Search Results

Search found 7634 results on 306 pages for 'preg replace'.

Page 250/306 | < Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >

  • prototype findElements querySelectorAll error

    - by JD
    i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

    Read the article

  • Is it possible to refer to metadata of the target from within the target implementation in MSBuild?

    - by mark
    Dear ladies and sirs. My msbuild targets file contains the following section: <ItemGroup> <Targets Include="T1"> <Project>A\B.sln"</Project> <DependsOnTargets>The targets T1 depends on</DependsOnTargets> </Targets> <Targets Include="T2"> <Project>C\D.csproj"</Project> <DependsOnTargets>The targets T2 depends on</DependsOnTargets> </Targets> ... </ItemGroup> <Target Name="T1" DependsOnTargets="The targets T1 depends on"> <MSBuild Projects="A\B.sln" Properties="Configuration=$(Configuration)" /> </Target> <Target Name="T2" DependsOnTargets="The targets T2 depends on"> <MSBuild Projects="C\D.csproj" Properties="Configuration=$(Configuration)" /> </Target> As you can see, A\B.sln appears twice: As Project metadata of T1 in the ItemGroup section. In the Target statement itself passed to the MSBuild task. I am wondering whether I can remove the second instance and replace it with the reference to the Project metadata of the target, which name is given to the Target task? Exactly the same question is asked for the (Targets.DependsOnTargets) metadata. It is mentioned twice much like the %(Targets.Project) metadata. Thanks. EDIT: I should probably describe the constraints, which must be satisfied by the solution: I want to be able to build individual projects with ease. Today I can simply execute msbuild file.proj /t:T1 to build the T1 target and I wish to keep this ability. I wish to emphasize, that some projects depend on others, so the DependsOnTargets attribute is really necessary for them.

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • Streaming content to JSF UI

    - by Mark Lewis
    Hello, I was quite happy with my JSF app which read the contents of MQ messages received and supplied them to the UI like this: <rich:panel> <snip> <rich:panelMenuItem label="mylabel" action="#{MyBacking.updateCurrent}"> <f:param name="current" value="mylog.log" /> </rich:panelMenuItem> </snip> </rich:panel> <rich:panel> <a4j:outputPanel ajaxRendered="true"> <rich:insert content="#{MyBacking.log}" highlight="groovy" /> </a4j:outputPanel> </rich:panel> and in MyBacking.java private String logFile = null; ... public String updateCurrent() { FacesContext context=FacesContext.getCurrentInstance(); setCurrent((String)context.getExternalContext().getRequestParameterMap().get("current")); setLog(getCurrent()); return null; } public void setLog(String log) { sendMsg(log); msgBody = receiveMsg(moreargs); logFile = msgBody; } public String getLog() { return logFile; } until the contents of one of the messages was too big and tomcat fell over. Obviously, I thought, I need to change the way it works so that I return some form of stream so that no one object grows so big that the container dies and the content returned by successive messages is streamed to the UI as it comes in. Am I right in thinking that I can replace the work I'm doing now on a String object with a BufferedOutputStream object ie no change to the JSF code and something like this changing at the back end: private BufferedOutputStream logFile = null; public void setLog(String log) { sendMsg(args); logFile = (BufferedOutputStream) receiveMsg(moreargs); } public String getLog() { return logFile; }

    Read the article

  • Java function changing input

    - by Doodle
    I would like to go from one number to another. For example if I started at 6 and my goal was 10 I want a function that on every pass would bring me from 6 towards 10 or if I had the number 14 and my goal was 9 it would count down from 14 towards 9.So far I have (this is written in Processing a Java Api but there is essentially no difference from regualr Java, draw is just a continuous loop) int x=100; void draw(){ x=towards(x,10); println(x); } int towards(int current ,int target){ if(current!=target){ if (current <target){ current=current+1; } else { current=current-1; } } return current; } this gives me the results I would like but I would like to have everything in side of the towards() function. When I replace X with a variable it of course resets it self to the static variable. To sum it up how can I pass a variable to a function and have that variable thats been passed change on every subsequent pass. I have looked into recursion as a solution but that of just brings me to a final solution. I can pass the count to an array but wouldn't like to do that either.

    Read the article

  • Given a typical Rails 3 environment, why am I unable to execute any tests?

    - by Tom
    I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

    Read the article

  • Writing csv file in asp.net

    - by Keith
    Hello, I'm trying to export data to a csv file, as there are chinese characters in the data i had to use unicode.. but after adding the preamble for unicode, the commas are not recognized as delimiters and all data are now written to the first column. I'm not sure what is wrong. Below is my code which i wrote in a .ashx file. DataView priceQuery = (DataView)context.Session["priceQuery"]; String fundName = priceQuery.Table.Rows[0][0].ToString().Trim().Replace(' ', '_'); context.Response.Clear(); context.Response.ClearContent(); context.Response.ClearHeaders(); context.Response.ContentType = "text/csv"; context.Response.ContentEncoding = System.Text.Encoding.Unicode; context.Response.AddHeader("Content-Disposition", "attachment; filename=" + fundName + ".csv"); context.Response.BinaryWrite(System.Text.Encoding.Unicode.GetPreamble()); String output = fundName + "\n"; output += "Price, Date" + "\n"; foreach (DataRow row in priceQuery.Table.Rows) { string price = row[2].ToString(); string date = ((DateTime)row[1]).ToString("dd-MMM-yy"); output += price + "," + date + "\n"; } context.Response.Write(output);

    Read the article

  • XAML get new width and height for Canvas

    - by Jack Navarro
    I have searched through many times but have not seen this before. Probably really simple question but can't wrap my head around it. Wrote a VSTO add-in for Excel that draws a Grid dynamically. Then launches a new window and replaces the contents of the Canvas with the generated Grid. The problem is with printing. When I call the print procedure the canvas.height and canvas.width returned is the old value prior to replacing it with the grid. Sample: string="<Grid Name=\"CanvasGrid\" xmlns=\"http://schemas.microsoft.com/winfx/2006/xaml/presentation\">..Lots of stuff..</Grid>"; // Launch new window and replace the Canvas element WpfUserControl newWindow = new WpfUserControl(); newWindow.Show(); //To test MessageBox.Show(myCanvas.ActualWidth.ToString()); //return 894 Grid testGrid = myCanvas.FindName("CanvasGrid") as Grid; MessageBox.Show("Grid " + testGrid.ActualWidth.ToString()); //return 234 StringReader stringReader = new StringReader(LssAllcChrt); XmlReader xmlReader = XmlReader.Create(stringReader); Canvas myCanvas = newWindow.FindName("GrphCnvs") as Canvas; myCanvas.Children.Clear(); myCanvas.Children.Add((UIElement)XamlReader.Load(xmlReader)); //To test MessageBox.Show(myCanvas.ActualWidth.ToString()); //return 894 but should be much larger the Grid spans all three of my screens Grid testGrid = myCanvas.FindName("CanvasGrid") as Grid; MessageBox.Show("Grid " + testGrid.ActualWidth.ToString()); //return 234 but should be much larger the Grid spans all three of my screens //Run code from WpfUserControl.cs after it loads from button click Grid testGrid = canvas.FindName("CanvasGrid") as Grid; MessageBox.Show("Grid " + testGrid.ActualWidth.ToString()); //return 234 but should be much larger the Grid spans all three of my screens So basically I have no way of telling what my new width and height are.

    Read the article

  • Matlab GUI - How to get the previous value entered from a callback function?

    - by Graham
    Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

    Read the article

  • IntelliJ Doesn't Notice Changes in Interface

    - by yar
    [I've decided to give IntelliJ another go (to replace Eclipse), since its Groovy support is supposed to be the best. But back to Java...] I have an Interface that defines a constant public static final int CHANNEL_IN = 1; and about 20 classes in my Module that implement that interface. I've decided that this constant was a bad idea so I did what I do in Eclipse: I deleted the entire line. This should cause the Project tree to light up like a Christmas tree and all classes that implement that interface and use that constant to break. Instead, this is not happening. If I don't actually double-click on the relevant classes -- which I find using grep -- the module even builds correctly (using Build - Make Module). If I double-click on a relevant class, the error is shown both in the Project Tree and in the Editor. I am not able to replicate this behavior in small tests, but in large modules it works (incorrectly) this way. Is there some relevant setting in IntelliJ for this?

    Read the article

  • is using private shared objects/variables on class level harmful ?

    - by haansi
    Hello, Thanks for your attention and time. I need your opinion on an basic architectural issue please. In page behind classes I am using a private and shared object and variables (list or just client or simplay int id) to temporary hold data coming from database or class library. This object is used temporarily to catch data and than to return, pass to some function or binding a control. 1st: Can this approach harm any way ? I couldn't analyze it but a thought was using such shared variables may replace data in it when multiple users may be sending request at a time? 2nd: Please comment also on using such variables in BLL (to hold data coming from DAL/database). In this example every time new object of BLL class will be made. Here is sample code: public class ClientManager { Client objclient = new Client(); //Used in 1st and 2nd method List<Client> clientlist = new List<Client>();// used in 3rd and 4th method ClientRepository objclientRep = new ClientRepository(); public List<Client> GetClients() { return clientlist = objclientRep.GetClients(); } public List<Client> SearchClients(string Keyword) { return clientlist = objclientRep.SearchClients(Keyword); } public Client GetaClient(int ClientId) { return objclient = objclientRep.GetaClient(ClientId); } public Client GetClientDetailForConfirmOrder(int UserId) { return objclientRep.GetClientDetailForConfirmOrder(UserId); } } I am really thankful to you for sparing time and paying kind attention.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to set HTMLField's widget's height in Admin?

    - by Georgie Porgie
    I have a HTMLField in a model as it's the laziest way to utilize tinymce widget in Admin. But the problem is that the textarea field doesn't have "rows" property set. So the textarea doesn't have enough height comfortable enough for editing in Admin. Is there any way to set the height of HTMLField without defining a ModelAdmin class? Update: I solved the problem by using the following code: def create_mce_formfield(db_field): return db_field.formfield(widget = TinyMCE( attrs = {'cols': 80, 'rows': 30}, mce_attrs = { 'external_link_list_url': reverse('tinymce.views.flatpages_link_list'), 'plugin_preview_pageurl': reverse('tinymce-preview', args= ('tinymce',)), 'plugins': "safari,pagebreak,style,layer,table,save,advhr,advimage,advlink,emotions,iespell,inlinepopups,insertdatetime,preview,media,searchreplace,print,contextmenu,paste,directionality,fullscreen,noneditable,visualchars,nonbreaking,xhtmlxtras,template", 'theme_advanced_buttons1': "save,newdocument,|,bold,italic,underline,strikethrough,|,justifyleft,justifycenter,justifyright,justifyfull,styleselect,formatselect,fontselect,fontsizeselect", 'theme_advanced_buttons2': "cut,copy,paste,pastetext,pasteword,|,search,replace,|,bullist,numlist,|,outdent,indent,blockquote,|,undo,redo,|,link,unlink,anchor,image,cleanup,help,code,|,insertdate,inserttime,preview,|,forecolor,backcolor", 'theme_advanced_buttons3': "tablecontrols,|,hr,removeformat,visualaid,|,sub,sup,|,charmap,emotions,iespell,media,advhr,|,print,|,ltr,rtl,|,fullscreen", 'theme_advanced_buttons4': "insertlayer,moveforward,movebackward,absolute,|,styleprops,|,cite,abbr,acronym,del,ins,attribs,|,visualchars,nonbreaking,template,pagebreak", 'theme_advanced_toolbar_location': "top", 'theme_advanced_toolbar_align': "left", 'theme_advanced_statusbar_location': "bottom", 'theme_advanced_resizing': True, 'extended_valid_elements': "iframe[src|title|width|height|allowfullscreen|frameborder|webkitAllowFullScreen|mozallowfullscreen|allowFullScreen]", }, )) class TinyMCEFlatPageAdmin(FlatPageAdmin): def formfield_for_dbfield(self, db_field, **kwargs): if db_field.name == 'content': return create_mce_formfield(db_field) return super(TinyMCEFlatPageAdmin, self).formfield_for_dbfield(db_field, **kwargs)

    Read the article

  • Calc_Anniversary Function with a Loop

    - by Rachel Ann Arndt
    Name: Calc_Anniversary Input: Pay_Date, Hire_Date, Termination_Date Output: "Y" if is the anniversary of the employee's Hire_Date, "N" if it is not, and "T" if he has been terminated before his anniversary. Description: Create local variables to hold the month and day of the employee's Date_of_Hire, Termination_Date, and of the processing date using the TO_CHAR function. First check to see if he was terminated before his anniversary. The anniversary could be on any day during the pay period, so there will be a loop to check all 14 days in the pay period to see if one was his anniversary. CREATE OR replace FUNCTION Calc_anniversary( incoming_anniversary_date IN VARCHAR2) RETURN BOOLEAN IS hiredate VARCHAR2(20); terminationdate VARCHAR(20); employeeid VARCHAR2(38); paydate NUMBER := 0; BEGIN SELECT Count(arndt_raw_time_sheet_data.pay_date) INTO paydate FROM arndt_raw_time_sheet_data; WHILE paydate <= 14 LOOP SELECT To_char(employee_id, '999'), To_char(hire_date, 'DD-MON'), To_char(termination_date, 'DD-MON') INTO employeeid, hiredate, terminationdate FROM employees, time_sheet WHERE employees.employee_id = time_sheet.employee_id AND paydate = pay_date; IF terminationdate > hiredate THEN RETURN 'T'; ELSE IF To_char(SYSDATE, 'DD-MON') = To_char(hiredate, 'DD-MON')THEN RETURN 'Y'; ELSE RETURN 'N'; END IF; END IF; paydate := paydate + 1; END LOOP; END; I need help with the loop..

    Read the article

  • Alternative to using c:out to prevent XSS

    - by lynxforest
    I'm working on preventing cross site scripting (XSS) in a Java, Spring based, Web application. I have already implemented a servlet filter similar to this example http://greatwebguy.com/programming/java/simple-cross-site-scripting-xss-servlet-filter/ which sanitizes all the input into the application. As an extra security measure I would like to also sanitize all output of the application in all JSPs. I have done some research to see how this could be done and found two complementary options. One of them is the use of Spring's defaultHtmlEscape attribute. This was very easy to implement (a few lines in web.xml), and it works great when your output is going through one of spring's tags (ie: message, or form tags). The other option I have found is to not directly use EL expressions such as ${...} and instead use <c:out value="${...}" /> That second approach works perfectly, however due to the size of the application I am working on (200+ JSP files). It is a very cumbersome task to have to replace all inappropriate uses of EL expressions with the c:out tag. Also it would become a cumbersome task in the future to make sure all developers stick to this convention of using the c:out tag (not to mention, how much more unreadable the code would be). Is there alternative way to escape the output of EL expressions that would require fewer code modifications? Thank you in advance.

    Read the article

  • Manually Trigger or Prevent Javascript Lazy Loading in Website from Bookmarklet

    - by stwhite
    One of the problems with using a bookmarklet for grabbing images on a page is that if a website uses lazy loading, the bookmarklet won't detect the image because it will have a placeholder, e.g. "grey.gif" and not the actual source of the image. Javascript on page load, is run to replace these urls. I'm looking for a solution to retrieve those images that are not being displayed by either triggering or preventing Lazy Loading from running. This bookmarklet isn't limited to one specific domain. So far some ideas I've had are: Ping the domain and retrieve the page html if no images are found the first time around: Problem: this then requires parsing the actual html. Problem: with lazy loading, a few images will always show, just none below the fold. Scroll page to initiate lazy loading when bookmarklet is clicked, then scroll back to top. Trigger Lazy Loading from inside bookmarklet using script. Lazy Loader adds the "original" attribute, potentially could check if attribute exists w/ value. Problem: ???

    Read the article

  • Django + jquery : getting 301

    - by llazzaro
    Hello, I have tabs that calls via javascript urls of django to complete the "container" But i am getting 301, any idea why this is happening? Server misconfiguration? urls.py urlpatterns = patterns('', (r'^admin/', include(admin.site.urls)), (r'^list/', 'carsproj.cars.views.list'), ) view def list(request): if request.is_ajax(): return render_to_response('templates/generic_list.html', { 'items' : Cars.objects.all(), 'name' : 'List - Cars' }, context_instance = RequestContext(request)) javascript the_tabs.click(function(e){ var element = $(this); if(element.find('#overLine').length) return false; var bg = element.attr('class').replace('tab ',''); $('#overLine').remove(); $('<div>',{ id:'overLine', css:{ display:'none', width:element.outerWidth()-2, background:topLineColor[bg] || 'white' }}).appendTo(element).fadeIn('slow'); if(!element.data('cache')) { $('#contentHolder').html('<img src="/media/img/ajax_preloader.gif" width="64" height="64" class="preloader" />'); $.get(element.data('page'),function(msg){ $('#contentHolder').html(msg); element.data('cache',msg); }); } else $('#contentHolder').html(element.data('cache')); e.preventDefault(); }) Please tell me what more information you need, js code? template? url.py? I WILL EDIT THIS POST FOR ADD MORE DATA

    Read the article

  • is it better to test if a function is needed inside or outside of it?

    - by b0x0rz
    what is the best practice? call a function then return if you test for something, or test for something then call? i prefer the test inside of function because it makes an easier viewing of what functions are called. for example: protected void Application_BeginRequest(object sender, EventArgs e) { this.FixURLCosmetics(); } and private void FixURLCosmetics() { HttpContext context = HttpContext.Current; if (!context.Request.HttpMethod.ToString().Equals("GET", StringComparison.OrdinalIgnoreCase)) { // if not a GET method cancel url cosmetics return; }; string url = context.Request.RawUrl.ToString(); bool doRedirect = false; // remove > default.aspx if (url.EndsWith("/default.aspx", StringComparison.OrdinalIgnoreCase)) { url = url.Substring(0, url.Length - 12); doRedirect = true; } // remove > www if (url.Contains("//www")) { url = url.Replace("//www", "//"); doRedirect = true; } // redirect if necessary if (doRedirect) { context.Response.Redirect(url); } } is this good: if (!context.Request.HttpMethod.ToString().Equals("GET", StringComparison.OrdinalIgnoreCase)) { // if not a GET method cancel url cosmetics return; }; or should that test be done in Application_BeginRequest? what is better? thnx

    Read the article

  • How to paginate Django with other get variables?

    - by vagabond
    I am having problems using pagination in Django. Take the URL below as an example: http://127.0.0.1:8000/users/?sort=first_name On this page I sort a list of users by their first_name. Without a sort GET variable it defaults to sort by id. Now if I click the next link I expect the following URL: http://127.0.0.1:8000/users/?sort=first_name&page=2 Instead I lose all get variables and end up with http://127.0.0.1:8000/users/?page=2 This is a problem because the second page is sorted by id instead of first_name. If I use request.get_full_path I will eventually end up with an ugly URL: http://127.0.0.1:8000/users/?sort=first_name&page=2&page=3&page=4 What is the solution? Is there a way to access the GET variables on the template and replace the value for the page? I am using pagination as described in Django's documentation and my preference is to keep using it. The template code I am using is similar to this: {% if contacts.has_next %} <a href="?page={{ contacts.next_page_number }}">next</a> {% endif %}

    Read the article

  • Word wrap in multiline textbox after 35 characters

    - by Kanavi
    <asp:TextBox CssClass="txt" ID="TextBox1" runat="server" onkeyup="CountChars(this);" Rows="20" Columns="35" TextMode="MultiLine" Wrap="true"> </asp:TextBox> I need to implement word-wrapping in a multi-line textbox. I cannot allow users to write more then 35 chars a line. I am using the following code, which breaks at precisely the specified character on every line, cutting words in half. Can we fix this so that if there's not enough space left for a word on the current line, we move the whole word to the next line? function CountChars(ID) { var IntermediateText = ''; var FinalText = ''; var SubText = ''; var text = document.getElementById(ID.id).value; var lines = text.split("\n"); for (var i = 0; i < lines.length; i++) { IntermediateText = lines[i]; if (IntermediateText.length <= 50) { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } else { while (IntermediateText.length > 50) { SubText = IntermediateText.substring(0, 50); FinalText += SubText + "\n"; IntermediateText = IntermediateText.replace(SubText, ''); } if (IntermediateText != '') { if (lines.length - 1 == i) FinalText += IntermediateText; else FinalText += IntermediateText + "\n"; } } } document.getElementById(ID.id).value = FinalText; $('#' + ID.id).scrollTop($('#' + ID.id)[0].scrollHeight); } Edit - 1 I have to show total max 35 characters in line without specific word break and need to keep margin of two characters from the right. Again, the restriction should be for 35 characters but need space for total 37 (Just for the Visibility issue.)

    Read the article

  • Creating a three level ASP.NET menu with SiteMap, how do i do it?

    - by user270399
    I want to create a three level menu, I have got a recursive function today that works with three levels. But the thing is how do i output the third lever? Using two repeaters i have managed to get a hold of the first two levels through the ChildNodes property. But that only gives me the second level. What if a want the third level? Example code below. How do i get the third level? :) <asp:Repeater ID="FirstLevel" DataSourceID="SiteMapDataSource" runat="server" EnableViewState="false"> <ItemTemplate> <li class="top"> <a href='/About/<%#Eval("Title")%>.aspx' class="top_link"><span class="down"><%#Eval("Title")%></span><!--[if gte IE 7]><!--></a><!--<![endif]--> <asp:Repeater runat="server" ID="SecondLevel" DataSource='<%#((SiteMapNode)Container.DataItem).ChildNodes%>'> <HeaderTemplate><!--[if lte IE 6]><table><tr><td><![endif]--><ul class="sub"></HeaderTemplate> <ItemTemplate> <li> <a href='<%#((string)Eval("Url")).Replace("~", "")%>' style="text-align: left;"><%#Eval("Title")%></a> Third repeater here? </li> </ItemTemplate> <FooterTemplate></ul><!--[if lte IE 6]></td></tr></table></a><![endif]--></FooterTemplate> </asp:Repeater> </li> </ItemTemplate> </asp:Repeater>

    Read the article

  • How to get the most out of a 3 month intern?

    - by firoso
    We've got a software engineering intern coming in who's fairly competent and shows promise. There's one catch: we have him for 3 months full time and can't count on anything past that. He still has a year of school left, which is why we can't say for sure that we have him past 3 months. We have a specific project we're putting him on. How can we maximize his productivity while still giving him a positive learning experience? He wants to learn about development cycles and real-world software engineering. Anything that you think would be critical that you wish you had learned earlier? Nearly six months later: He's preformed admirably and even I have learned a lot from him. Thank you all for the input. Now I want to provide feedback to YOU! He has benefited most from sitting down and writing code. However, he has had a nasty history of bad software engineering practices which I'm trying to replace with good habits (properly finishing a method before moving on, not hacking code together, proper error channeling, etc). He has also really gained a lot by feeling involved in design decisions, even if most of the time they're related to my own design plans.

    Read the article

  • Boost multi_index_container crash in release mode

    - by Zan Lynx
    I have a program that I just changed to using a boost::multi_index_container collection. After I did that and tested my code in debug mode, I was feeling pretty good about myself. However, then I compiled a release build with NDEBUG set, and the code crashed. Not immediately, but sometimes in single-threaded tests and often in multi-threaded tests. The segmentation faults happen deep inside boost insert and rotate functions related to the index updates and they are happening because a node has NULL left and right pointers. My code looks a bit like this: struct Implementation { typedef std::pair<uint32_t, uint32_t> update_pair_type; struct watch {}; struct update {}; typedef boost::multi_index_container< update_pair_type, boost::multi_index::indexed_by< boost::multi_index::ordered_unique< boost::multi_index::tag<watch>, boost::multi_index::member<update_pair_type, uint32_t, &update_pair_type::first> >, boost::multi_index::ordered_non_unique< boost::multi_index::tag<update>, boost::multi_index::member<update_pair_type, uint32_t, &update_pair_type::second> > > > update_map_type; typedef std::vector< update_pair_type > update_list_type; update_map_type update_map; update_map_type::iterator update_hint; void register_update(uint32_t watch, uint32_t update); void do_updates(uint32_t start, uint32_t end); }; void Implementation::register_update(uint32_t watch, uint32_t update) { update_pair_type new_pair( watch_offset, update_offset ); update_hint = update_map.insert(update_hint, new_pair); if( update_hint->second != update_offset ) { bool replaced _unused_ = update_map.replace(update_hint, new_pair); assert(replaced); } }

    Read the article

  • Trouble with building up a string in Clojure

    - by Aki Iskandar
    Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

    Read the article

  • Sharing same vector control between different places

    - by Alexander K
    Hi everyone, I'm trying to implement the following: I have an Items Manager, that has an Item class inside. Item class can store two possible visual representations of it - BitmapImage(bitmap) and UserControl(vector). Then later, in the game, I need to share the same image or vector control between all possible places it takes place. For example, consider 10 trees on the map, and all point to the same vector control. Or in some cases this can be bitmap image source. So, the problem is that BitmapImage source can be easily shared in the application by multiple UIElements. However, when I try to share vector control, it fails, and says Child Element is already a Child element of another control. I want to know how to organize this in the best way. For example replace UserControl with other type of control, or storage, however I need to be sure it supports Storyboard animations inside. The code looks like this: if (bi.item.BitmapSource != null) { Image previewImage = new Image(); previewImage.Source = bi.item.BitmapSource; itemPane.ItemPreviewCanvas.Children.Add(previewImage); } else if (bi.item.VectorSource != null) { UserControl previewControl = bi.item.VectorSource; itemPane.ItemPreviewCanvas.Children.Add(previewControl); } Thanks in advance

    Read the article

< Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >