(termination_date, 'DD-MON') INTO employeeid, hiredate, terminationdate FROM employees, time_sheet WHERE employees.employee_id = time_sheet.employee_id AND paydate = pay_date; IF terminationdate > hiredate THEN RETURN 'T'; ELSE IF To_char(SYSDATE, 'DD-MON') = To_char(hiredate, 'DD-MON')THEN RETURN 'Y'; ELSE RETURN 'N'; END IF; END IF; paydate := paydate + 1; END LOOP; END; I need help with the loop..

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • Set .aspx page title to that of an Eval

    - by user1860529
    I am trying to use an <%# Eval("name") %> to be the title of my page. I can't seem to figure out any solutions online. I have tried the other StackOverflow question but that did now work either. The page is a bio.aspx and on the site it is displayed as bio.aspx?id=123 so the page title needs to vary depending on the ID. I figured I could just use the Eval("name") but no luck yet. I currently am using JavaScript: window.onload = function() { document.title = '<%# Eval("name") %> | Title Line'; } This works, but it still leaves the title tags empty, and it's kind of spammy. Here is the codebehind: using System; using System.Data; using System.Configuration; using System.Collections; using System.Web; using System.Web.Security; using System.Web.UI; using System.Web.UI.WebControls; using System.Web.UI.WebControls.WebParts; using System.Web.UI.HtmlControls; public partial class DoctorBio : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { Page.Title = "Your Page Title"; HtmlMeta metaDescription = new HtmlMeta(); metaDescription.Name = "description"; metaDescription.Content = "brief description"; Page.Header.Controls.Add(metaDescription); HtmlMeta metaKeywords = new HtmlMeta(); metaKeywords.Name = "keywords"; metaKeywords.Content = "keywords, keywords"; Page.Header.Controls.Add(metaKeywords); } protected void SetPageTitle(object title) { this.Title = title.ToString(); } protected string ReplaceLineBreaks(object text) { string newText = text as string; if (newText == null) { return string.Empty; } return newText.Replace("\r\n", "<br />"); } }

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • Creating a three level ASP.NET menu with SiteMap, how do i do it?

    - by user270399
    I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

  • Starting Beyond Compare from the Command Line

    - by Logan
    I have Beyond Compare 3 installed at; "C:\Program Files\Beyond Compare 3\BCompare.exe" and Cygwin; "C:\Cygwin\bin\bash.exe" What I would like is to be able to use a command such as; diff <file1> <file2> into the Cygwin shell and to have the shell fork a process opening the two files in beyond compare. I looked at the Beyond Compare Support Page but I'm afraid It was too brief for me. I tried copying the text verbatim (apart from path to executable) to no avail; Instead of using a batch file, create a file named "bc.sh" with the following line: "$(cygpath 'C:\Progra~1\Beyond~1\bcomp.exe')" `cygpath -w "$6"` `cygpath -w "$7"` /title1="$3" /title2="$5" /readonly Was I supposed to replace cygpath? I get a 'Command not found' error when I enter the name of the script on the command line. gavina@whwgavina1 /cygdrive $ "C:\Documents and Settings\gavina\Desktop\bc.sh" bash: C:\Documents and Settings\gavina\Desktop\bc.sh: command not found Does anyone have Beyond Compare working as I have described? Is this even possible in a Windows environment? Thanks in advance!

    Read the article

  • How do I make custom functions chain-able with jQuery's?

    - by sergio
    I need a "callfront" or "precall" (the opposite of "callback" ¿?) to add in MANY places before an animation occurs in an existing plugin, To be used like e.g. $(some_unpredictable_obj).preFunct().animate(… The problem is, as I said they are MANY places, and all of them are different animations, on different objects. I can TELL where all of them occur, but I don't want to add over and over the same code. I actually have to add both a function before and after those animations, but I think I can use the callback for all of them. In a perfect world, I'd like to replace every animate(property, duration) by preFunct().animate(property,duration).postFunct() preFunct and postFunct don't need parameters, since they are always the same action, on the same object. This could be an amazing addition to "jQuery" (an easy way to jQuerize custom functions to be added to the normal chain (without messing with queues) I found this example but it will act on the applied element, and I don't want that because, as I said above, all the original animations to be added to are on different elements. I also found jQuery.timing, but it looks cooler the chain-able function :) Thanks.

