Search Results

Search found 22841 results on 914 pages for 'aspect orientated program'.

Page 252/914 | < Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >

  • Where is PostSharp.Public 1.5 DLL ?

    - by jfneis
    Fellows, I'm going crazy with looks like a really stupid problem. I'm trying to build a simple example using PostSharp as a log AOP utility. I've not installed PostSharp, and I don't want to, I want to reference the necessaries DLLs, change my .csproj and see everything working. Change the project and add references was kind of easy, byt just after adding the LogAttribute to a method I got two errors: Error 1 'Log4PostSharp.LogAttribute' is not an attribute class C:\Dev\LogWithPostsharp\LogWithPostsharpCmd\Program.cs 17 10 LogWithPostsharpCmd Error 2 The type 'PostSharp.Extensibility.MulticastAttribute' is defined in an assembly that is not referenced. You must add a reference to assembly 'PostSharp.Public, Version=1.5.0.0, Culture=neutral, PublicKeyToken=b13fd38b8f9c99d7'. C:\Dev\LogWithPostsharp\LogWithPostsharpCmd\Program.cs 18 22 LogWithPostsharpCmd The first error really looks like consequence of the second, but here is the deal: the PostSharp.Public.* simply doesn't exist in the downloaded .zip. Is there something that I'm not getting? Thank you in advance. Filipe

    Read the article

  • Port scientific software to GPU and publish it

    - by Werner
    Hi, let's say that I am a physicist and that I am the master of the universe when it comes to port salready existing oftware to GPU's with 100x or more speedups. Let's say that I find that some other scientist, which does not know how to program GPU, publishes the Open Source code in his/her website of a physical simulation program, in the field I am expert on. Let's say that I realize "I can port that code to GPU", and I suggest him, but he shows no interest. My interest here is, 1) to port it to GPU, 2) to publish this result in a scientific journal related with physics and/or computer science My question for you is 1- would you proceed here to port the code to GPU (or other new arch) and publish it? 2- how would you do it and which journal do you suggest? Thanks

    Read the article

  • Couchdb conflict resolution

    - by Sundar
    How does CouchDB handles conflicts while doing bi-directional replication? For example: Lets say there are two address book databases (in server A and B). There is a document for Jack which contains contact details of Jack. Server A and B are replicated and both have the same version of Jack document. In server A, Jack's mobile no is updated. In server B, Jack's address is updated. Now when we do bi-directional replication there is a conflict. How does couchDB handles it? If we initiate replication in a Java program, is there a way to know whether there were any conflicts from the java program?

    Read the article

  • OnExit is not entering via PostSharp in asp.net project.

    - by mark smith
    Hi there, I have setup PostSharp and it appears to be working but i don't get it entering OnExit (i have logged setup to ensure it is working) ... Its a bit tricky to configure with asp.net - or is it just me ... I am using the 1.5 new version I basically have the following in my web.config and i had to add the SearchPath otherwise it can't find my assemblies <postsharp directory="C:\Program Files\PostSharp 1.5" trace="true"> <parameters> <!--<add name="parameter-name" value="parameter-value"/>--> </parameters> <searchPath> <!-- Always add the binary folder to the search path. --> <add name="bin" value="~\bin"/> </searchPath> </postsharp> I have set tracing on but what is strange to me is that it appears to build to the temp directory, maybe this is my issue, i am unsure .. hence i do F5 ... Is it possible to name the Output directory and output file?? As you can see it is editing a DLL in the temp dir so IIS is no longer in control so it doesn't execute it ??? Confused! :-) C:\Program Files\PostSharp 1.5\postsharp.exe "/P:Output=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" "/P:IntermediateDirectory=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp " /P:CleanIntermediate=False /P:ReferenceDirectory=. /P:SignAssembly=False /P:PrivateKeyLocation= /P:ResolvedReferences= "/P:SearchPath=C:\Source Code\Visual Studio 2008\Projects\mysitemvc\mysitemvc\bin," /V /SkipAutoUpdate "C:\Program Files\PostSharp 1.5\Default.psproj" "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\before-postsharp\App_Web_04ae3ewy.dll" PostSharp 1.5 [1.5.6.627] - Copyright (c) Gael Fraiteur, 2005-2009. info PS0035: C:\Windows\Microsoft.NET\Framework\v2.0.50727\ilasm.exe "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.il" /QUIET /DLL /PDB "/RESOURCE=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.res" "/OUTPUT=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" /SUBSYSTEM=3 /FLAGS=1 /BASE=18481152 /STACK=1048576 /ALIGNMENT=512 /MDV=v2.0.50727

    Read the article

  • Linking with Boost error

    - by drhorrible
    I just downloaded and ran the boost installer for version 1.42 (from boostpro.com), and set up my project according to the getting started guide. However, when I build the program, I get this linker error: LINK : fatal error LNK1104: cannot open file 'libboost_program_options-vc90-mt-gd-1_42.lib' The build log adds this (I've replaced project-specific paths with *'s): Creating temporary file "******\Debug\RSP00001252363252.rsp" with contents [ /OUT:"*********.exe" /INCREMENTAL /LIBPATH:"C:\Program Files\boost\boost_1_42_0\lib" /MANIFEST /MANIFESTFILE:"Debug\hw6.exe.intermediate.manifest" /MANIFESTUAC:"level='asInvoker' uiAccess='false'" /DEBUG /PDB:"********\Debug\***.pdb" /SUBSYSTEM:CONSOLE /DYNAMICBASE /NXCOMPAT /MACHINE:X86 kernel32.lib user32.lib gdi32.lib winspool.lib comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib uuid.lib odbc32.lib odbccp32.lib ".\Debug\****.obj" ".\Debug\****.exe.embed.manifest.res" ] Creating command line "link.exe @********\Debug\RSP00001252363252.rsp /NOLOGO /ERRORREPORT:PROMPT" I've also emailed [email protected] (with a message very similar to this), but I thought maybe so would be faster.

    Read the article

  • Mapping between 4+1 architectural view model & UML

    - by Sadeq Dousti
    I'm a bit confused about how the 4+1 architectural view model maps to UML. Wikipedia gives the following mapping: Logical view: Class diagram, Communication diagram, Sequence diagram. Development view: Component diagram, Package diagram Process view: Activity diagram Physical view: Deployment diagram Scenarios: Use-case diagram The paper Role of UML Sequence Diagram Constructs in Object Lifecycle Concept gives the following mapping: Logical view (class diagram (CD), object diagram (OD), sequence diagram (SD), collaboration diagram (COD), state chart diagram (SCD), activity diagram (AD)) Development view (package diagram, component diagram), Process view (use case diagram, CD, OD, SD, COD, SCD, AD), Physical view (deployment diagram), and Use case view (use case diagram, OD, SD, COD, SCD, AD) which combines the four mentioned above. The web page UML 4+1 View Materials presents the following mapping: Finally, the white paper Applying 4+1 View Architecture with UML 2 gives yet another mapping: Logical view class diagrams, object diagrams, state charts, and composite structures Process view sequence diagrams, communication diagrams, activity diagrams, timing diagrams, interaction overview diagrams Development view component diagrams Physical view deployment diagram Use case view use case diagram, activity diagrams I'm sure further search will reveal other mappings as well. While various people usually have different perspectives, I don't see why this is the case here. Specially, each UML diagram describes the system from a particular aspect. So, for instance, why the "sequence diagram" is considered as describing the "logical view" of the system by one author, while another author considers it as describing the "process view"? Could you please help me clarify the confusion?

    Read the article

  • How can I flush the output of disp in Octave?

    - by Nathan Fellman
    I have a program in Octave that has a loop - running a function with various parameters, not something that I can turn into matrices. At the beginning of each iteration I print the current parameters using disp. The first times I ran it I had a brazillion warnings, and then I also got these prints. Now that I cleaned them up, I no longer see them. My guess is that they're stuck in a buffer, and I'll see them when the program ends or the buffer fills. Is there any way to force a flush of the print buffer so that I can see my prints?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • Common mistakes which lead to corrupted invariants

    - by Dave B.
    My main source of income is web development and through this I have come to enjoy the wonders of programming as my knowledge of different languages has increased over the years through work and personal play. At some point I reached a decision that my college education was not enough and that I wanted to go back to school to get a university degree in either computer science or software engineering. I have tried a number of things in my life and it took me a while before I found something that I feel is a passion and this is it. There is one aspect of this area of study that I find throws me off though. I find the formal methods of proving program correctness a challenge. It is not that I have trouble writing code correctly, I can look at an algorithm and see how it is correct or flawed but I struggle sometimes to translate this into formal definitions. I have gotten perfect or near perfect marks on every programming assignment I have done at the college level but I recently got a swath of textbooks from a guy from univeristy of waterloo and found that I have had trouble when it comes to a few of the formalisms. Well at this point its really just one thing specifically, It would really help me if some of you could provide to me some good examples of common mistakes which lead to corrupted invariants, especially in loops. I have a few software engineering and computer science textbooks but they only show how things should be. I would like to know how things go wrong so that it is easier to recognize when it happens. Its almost embarrassing to broach this subject because formalisms are really basic foundations upon which matters of substance are built. I want to overcome this now so that it does not hinder me later.

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

< Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >