Search Results

Search found 8190 results on 328 pages for 'separate'.

Page 258/328 | < Previous Page | 254 255 256 257 258 259 260 261 262 263 264 265  | Next Page >

  • Tools\addin's for formating or cleaning up xaml?

    - by cody
    I'm guessing these don't exist since I searched around for these but I'm looking for a few tools: 1) A tool that cleans up my xaml so that the properties of elements are consistent through a file. I think enforcing that consistence would make the xaml easier to read. Maybe there could be a hierarchy of what comes first but if not alphabetical might work. Example before: TextBox Name="myTextBox1" Grid.Row="3" Grid.Column="1" Margin="4" TextBox Grid.Column="1" Margin="4" Name="t2" Grid.Row="3" Example after: TextBox Name="myTextBox1" Grid.Row="3" Grid.Column="1" Margin="4" TextBox Name="t2" Grid.Row="3" Grid.Column="1" Margin="4" (note < / has been remove from the above since control seem to have issues parsing whe the after section was added) 2) Along the same lines as above, to increase readability, a tool to align properties, so from the above code example similar props would start in the same place. <TextBox Name="myTextBox1" Grid.Row="3" Grid.Column="1" Margin="4"/> <TextBox Name="t2" Grid.Row="3" Grid.Column="1" Margin="4"/> I know VS has default settings for XAML documents so props can be on one line or separate lines so maybe if there was a tool as described in (1) this would not be needed...but it would still be nice if you like your props all on one line. 3) A tool that adds X to the any of the Grid.Row values and Y to any of the Grid.Column values in the selected text. Every time I add a new row\column I have to go manually fix these. From my understanding Expression Blend can help with this but seem excessive to open Blend just to increment some numbers (and just don't grok Blend). Maybe vs2010 with the designer will help but right now I'm on VS08 and Silverlight. Any one know of any tools to help with this? Anyone planning to write something like this...I'm looking at you JetBrains and\or DevExpress. Thanks.

    Read the article

  • Ruby Design Problem for SQL Bulk Inserter

    - by crunchyt
    This is a Ruby design problem. How can I make a reusable flat file parser that can perform different data scrubbing operations per call, return the emitted results from each scrubbing operation to the caller and perform bulk SQL insertions? Now, before anyone gets narky/concerned, I have written this code already in a very unDRY fashion. Which is why I am asking any Ruby rockstars our there for some assitance. Basically, everytime I want to perform this logic, I create two nested loops, with custom processing in between, buffer each processed line to an array, and output to the DB as a bulk insert when the buffer size limit is reached. Although I have written lots of helpers, the main pattern is being copy pasted everytime. Not very DRY! Here is a Ruby/Pseudo code example of what I am repeating. lines_from_file.each do |line| line.match(/some regex/).each do |sub_str| # Process substring into useful format # EG1: Simple gsub() call # EG2: Custom function call to do complex scrubbing # and matching, emitting results to array # EG3: Loop to match opening/closing/nested brackets # or other delimiters and emit results to array end # Add processed lines to a buffer as SQL insert statement @buffer << PREPARED INSERT STATEMENT # Flush buffer when "buffer size limit reached" or "end of file" if sql_buffer_full || last_line_reached @dbc.insert(SQL INSERTS FROM BUFFER) @buffer = nil end end I am familiar with Proc/Lambda functions. However, because I want to pass two separate procs to the one function, I am not sure how to proceed. I have some idea about how to solve this, but I would really like to see what the real Rubyists suggest? Over to you. Thanks in advance :D

    Read the article

  • drupal themes: .info file: how do I add more than 1 css file / js file to my theme?

    - by egarcia
    I'm creating a new Drupal theme. Until now, I only needed to include a single css file and a single js file. So my theme.info file had something like this: stylesheets[all][] = css/style.css scripts[] = js/script.js Now I must include jquery and jquery-ui in order to use a calendar date. These come with 2 new javascript files, and 1 additonal css file that I must add to the site. The calendar input form is going to be used in all pages (on a side block) so it is ok for me to load the extra css/javascript on all pages. I think the easiest thing would be to reference them on the .info file itself. At first I tried to just put them there with separate spaces: stylesheets[all][] = css/style.css css/ui-lightness/jquery-ui-1.8.1.custom.css scripts[] = js/jquery-1.4.2.min.js js/jquery-ui-1.8.1.custom.min.js js/reservations.js I emptied drupal's cache and... none of them loaded. I then tried separating each file with a comma, and flushing the cache again. Same result. I've browsed some drupal pages, but could not find how to add several javascript/css files on one theme (they always seem to add just 1 of each). So, how do I include several css/javascript files on the .info file?

    Read the article

  • Architecture for database analytics

    - by David Cournapeau
    Hi, We have an architecture where we provide each customer Business Intelligence-like services for their website (internet merchant). Now, I need to analyze those data internally (for algorithmic improvement, performance tracking, etc...) and those are potentially quite heavy: we have up to millions of rows / customer / day, and I may want to know how many queries we had in the last month, weekly compared, etc... that is the order of billions entries if not more. The way it is currently done is quite standard: daily scripts which scan the databases, and generate big CSV files. I don't like this solutions for several reasons: as typical with those kinds of scripts, they fall into the write-once and never-touched-again category tracking things in "real-time" is necessary (we have separate toolset to query the last few hours ATM). this is slow and non-"agile" Although I have some experience in dealing with huge datasets for scientific usage, I am a complete beginner as far as traditional RDBM go. It seems that using column-oriented database for analytics could be a solution (the analytics don't need most of the data we have in the app database), but I would like to know what other options are available for this kind of issues.

    Read the article

  • Good strategy for copying a "sliding window" of data from a table?

    - by chiborg
    I have a MySQL table from a third-party application that has millions of rows and only one index - the timestamp of each entry. Now I want to do some heavy self-joins and queries on the data using fields other than the timestamp. Doing the query on the original table would bring the database to a crawl, adding indexes to the table is not an option. Additionally, I only need entries that are newer than one week. My current strategy for doing the queries efficiently is to use a separate table (aux_table) that has the necessary indexes. My questions are: Is there another way to do the queries? and if not, How do I update the data in the indexed table efficiently? So far I have found two approaches for updating aux_table: Truncate aux_table and insert the desired data from the original table. Not very efficient because all the indexes must be re-crated. Check for the biggest timestamp in aux_table and insert all entries with a greater or equal timestamp from the original table. Occasionally drop older entries. Only copying entries with greater timestamp leads to dropped entries (because of entries with same timestamp that were inserted into the original table after the last update).

    Read the article

  • Tree data in MySql database table

    - by Robert Koritnik
    I have a table that uses Adjacency list model for hierarchy storage. My most relevant columns in this table are therefore: ItemId // is auto_increment ParentId Level ParentTrail // in the form of "parentId/../parentId/itemId" then I created a before insert tigger, that populates columns Level and ParentTrail. Since the last column also includes current item's ID I had to use a trick in my trigger because auto_increment columns are not available in the before insert trigger. So I get that value from the information_schema.tables table. All works fine, until I try to write an update trigger, that would update my item and its descendants when the item changes its parent (ParentId has changed). But I can't make an update on my table inside the update trigger. All I can do is to change current record's values but not other's. I could use a separate table for hierarchy data, but that would mean that I would also have to create a view that would combine these two tables (1:1 relation) and I would like to avoid this is at all possible. Is there a way to have all these in the same table so that these fields (Level and ParetTrail) set/update themselves automagically using triggers?

    Read the article

  • How to model a mutually exclusive relationship in sql server

    - by littlechris
    Hi, I have to add functionality to an existing application and I've run into a data situation that I'm not sure how to model. I am being restricted to the creation of new tables and code. If I need to alter the existing structure I think my client may reject the proposal..although if its the only way to get it right this is what I will have to do. I have an Item table that can me link to any number of tables, and these tables may increase over time. The Item can only me linked to one other table, but the record in the other table may have many items linked to it. Examples of the tables/entities being linked to are "Person", "Vehicle", "Building", "Office". These are all separate tables. Example of Items are "Pen", "Stapler", "Cushion", "Tyre", "A4 Paper", "Plastic Bag", "Poster", "Decoration" For instance a "Poster" may be allocated to a "Person" or "Office" or "Building". In the future if they add a "Conference Room" table it may also be added to that. My intital thoughts are: Item { ID, Name } LinkedItem { ItemID, LinkedToTableName, LinkedToID } The LinkedToTableName field will then allow me to identify the correct table to link to in my code. I'm not overly happy with this solution, but I can't quite think of anything else. Please help! :) Thanks!

    Read the article

  • Beginner Question: For extract a large subset of a table from MySQL, how does Indexing, order of tab

    - by chongman
    Sorry if this is too simple, but thanks in advance for helping. This is for MySQL but might be relevant for other RDMBSs tblA has 4 columns: colA, colB, colC, mydata, A_id It has about 10^9 records, with 10^3 distinct values for colA, colB, colC. tblB has 3 columns: colA, colB, B_id It has about 10^4 records. I want all the records from tblA (except the A_id) that have a match in tblB. In other words, I want to use tblB to describe the subset that I want to extract and then extract those records from tblA. Namely: SELECT a.colA, a.colB, a.colC, a.mydata FROM tblA as a INNER JOIN tblB as b ON a.colA=b.colA a.colB=b.colB ; It's taking a really long time (more than an hour) on a newish computer (4GB, Core2Quad, ubuntu), and I just want to check my understanding of the following optimization steps. ** Suppose this is the only query I will ever run on these tables. So ignore the need to run other queries. Now my questions: 1) What indexes should I create to optimize this query? I think I just need a multiple index on (colA, colB) for both tables. I don't think I need separate indexes for colA and colB. Another stack overflow article (that I can't find) mentioned that when adding new indexes, it is slower when there are existing indexes, so that might be a reason to use the multiple index. 2) Is INNER JOIN correct? I just want results where a match is found. 3) Is it faster if I join (tblA to tblB) or the other way around, (tblB to tblA)? This previous answer says that the optimizer should take care of that. 4) Does the order of the part after ON matter? This previous answer say that the optimizer also takes care of the execution order.

    Read the article

  • SQL Server 2005 Import from Excel

    - by user327045
    I'd like to know what my best option would be to import data from an excel file on a weekly or monthly basis. At first, I thought I would use SSIS, but after much struggle with seemingly simple tasks, I'm starting to rethink my plan. Would it be better/easier to just write the SQL by hand or use the services of an SSIS package? The basic process will be as follows: A separate process will download an .xls file to a local fileshare. The xls file will have a filename like: 'myfilename MON YY'. I will need to read the month and year from the the filename, reformat it to a sql date and then query a DimDate table to find the corresponding date key. For each row (after the first 2 header rows), insert the data with the date key, unless the row is a total row, then ignore. Here are some of the issues I've been encountering with SSIS: I can parse the date string from a flat file datasource, but can't seem to do it with an excel data source. Also, once parsed, i cannot seem to convert the string to a date in order to perform the lookup for the date key. For example, I want to do something like this: select DateKey from DimDate where ActualDate = convert(datetime, '01-' + 'JAN-10', 120) but i don't think it is possible to use the 'convert' or 'datetime' keywords in an expression builder. I have been also unable to find where I can edit the SQL to ignore the first 2 rows of data. I'm very skeptical of using SSIS because it seems like a Kludgy way of doing something that can probably be accomplished more efficiently writing the SQL yourself, but I may be forced to use SSIS. Thoughts?

    Read the article

  • C++ How to read a string of text and create object of their class

    - by user1777711
    After reading a text file... The following information is available Point2D, [3, 2] Line3D, [7, 12, 3], [-9, 13, 68] Point3D, [1, 3, 8] Line2D, [5, 7], [3, 8] Point2D, [3, 2] Line3D, [7, -12, 3], [9, 13, 68] Point3D, [6, 9, 5] Point2D, [3, 2] Line3D, [70, -120, -3], [-29, 1, 268] Line3D, [25, -69, -33], [-2, -41, 58] Point3D, [6, 9, -50] The first data separate by the delimiter comma is the class name. for each of the 4 class Point2D,Line3D,Point3D,Line2D How do i like store them into relevant object base on their class means.. when it read first line Point2D, [3, 2] It will store it as Point2D object with the Data [3, 2] But the issue is what dataset should i pick, Vector, Set , Map or List I was thinking to actually create a data set then but i can't use new Point2D(); since Point2D is parent of Point3D Line2D is parent of Line3D and theres no parent class of Point2D and Line2D. how can i like create a object of them in a data set like e.g Vector so Vector[0] is of Point2D class with data [3,2] , then Vector[1] is of Line3D class with data [7, 12, 3], [-9, 13, 68] Thanks for helping.!

    Read the article

  • What is an elegant way to set up a leiningen project that requires different dependencies based on the build platform?

    - by Savanni D'Gerinel
    In order to do some multi-platform GUI development, I have just switched from GTK + Clojure (because it looks like the Java bindings for GTK never got ported to Windows) to SWT + Clojure. So far, so good in that I have gotten an uberjar built for Linux. The catch, though, is that I want to build an uberjar for Windows and I am trying to figure out a clean way to manage the project.clj file. At first, I thought I would set the classpath to point to the SWT libraries and then build the uberjar. This would require that I set a classpath to the SWT libraries before running the jar, but I would likely need a launcher script, anyway. However, leiningen seems to ignore the classpath in this instance because it always reports that Currently, project.clj looks like this for me: (defproject alyra.mana-punk/character "1.0.0-SNAPSHOT" :description "FIXME: write" :dependencies [[org.clojure/clojure "1.2.0"] [org.clojure/clojure-contrib "1.2.0"] [org.eclipse/swt-gtk-linux-x86 "3.5.2"]] :main alyra.mana-punk.character.core) The relevant line is the org.eclipse/swt-gtk-linux-x86 line. If I want to make an uberjar for Windows, I have to depend on org.eclipse/swt-win32-win32-x86, and another one for x86-64, and so on and so forth. My current solution is to simply create a separate branch for each build environment with a different project.clj. This seems kinda like using a semi to deliver a single gallon of milk, but I am using bazaar for version control, so branching and repeated integrations are easy. Maybe the better way is to have a project.linux.clj, project.win32.clj, etc, but I do not see any way to tell leiningen which project descriptor to use. What are other (preferably more elegant) ways to set up such an environment?

    Read the article

  • What is a good automated data import method for SQL Server?

    - by Joel Potter
    I'm in the process of porting some SQL Server 2005 databases to SQL Server 2008. One of these databases has an associated import application (Windows task) which uses SSIS with a DTS package to import a large dataset from an MS Access database nightly. In upgrading to SQL Server 2008, I discovered that I can't run the same console application which has been performing the imports due to the missing manageddts DLL in SQL Server 2008. It's several years old and in need of a rewrite for various reason, plus, I've been fairly unhappy with DTS in general. The original reason DTS was chosen was for speed (5 min import time compared to 30+ for ADO.NET). The format of the data to import is out of my control (the client likes Access). I would also like to be able to run the import from a machine completely separate from the server hosting SQL Server and preferably with minimal SQL features installed. Options I've considered: Creating an Access application to connect to both databases (SQL Server and Access) and perform the import (Ugh!) Revisiting ADO.NET to see if the original implementation was poorly written. Updated SSIS packages. What other technologies should I be considering for this job?

    Read the article

  • incremental way of counting quantiles for large set of data

    - by Gacek
    I need to count the quantiles for a large set of data. Let's assume we can get the data only through some portions (i.e. one row of a large matrix). To count the Q3 quantile one need to get all the portions of the data and store it somewhere, then sort it and count the quantile: List<double> allData = new List<double>(); foreach(var row in matrix) // this is only example. In fact the portions of data are not rows of some matrix { allData.AddRange(row); } allData.Sort(); double p = 0.75*allData.Count; int idQ3 = (int)Math.Ceiling(p) - 1; double Q3 = allData[idQ3]; Now, I would like to find a way of counting this without storing the data in some separate variable. The best solution would be to count some parameters od mid-results for first row and then adjust it step by step for next rows. Note: These datasets are really big (ca 5000 elements in each row) The Q3 can be estimated, it doesn't have to be an exact value. I call the portions of data "rows", but they can have different leghts! Usually it varies not so much (+/- few hundred samples) but it varies! This question is similar to this one: http://stackoverflow.com/questions/1058813/on-line-iterator-algorithms-for-estimating-statistical-median-mode-skewness But I need to count quantiles. ALso there are few articles in this topic, i.e.: http://web.cs.wpi.edu/~hofri/medsel.pdf http://portal.acm.org/citation.cfm?id=347195&dl But before I would try to implement these, I wanted to ask you if there are maybe any other, qucker ways of counting the 0.25/0.75 quantiles?

    Read the article

  • Best practice - logging events (general) and changes (database)

    - by b0x0rz
    need help with logging all activities on a site as well as database changes. requirements: * should be in database * should be easily searchable by initiator (user name / session id), event (activity type) and event parameters i can think of a database design but either it involves a lot of tables (one per event) so i can log each of the parameters of an event in a separate field OR it involves one table with generic fields (7 int numeric and 7 text types) and log everything in one table with event type field determining what parameter got written where (and hoping that i don't need more than 7 fields of a certain type, or 8 or 9 or whatever number i choose)... example of entries (the usual things): [username] login failed @datetime [username] login successful @datetime [username] changed password @datetime, estimated security of password [low/ok/high/perfect] @datetime [username] clicked result [result number] [result id] after searching for [search string] and got [number of results] @datetime [username] clicked result [result number] [result id] after searching for [search string] and got [number of results] @datetime [username] changed profile name from [old name] to [new name] @datetime [username] verified name with [credit card type] credit card @datetime datbase table [table name] purged of old entries @datetime via automated process etc... so anyone dealt with this before? any best practices / links you can share? i've seen it done with the generic solution mentioned above, but somehow that goes against what i learned from database design, but as you can see the sheer number of events that need to be trackable (each user will be able to see this info) is giving me headaches, BUT i do LOVE the one event per table solution more than the generic one. any thoughts? edit: also, is there maybe an authoritative list of such (likely) events somewhere? thnx stack overflow says: the question you're asking appears subjective and is likely to be closed. my answer: probably is subjective, but it is directly related to my issue i have with designing a database / writing my code, so i'd welcome any help. also i tried narrowing down the ideas to 2 so hopefully one of these will prevail, unless there already is an established solution for these kinds of things.

    Read the article

  • convert xml document to comma delimited (CSV) file using xslt stylesheet.

    - by Brad H
    I need some assistance converting an xml document to a CSV file using an xslt stylesheet. I am trying to use the following xsl and I can't seem to get it right. I want my comma delimited file to include column headings, followed by the data. My biggest issues are removing the final comma after the last item and inserting a carriage return so each group of data appears on a separate line. I have been using XML Notepad. <xsl:template match="/"> <xsl:element name="table"> <xsl:apply-templates select="/*/*[1]" mode="header" /> <xsl:apply-templates select="/*/*" mode="row" /> </xsl:element> </xsl:template> <xsl:template match="*" mode="header"> <xsl:element name="tr"> <xsl:apply-templates select="./*" mode="column" /> </xsl:element> </xsl:template> <xsl:template match="*" mode="row"> <xsl:element name="tr"> <xsl:apply-templates select="./*" mode="node" /> </xsl:element> </xsl:template> <xsl:template match="*" mode="column"> <xsl:element name="th"> <xsl:value-of select="translate(name(.),'qwertyuiopasdfghjklzxcvbnm_','QWERTYUIOPASDFGHJKLZXCVBNM ')" /> </xsl:element>, </xsl:template> <xsl:template match="*" mode="node"> <xsl:element name="td"> <xsl:value-of select="." /> </xsl:element>, </xsl:template>

    Read the article

  • How do I ensure a Flex dataProvider processes the data synchronously?

    - by Matt Calthrop
    I am using an component, and currently have a dataProvider working that is an ArrayCollection (have a separate question about how to make this an XML file... but I digress). Variable declaration looks like this: [Bindable] private var _dpImageList : ArrayCollection = new ArrayCollection([ {"location" : "path/to/image1.jpg"}, {"location" : "path/to/image2.jpg"}, {"location" : "path/to/image3.jpg"} ]); I then refer to like this: <s:List id="lstImages" width="100%" dataProvider="{_dpImageList}" itemRenderer="path.to.render.ImageRenderer" skinClass="path.to.skins.ListSkin" > <s:layout> <s:HorizontalLayout gap="2" /> </s:layout> </s:List> Currently, it would appear that each item is processed asynchronously. However, I want them to be processed synchronously. Reason: I am displaying a list of images, and I want the leftmost one rendered first, followed by the one to its right, and so on. Edit: I just found this answer. Do you think that could be the same issue?

    Read the article

  • Concatenate 2 text elements on a line with full-width border using CSS only

    - by Michael Horne
    Okay, I'm a newbie to CSS3, so please be gentle. ;-) I'm working with some Wordpress code (Woocommerce plugin, to be exact), and I'm trying to format a line of code in a sidebar so that 2 separate text items (one in an <a, the other in a <span are all on the same line, the full width of the column, and with a bottom border. It looks something like this (except the bottom border on each text do not go all the way across the enclosing sidebar box): http://www.dalluva.com/temp/browse-catalog.JPG (sorry, I'm new and can't post inline images yet) Here's the code fragment I'm trying to live with (i.e. I don't want to change it): <div class="widget"> ... <ul class="product-categories"> <li class="cat-item"> <a href="http://localhost/dalluva/shop/product-category/books/">Books</a> <span class="count">(5)</span> </li> ... And here's the CSS I have now: .widget ul li a { border-bottom: 1px solid #e9e9e9; line-height:1.0; padding: 5px 0 5px 22px; display: inline-block; } .widget ul li span { border-bottom: 1px solid #e9e9e9; line-height: 1.0; padding: 5px 0 5px 0; display: inline-block; } The output in the image above looks right for this CSS code, but when I change the 'span' CSS to include a width:100%, it causes the span element to wrap to the next line, looking like this: http://www.dalluva.com/temp/browse-catalog-2.JPG I've played with white-space:nowrap, overflow:hidden, etc, but I can't seem to find a way to have both the <a and the <span text on the same line with the border extending the full width of the column. Any suggestions on getting the desired effect through CSS only? Thanks. Michael

    Read the article

  • php paging class

    - by Stick it to THE MAN
    Can anyone recommend a good PHP paging class? I have searched google, but have not seen anything that matches my requirements. Rather than "rolling my own" (and almost surely reinventing the wheel), I decided to check in here first. First some background: I am developing a website using Symfony 1.3.2 with Propel ORM on Ubuntu 9.10. I am currently using the Propel pager, which is OK, but I recently started using memcache to speed things up a little. At this point, the Propel pager is of little use, as it (AFAIK), only works with Propel objects. What I need is a class th:t meets the following requirents Has clean interface, with separation of concerns, so that the logic to retrieve records from the datasource (e.g. database) is encapsulated in a class (or at least a separate file). Can work with arrays of objects Provides pagination links, and only fetches the data required for the current page. Also, the pagination should 'split' the available page links if there are too many. For example, if there are potentially 1000 possible page links, the pages displayed should be something like FIRST 2,3 ....999 LAST Can return the number of all the records in the table being queried, so that the following links are available FIRST, LAST (this requirement is actually already covered in the previous requirement - but I just wanted to re-emphasise it). Can anyone recommend such a library, if they have used it succesfully in the past? Alternatively, someobe may have 'hacked' (e.g. derived from) the current Propel pager, to get it to do the things I listed about - please let me know.

    Read the article

  • Why do WCF clients depend on the app.config file?

    - by routeNpingme
    Like a lot of things, I'm sure there's a good reason for this, so please help me understand... Why, by default, do WCF services store settings in app.config? This has been so frustrating trying to work with multiple Silverlight class libraries. These class libraries are supposed to be completely independent from each other, and this dependency on the app.config seems to cause the following headaches: Single Responsibility Principle - I should be able to add a reference to a class library and go. If that class library uses a service reference, this idea is shot before I even start coding against it. Muddy Configuration - To get other libraries to work, I have to copy and paste the service configurations into the "main" application configs. If an endpoint changes in any way, I can't just worry about a new version of that class DLL - I have to worry about anything that uses it, too. Complex Alternatives - Programmatically creating the endpoint isn't pretty. Period. There has to be a better way. Why doesn't WCF at least separate the service configurations into a ServiceName.config or something that gets copied to an output directory. What am I missing? How do you deal with this?

    Read the article

  • DataGridView with row-specific DataGridViewComboBoxColumn contents

    - by XXXXX
    So I have something like the following data structure (constructors omitted) class Child { public string Name { get; set; } public int Age { get; set; } } class Parent { public string Name { get; set; } public List <Child> Children { get; private set; } // never null; list never empty public Child FavoriteChild { get; set; } // never null; always a reference to a Child in Children } List < Parent > Parents; What I want to do is show a DataGridView where each row is a Parent from Parent list. Each row should have two columns: a text box showing the parent's name and a DataGridViewComboBoxColumn containing that parent's children, from which the user can select the parent's favorite child. I suppose I could do the whole thing manually, but I'd like to do all this with more-or-less standard Data Binding. It's easy enough to bind the DataGridView to the list of parents, and easy enough to bind the selected child to the FavoriteChild property. The part that's giving me difficulty is that it looks like the Combo Box column wants to bind to one data source for all the combo-box's contents on all rows. I'd like each instance of the combo box to bind to the list of each parent's children. I'm fairly new to C#/Windows Forms, so I may well be missing something obvious. Or it could be that "you can't get there from here." It's not too tough to make a separate list of all the children and filter it by parent; I'm looking into that possibility right now. Is this feasible, or is there a better way?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How can I perform this query between related tables without using UNION?

    - by jeremy
    Suppose I have two separate tables that I watch to query. Both of these tables has a relation with a third table. How can I query both tables with a single, non UNION based query? I want the result of the search to rank the results by comparing a field on each table. Here's a theoretical example. I have a User table. That User can have both CDs and books. I want to find all of that user's books and CDs with a single query matching a string ("awesome" in this example). A UNION based query might look like this: SELECT "book" AS model, name, ranking FROM book WHERE name LIKE 'Awesome%' UNION SELECT "cd" AS model, name, ranking FROM cd WHERE name LIKE 'Awesome%' ORDER BY ranking DESC How can I perform a query like this without the UNION? If I do a simple left join from User to Books and CDs, we end up with a total number of results equal to the number of matching cds timse the number of matching books. Is there a GROUP BY or some other way of writing the query to fix this?

    Read the article

  • I'm trying to grasp the concept of creating a program that uses a SQL Server database, but I'm used

    - by Sergio Tapia
    How can I make a program use a SQL Server database, and have that program work on whatever computer it's installed on. If you've been following my string of questions today, you'd know that I'm making an open source and free Help Desk suite for small and medium businesses. The client application. The client application is a Windows Forms app. On installation and first launch on every client machine, it'll ask for the address of the main Help Desk server. The server. Here I plan to handle all incoming help requests, show them to the IT guys, and provide WCF services for the Client application to consume. My dilemma lies in that, I know how to make the program run on my local machine; but I'm really stumped on how to make this work for everyone who wants to download and install the server bit on their Windows Server. Would I have to make an SQL Script and have it run on the MS SQL server when a user wants to install the 'server' application? Many thanks to all for your valuable time and effort to teach me. It's really really appreciated. :) Edit: To clarify, each business will have their server completely separate from me. I will have no access whatsoever to them nor will they be in any way connected to me. (I don't know why I should clarify this :P ) So, assuming the have ABSOLUTELY NO DATABASE SERVER installed; what can I do?

    Read the article

  • Images not showing in ie7 using jquery cycle and jCarouselLite plugin

    - by Geetha
    Hi All, I am using jquery cycle and jCarouselLite plugin to display images as slide. Images are getting displayed in ie7. but working perfect in ie6. Image Property inside the cycle control: Protocol: Not available Type: Not available Address(url): Not available Size: Not available Dimensions: 100X100 but control having the url. if i tried that image url separate it showing the image. Code: $('#slide').cycle({ fx: 'fade', continuous: true, speed: 7500, timeout: 55000, sync: 1 }); Html Code: <div id="slide"> <img src="samp1.jpg" width="664" height="428" border="0" /> <img src="samp2.jpg" width="664" height="428" border="0" /> <img src="samp3.jpg" width="664" height="428" border="0" /> <img src="samp4.jpg" width="664" height="428" border="0" /> <img src="samp5.jpg" width="664" height="428" border="0" /> <img src="samp6.jpg" width="664" height="428" border="0" /> <img src="samp7.jpg" width="664" height="428" border="0" /> <img src="samp8.jpg" width="664" height="428" border="0" /> </div> Geetha.

    Read the article

  • functions with same names in javascript

    - by biju
    Hi, I tried to write a function on a js file and another function with the same name in the page.I expected an error but no error came and i got only the function from the js file to execute.How is this possible.Even if i write a function in a separate js file,everything is rendered in a single html file.Then how come it is possible <script type="text/javascript" language="javascript" src="JScript.js" /> <script language="javascript"> function Boo() { alert("Hai new"); } </script> <head runat="server"> <title></title> </head> <body> <form id="form1" runat="server"> <div> <asp:Button runat=server OnClientClick="Boo();" Text="Click" /> </div> </form> </body> and in the js file function Boo() { alert("Hai"); }

    Read the article

< Previous Page | 254 255 256 257 258 259 260 261 262 263 264 265  | Next Page >