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Sharing same vector control between different places

    - by Alexander K
    Hi everyone, I'm trying to implement the following: I have an Items Manager, that has an Item class inside. Item class can store two possible visual representations of it - BitmapImage(bitmap) and UserControl(vector). Then later, in the game, I need to share the same image or vector control between all possible places it takes place. For example, consider 10 trees on the map, and all point to the same vector control. Or in some cases this can be bitmap image source. So, the problem is that BitmapImage source can be easily shared in the application by multiple UIElements. However, when I try to share vector control, it fails, and says Child Element is already a Child element of another control. I want to know how to organize this in the best way. For example replace UserControl with other type of control, or storage, however I need to be sure it supports Storyboard animations inside. The code looks like this: if (bi.item.BitmapSource != null) { Image previewImage = new Image(); previewImage.Source = bi.item.BitmapSource; itemPane.ItemPreviewCanvas.Children.Add(previewImage); } else if (bi.item.VectorSource != null) { UserControl previewControl = bi.item.VectorSource; itemPane.ItemPreviewCanvas.Children.Add(previewControl); } Thanks in advance

    Read the article

  • Exporting emails from outlook programtically with vba

    - by David
    I'm using this script to export email from outlook. My question is how do I export the body of the email without the html formatting ? Sub SaveItemsToExcel() On Error GoTo ErrorHandlerExit Dim oNameSpace As Outlook.NameSpace Dim oFolder As Outlook.MAPIFolder Dim objFS As Scripting.FileSystemObject Dim objOutputFile As Scripting.TextStream Set objFS = New Scripting.FileSystemObject Set objOutputFile = objFS.OpenTextFile("C:\Temp\Export.csv", ForWriting, True) Set oNameSpace = Application.GetNamespace("MAPI") Set oFolder = oNameSpace.PickFolder If oFolder Is Nothing Then GoTo ErrorHandlerExit End If If oFolder.DefaultItemType <> olMailItem Then MsgBox "Folder does not contain mail messages" GoTo ErrorHandlerExit End If objOutputFile.WriteLine "From,Subject,Recived, Body" ProcessFolderItems oFolder, objOutputFile objOutputFile.Close Set oFolder = Nothing Set oNameSpace = Nothing Set objOutputFile = Nothing Set objFS = Nothing ErrorHandlerExit: Exit Sub End Sub Sub ProcessFolderItems(oParentFolder As Outlook.MAPIFolder, ByRef objOutputFile As Scripting.TextStream) Dim oCount As Integer Dim oMail As Outlook.MailItem Dim oFolder As Outlook.MAPIFolder oCount = oParentFolder.Items.Count For Each oMail In oParentFolder.Items If oMail.Class = olMail Then objOutputFile.WriteLine oMail.SenderEmailAddress & "," & Replace(oMail.Subject, ",", "") & "," & oMail.ReceivedTime End If Next oMail Set oMail = Nothing If (oParentFolder.Folders.Count > 0) Then For Each oFolder In oParentFolder.Folders ProcessFolderItems oFolder, objOutputFile Next End If End Sub

    Read the article

  • Streaming content to JSF UI

    - by Mark Lewis
    Hello, I was quite happy with my JSF app which read the contents of MQ messages received and supplied them to the UI like this: <rich:panel> <snip> <rich:panelMenuItem label="mylabel" action="#{MyBacking.updateCurrent}"> <f:param name="current" value="mylog.log" /> </rich:panelMenuItem> </snip> </rich:panel> <rich:panel> <a4j:outputPanel ajaxRendered="true"> <rich:insert content="#{MyBacking.log}" highlight="groovy" /> </a4j:outputPanel> </rich:panel> and in MyBacking.java private String logFile = null; ... public String updateCurrent() { FacesContext context=FacesContext.getCurrentInstance(); setCurrent((String)context.getExternalContext().getRequestParameterMap().get("current")); setLog(getCurrent()); return null; } public void setLog(String log) { sendMsg(log); msgBody = receiveMsg(moreargs); logFile = msgBody; } public String getLog() { return logFile; } until the contents of one of the messages was too big and tomcat fell over. Obviously, I thought, I need to change the way it works so that I return some form of stream so that no one object grows so big that the container dies and the content returned by successive messages is streamed to the UI as it comes in. Am I right in thinking that I can replace the work I'm doing now on a String object with a BufferedOutputStream object ie no change to the JSF code and something like this changing at the back end: private BufferedOutputStream logFile = null; public void setLog(String log) { sendMsg(args); logFile = (BufferedOutputStream) receiveMsg(moreargs); } public String getLog() { return logFile; }

    Read the article

  • Trouble with building up a string in Clojure

    - by Aki Iskandar
    Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

    Read the article

  • Python: Copying files with special characters in path

    - by erikderwikinger
    Hi is there any possibility in Python 2.5 to copy files having special chars (Japanese chars, cyrillic letters) in their path? shutil.copy cannot handle this. here is some example code: import copy, os,shutil,sys fname=os.getenv("USERPROFILE")+"\\Desktop\\testfile.txt" print fname print "type of fname: "+str(type(fname)) fname0 = unicode(fname,'mbcs') print fname0 print "type of fname0: "+str(type(fname0)) fname1 = unicodedata.normalize('NFKD', fname0).encode('cp1251','replace') print fname1 print "type of fname1: "+str(type(fname1)) fname2 = unicode(fname,'mbcs').encode(sys.stdout.encoding) print fname2 print "type of fname2: "+str(type(fname2)) shutil.copy(fname2,'C:\\') the output on a Russian Windows XP C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname0: <type 'unicode'> C:\Documents and Settings\+????????????\Desktop\testfile.txt type of fname1: <type 'str'> C:\Documents and Settings\?????????????\Desktop\testfile.txt type of fname2: <type 'str'> Traceback (most recent call last): File "C:\Test\getuserdir.py", line 23, in <module> shutil.copy(fname2,'C:\\') File "C:\Python25\lib\shutil.py", line 80, in copy copyfile(src, dst) File "C:\Python25\lib\shutil.py", line 46, in copyfile fsrc = open(src, 'rb') IOError: [Errno 2] No such file or directory: 'C:\\Documents and Settings\\\x80\ xa4\xac\xa8\xad\xa8\xe1\xe2\xe0\xa0\xe2\xae\xe0\\Desktop\\testfile.txt'

    Read the article

  • Django + jquery : getting 301

    - by llazzaro
    Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

    Read the article

  • Why is Func<T> ambiguous with Func<IEnumerable<T>>?

    - by Matt Hamilton
    This one's got me flummoxed, so I thought I'd ask here in the hope that a C# guru can explain it to me. Why does this code generate an error? class Program { static void Main(string[] args) { Foo(X); // the error is on this line } static String X() { return "Test"; } static void Foo(Func<IEnumerable<String>> x) { } static void Foo(Func<String> x) { } } The error in question: Error 1 The call is ambiguous between the following methods or properties: 'ConsoleApplication1.Program.Foo(System.Func<System.Collections.Generic.IEnumerable<string>>)' and 'ConsoleApplication1.Program.Foo(System.Func<string>)' C:\Users\mabster\AppData\Local\Temporary Projects\ConsoleApplication1\Program.cs 12 13 ConsoleApplication1 It doesn't matter what type I use - if you replace the "String" declarations with "int" in that code you'll get the same sort of error. It's like the compiler can't tell the difference between Func<T> and Func<IEnumerable<T>>. Can someone shed some light on this?

    Read the article

< Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >