Search Results

Search found 8190 results on 328 pages for 'separate'.

Page 259/328 | < Previous Page | 255 256 257 258 259 260 261 262 263 264 265 266  | Next Page >

  • AudioRecord problems with non-HTC devices

    - by Marc
    I'm having troubles using AudioRecord. An example using some of the code derived from the splmeter project: private static final int FREQUENCY = 8000; private static final int CHANNEL = AudioFormat.CHANNEL_CONFIGURATION_MONO; private static final int ENCODING = AudioFormat.ENCODING_PCM_16BIT; private int BUFFSIZE = 50; private AudioRecord recordInstance = null; ... android.os.Process.setThreadPriority(android.os.Process.THREAD_PRIORITY_URGENT_AUDIO); recordInstance = new AudioRecord(MediaRecorder.AudioSource.MIC, FREQUENCY, CHANNEL, ENCODING, 8000); recordInstance.startRecording(); short[] tempBuffer = new short[BUFFSIZE]; int retval = 0; while (this.isRunning) { for (int i = 0; i < BUFFSIZE - 1; i++) { tempBuffer[i] = 0; } retval = recordInstance.read(tempBuffer, 0, BUFFSIZE); ... // process the data } This works on the HTC Dream and the HTC Magic perfectly without any log warnings/errors, but causes problems on the emulators and Nexus One device. On the Nexus one, it simply never returns useful data. I cannot provide any other useful information as I'm having a remote friend do the testing. On the emulators (Android 1.5, 2.1 and 2.2), I get weird errors from the AudioFlinger and Buffer overflows with the AudioRecordThread. I also get a major slowdown in UI responsiveness (even though the recording takes place in a separate thread than the UI). Is there something apparent that I'm doing incorrectly? Do I have to do anything special for the Nexus One hardware?

    Read the article

  • Can't get KnownType to work with WCF

    - by Kelly Cline
    I have an interface and a class defined in separate assemblies, like this: namespace DataInterfaces { public interface IPerson { string Name { get; set; } } } namespace DataObjects { [DataContract] [KnownType( typeof( IPerson ) ) ] public class Person : IPerson { [DataMember] public string Name { get; set; } } } This is my Service Interface: public interface ICalculator { [OperationContract] IPerson GetPerson ( ); } When I update my Service Reference for my Client, I get this in the Reference.cs: public object GetPerson() { return base.Channel.GetPerson(); I was hoping that KnownType would give me IPerson instead of "object" here. I have also tried [KnownType( typeof( Person ) ) ] with the same result. I have control of both client and server, so I have my DataObjects (where Person is defined) and DataInterfaces (where IPerson is defined) assemblies in both places. Is there something obvious I am missing? I thought KnownType was the answer to being able to use interfaces with WCF. ----- FURTHER INFORMATION ----- I removed the KnownType from the Person class and added [ServiceKnownType( typeof( Person ) ) ] to my service interface, as suggested by Richard. The client-side proxy still looks the same, public object GetPerson() { return base.Channel.GetPerson(); , but now it doesn't blow up. The client just has an "object", though, so it has to cast it to IPerson before it is useful. var person = client.GetPerson ( ); Console.WriteLine ( ( ( IPerson ) person ).Name );

    Read the article

  • I'm trying to grasp the concept of creating a program that uses a SQL Server database, but I'm used

    - by Sergio Tapia
    How can I make a program use a SQL Server database, and have that program work on whatever computer it's installed on. If you've been following my string of questions today, you'd know that I'm making an open source and free Help Desk suite for small and medium businesses. The client application. The client application is a Windows Forms app. On installation and first launch on every client machine, it'll ask for the address of the main Help Desk server. The server. Here I plan to handle all incoming help requests, show them to the IT guys, and provide WCF services for the Client application to consume. My dilemma lies in that, I know how to make the program run on my local machine; but I'm really stumped on how to make this work for everyone who wants to download and install the server bit on their Windows Server. Would I have to make an SQL Script and have it run on the MS SQL server when a user wants to install the 'server' application? Many thanks to all for your valuable time and effort to teach me. It's really really appreciated. :) Edit: To clarify, each business will have their server completely separate from me. I will have no access whatsoever to them nor will they be in any way connected to me. (I don't know why I should clarify this :P ) So, assuming the have ABSOLUTELY NO DATABASE SERVER installed; what can I do?

    Read the article

  • Add webservice reference, the classes in different file

    - by ArunDhaJ
    Hi, When I add webservice as service reference in my .Net project, it creates a service folder within "Service References". All the interfaces and classes are contained within that service folder. I wanted to know how to split the interface's method and classes. Actually I wanted the web service reference to import classes defined in different dll. I wanted to define this way because of my design constraints. I've 3 layered application. Of which third layer is communication layer which holds all web service references. second is business layer and first is presentation layer. If the class declarations are in layer-3 and I'm accessing those classes from presentation layer, it is logically a cross-layer-access-violation. Instead, I wanted a separate project which holds only the class declarations and this would be used in all 3 layers. I didn't faced any problems to achieve this with layer-1 and layer-2. But, I'm not sure how to make communication layer to use this common declaration dll. Your suggestion would help me to design my application better. Thanks in advance Regards ArunDhaJ

    Read the article

  • Unit test project doesn't recognize the classes it was generated from

    - by DougLeary
    I have a fairly simple file-system website consisting of one aspx page and several classes in separate .cs files. Everything is on my own HD. The web app itself builds and runs fine. Out of curiosity I decided to try out Visual Studio's nifty, easy-to-use unit test feature. So I opened each class file and clicked Create Unit Tests. VS generated a test project containing a set of test classes and some other files. Easy! But when I try to build or run the test project it throws a series of build errors, one for every class: The type or namespace name 'class-name' could not be found (are you missing a using directive or an assembly reference?). Somebody asked if my test project has a reference to the original project. Well no, because the original project is a file-system website. It has no bin folder and no DLL, so there's nothing to reference as far as I can tell. I would think that since VS generated these unit tests it would generate whatever references it needs, but apparently not. Is generating unit tests for file-system web apps an undocumented no-no, or is there a magic trick to getting it to work?

    Read the article

  • Can not access response.body inside after filter block in Sinatra 1.0

    - by Petr Vostrel
    I'm struggling with a strange issue. According to http://github.com/sinatra/sinatra (secion Filters) a response object is available in after filter blocks in Sinatra 1.0. However the response.status is correctly accessible, I can not see non-empty response.body from my routes inside after filter. I have this rackup file: config.ru require 'app' run TestApp Then Sinatra 1.0.b gem installed using: gem install --pre sinatra And this is my tiny app with a single route: app.rb require 'rubygems' require 'sinatra/base' class TestApp < Sinatra::Base set :root, File.dirname(__FILE__) get '/test' do 'Some response' end after do halt 500 if response.empty? # used 500 just for illustation end end And now, I would like to access the response inside the after filter. When I run this app and access /test URL, I got a 500 response as if the response is empty, but the response clearly is 'Some response'. Along with my request to /test, a separate request to /favicon.ico is issued by the browser and that returns 404 as there is no route nor a static file. But I would expect the 500 status to be returned as the response should be empty. In console, I can see that within the after filter, the response to /favicon.ico is something like 'Not found' and response to /test really is empty even though there is response returned by the route. What do I miss?

    Read the article

  • Python Tkinter comparing PhotoImage objects

    - by Kyle Schmidt
    In a simple LightsOut game, when I click on a light I need to toggle the image on a button. I'm doing this with Tkinter, so I thought I'd just check and see what image is currently on the button (either 'on.gif' or 'off.gif') and set it to the other one, like this: def click(self,x,y): if self.buttons[x][y].image == self.on: self.buttons[x][y].config(image=self.off) self.buttons[x][y].image == self.off else: self.buttons[x][y].config(image=self.on) self.buttons[x][y].image == self.on This ends up always being True - I can turn a lgiht off, but never turn it back on. Did some research, realized that I should probably be using cmp: def click(self,x,y): if cmp(self.buttons[x][y].image,self.on) == 0: self.buttons[x][y].config(image=self.off) self.buttons[x][y].image == self.off else: self.buttons[x][y].config(image=self.on) self.buttons[x][y].image == self.on But that gave me the exact same result. Both self.on and self.off are PhotoImage objects. Aside from keeping a separate set of lists which tracks what type of light is in each position and redrawing them every click, is there a way to directly compare two PhotoImage objects like this?

    Read the article

  • How to detect that the internet connection has got disconnected through a java desktop application?

    - by Yatendra Goel
    I am developing a Java Desktop Application that access internet. It is a multi-threaded application, each thread do the same work (means each thread is an instance of same Thread class). Now, as all the threads need internet connection to be active, there should be some mechanism that detects whether an internet connection is active or not. Q1. How to detect whether the internet connection is active or not? Q2. Where to implement this internet-status-check-mechanism code? Should I start a separate thread for checking internet status regularly and notifies all the threads when the status changes from one state to another? Or should I let each thread check for the internet-status itself? Q3. This issue should be a very common issue as every application accessing an internet should deal with this problem. So how other developers usually deal with this problem? Q4. If you could give me a reference to a good demo application that addresses this issue then it would greatly help me.

    Read the article

  • Advice on whether to use native C++ DLL or not: PINVOKE & Marshaling ?

    - by Bob
    What's the best way to do this....? I have some Native C++ code that uses a lot of Win32 calls together with byte buffers (allocated using HeapAlloc). I'd like to extend the code and make a C# GUI...and maybe later use a basic Win32 GUI (for use where there is no .Net and limited MFC support). (A) I could just re-write the code in C# and use multiple PINVOKEs....but even with the PINVOKES in a separate class, the code looks messy with all the marshaling. I'm also re-writing a lot of code. (B) I could create a native C++ DLL and use PINVOKE to marshal in the native data structures. I'm assuming I can include the native C++ DLL/LIB in a project using C#? (C) Create a mixed mode DLL (Native C++ class plus managed ref class). I'm assuming that this would make it easier to use the managed ref class in C#......but is this the case? Will the managed class handle all the marshaling? Can I use this mixed mode DLL on a platform with no .Net (i.e. still access the native C++ unmanaged component) or do I limit myself to .Net only platforms. One thing that bothers me about each of these options is all the marshalling. Is it better to create a managed data structure (array, string etc.) and pass that to the native C++ class, or, the other way around? Any ideas on what would be considered best practice...?

    Read the article

  • Images not showing in ie7 using jquery cycle and jCarouselLite plugin

    - by Geetha
    Hi All, I am using jquery cycle and jCarouselLite plugin to display images as slide. Images are getting displayed in ie7. but working perfect in ie6. Image Property inside the cycle control: Protocol: Not available Type: Not available Address(url): Not available Size: Not available Dimensions: 100X100 but control having the url. if i tried that image url separate it showing the image. Code: $('#slide').cycle({ fx: 'fade', continuous: true, speed: 7500, timeout: 55000, sync: 1 }); Html Code: <div id="slide"> <img src="samp1.jpg" width="664" height="428" border="0" /> <img src="samp2.jpg" width="664" height="428" border="0" /> <img src="samp3.jpg" width="664" height="428" border="0" /> <img src="samp4.jpg" width="664" height="428" border="0" /> <img src="samp5.jpg" width="664" height="428" border="0" /> <img src="samp6.jpg" width="664" height="428" border="0" /> <img src="samp7.jpg" width="664" height="428" border="0" /> <img src="samp8.jpg" width="664" height="428" border="0" /> </div> Geetha.

    Read the article

  • Reading Unicode files line by line C++

    - by Roger Nelson
    What is the correct way to read Unicode files line by line in C++? I am trying to read a file saved as Unicode (LE) by Windows Notepad. Suppose the file contains simply the characters A and B on separate lines. In reading the file byte by byte, I see the following byte sequence (hex) : FE FF 41 00 0D 00 0A 00 42 00 0D 00 0A 00 So 2 byte BOM, 2 byte 'A', 2byte CR , 2byte LF, 2 byte 'B', 2 byte CR, 2 byte LF . I tried reading the text file using the following code: std::wifstream file("test.txt"); file.seekg(2); // skip BOM std::wstring A_line; std::wstring B_line; getline(file,A_line); // I get "A" getline(file,B_line); // I get "\0B" I get the same results using operator instead of getline file >> A_line; file >> B_line; It appears that the single byte CR character is is being consumed only as the single byte. or CR NULL LF is being consumed but not the high byte NULL. I would expect wifstream in text mode would read the 2byte CR and 2byte LF. What am I doing wrong? It does not seem right that one should have to read a text file byte by byte in binary mode just to parse the new lines.

    Read the article

  • How can I perform this query between related tables without using UNION?

    - by jeremy
    Suppose I have two separate tables that I watch to query. Both of these tables has a relation with a third table. How can I query both tables with a single, non UNION based query? I want the result of the search to rank the results by comparing a field on each table. Here's a theoretical example. I have a User table. That User can have both CDs and books. I want to find all of that user's books and CDs with a single query matching a string ("awesome" in this example). A UNION based query might look like this: SELECT "book" AS model, name, ranking FROM book WHERE name LIKE 'Awesome%' UNION SELECT "cd" AS model, name, ranking FROM cd WHERE name LIKE 'Awesome%' ORDER BY ranking DESC How can I perform a query like this without the UNION? If I do a simple left join from User to Books and CDs, we end up with a total number of results equal to the number of matching cds timse the number of matching books. Is there a GROUP BY or some other way of writing the query to fix this?

    Read the article

  • Java downcasting and is-A has-A relationship

    - by msharma
    HI, I have a down casting question, I am a bit rusty in this area. I have 2 clasess like this: class A{ int i; String j ; //Getters and setters} class B extends A{ String k; //getter and setter} I have a method like this, in a Utility helper class: public static A converts(C c){} Where C are objects that are retireved from the database and then converted. The problem is I want to call the above method by passing in a 'C' and getting back B. So I tried this: B bClasss = (B) Utility.converts(c); So even though the above method returns A I tried to downcast it to B, but I get a runtime ClassCastException. Is there really no way around this? DO I have to write a separate converts() method which returns a B class type? If I declare my class B like: class B { String k; A a;} // So instead of extending A it has-a A, getter and setters also then I can call my existing method like this: b.setA(Utility.converts(c) ); This way I can reuse the existing method, even though the extends relationship makes more sense. What should I do? Any help much appreciated. Thanks.

    Read the article

  • Best approach for Java/Maven/JPA/Hibernate build with multiple database vendor support?

    - by HDave
    I have an enterprise application that uses a single database, but the application needs to support mysql, oracle, and sql*server as installation options. To try to remain portable we are using JPA annotations with Hibernate as the implementation. We also have a test-bed instance of each database running for development. The app is building nicely in Maven, and I've played around with the hibernate3-maven-plugin and can auto-generate DDL for a given database dialect. What is the best way to approach this so that individual developers can easily test against all three databases and our Hudson based CI server can build things propertly. More specifically: 1) I thought the hbm2ddl goal in the hibernate3-maven-plugin would just generate a schema file, but apparently it connects to a live database and attempts to create the schema. Is there a way to have this just create the schema file for each database dialect without connecting to a database? 2) If the hibernate3-maven-plug insists on actually creating the database schema, is there a way to have it drop the database and recreate it before creating the schema? 3) I am thinking that each developer (and the hudson build machine) should have their own separate database on each database server. Is this typical? 4) Will developers have to run Maven three times...once for each database vendor? If so, how do I merge the results on the build machine? 5) There is a hbm2doc goal within hibernate3-maven-plugin. It seems overkill to run this three times...I gotta believe it'd be nearly identical for each database.

    Read the article

  • Consecutive build of VS2005 and VS2008 C++ projects causes LNK1104 error

    - by TestAccount
    I have VS2005 and VS2008 installed on the same machine. I also have a common codebase that I build using both '05 and '08. For this purpose, I have 2 VC projects.. A '08 project called XYZ_2008.vcproj and a '05 project called XYZ_2005.vcproj, and the corresponding 2 slns as well. Both projects output dlls, libs and pdbs to the same output directory (all with appropriate _2005 and _2008 suffixes). Assuming that I am starting from a clean state, I first open XYZ_2005.sln (containing XYZ_2005.vcproj) in VS2005 and build it successfully. Then I close VS2005. Next, I open XYZ_2008.sln (containing XYZ_2008.vcproj) and build (not rebuild) it. At this point, I get an error saying: LINK : fatal error LNK1104: cannot open file 'mfc80u.lib' If now I rebuild the '08 solution, the error goes away and the build succeeds. The build also succeeds if I directly do a rebuild instead of a build for the '08 sln. In spite of everything being separate, the VS08 build seems to be picking up a MFC8 file (from VS05) instead of a MFC9 file. Can somebody please help out with this issue? Thanks in advance!

    Read the article

  • Database design: Calculating the Account Balance

    - by 001
    How do I design the database to calculate the account balance? 1) Currently I calculate the account balance from the transaction table In my transaction table I have "description" and "amount" etc.. I would then add up all "amount" values and that would work out the user's account balance. I showed this to my friend and he said that is not a good solution, when my database grows its going to slow down???? He said I should create separate table to store the calculated account balance. If did this, I will have to maintain two tables, and its risky, the account balance table could go out of sync. Any suggestion? EDIT: OPTION 2: should I add an extra column to my transaction tables "Balance". now I do not need to go through many rows of data to perform my calculation. Example John buys $100 credit, he debt $60, he then adds $200 credit. Amount $100, Balance $100. Amount -$60, Balance $40. Amount $200, Balance $240.

    Read the article

  • Powershell - Using variables in -Include filter

    - by TheD
    (again!) My final question for the night. I have a function which uses the Get-ChildItem to work out the newest file within a folder. The reason being I need to find the latest incremental backup in a folder and script an EXE to mount it. However, within this same folder there are multiple backup chains for all different servers: i.e. SERVER1_C_VOL_b001_i015.spi SERVER2_D_VOL_b001_i189.spi SERVER1_C_VOL_b002_i091.spi SERVER1_E_VOL_b002_i891.spi (this is the newest file created) I want only to look at SERVER1, look at only the C_VOL and look at only b001 - nothing else. I have all these seperate components: the drive letter, the Server Name, the b00X number stored in array. How then can I go and use the Get-ChildItem with the -Include filter to only look at: .spi SERVER1 C_VOL b001 Given I have all of these separate components in an array taken from a text file: Get-Content .\PostBackupCheck-TextFile.txt | Select-Object -First $i { $a = $_ -split ' ' ; $locationArray += "$($a[0]):\$($a[1])\$($a[2])" ; $imageArray += "$($a[2])_$($a[3])_VOL_b00$($a[4])_i$($a[5]).spi" } I then go onto try and filter then and then get stuck: $latestIncremental = Get-ChildItem -Path ${shadowProtectDataLocation}\*.* -Include *.spi | Sort-Object LastAccessTime -Descending | Select-Object -First 1 I have the .spi filtered, but how can I also just include the C (for volume), the number for the b00x and the server name. Thanks!

    Read the article

  • How do I ensure a Flex dataProvider processes the data synchronously?

    - by Matt Calthrop
    I am using an component, and currently have a dataProvider working that is an ArrayCollection (have a separate question about how to make this an XML file... but I digress). Variable declaration looks like this: [Bindable] private var _dpImageList : ArrayCollection = new ArrayCollection([ {"location" : "path/to/image1.jpg"}, {"location" : "path/to/image2.jpg"}, {"location" : "path/to/image3.jpg"} ]); I then refer to like this: <s:List id="lstImages" width="100%" dataProvider="{_dpImageList}" itemRenderer="path.to.render.ImageRenderer" skinClass="path.to.skins.ListSkin" > <s:layout> <s:HorizontalLayout gap="2" /> </s:layout> </s:List> Currently, it would appear that each item is processed asynchronously. However, I want them to be processed synchronously. Reason: I am displaying a list of images, and I want the leftmost one rendered first, followed by the one to its right, and so on. Edit: I just found this answer. Do you think that could be the same issue?

    Read the article

  • W3C error doc error? Output tag browser support.

    - by ThomasReggi
    Was looking at the reference page here : http://www.w3.org/TR/html5/offline.html I copied and pasted the code on my server here in separate files. All of the pages are linked correctly but the clock won't show. Just to double check, it wasn't my "server config" I put it on jsfiddle.net here: http://jsfiddle.net/reggi/Dy8PU/. Fails: MAC / FIREFOX 3.6.13 Wins: MAC / FIREFOX 4.0.b8 Is this dummy example code? <!-- clock.html --> <!DOCTYPE HTML> <html> <head> <title>Clock</title> <script src="clock.js"></script> <link rel="stylesheet" href="clock.css"> </head> <body> <p>The time is: <output id="clock"></output></p> </body> </html> /* clock.css */ output { font: 2em sans-serif; } /* clock.js */ setTimeout(function () { document.getElementById('clock').value = new Date(); }, 1000); UPDATE: The W3C code above works on only the NEWEST Beta releases of certain browsers Below are some viable current javascript workarounds

    Read the article

  • convert htmlelement to string for comparison javascript

    - by Jamex
    Hi, I am using a function that obtains a target element id at onclick. Example, if I click on the text element that has the id of 'help'. var click = (e && e.target) || (event && event.srcElement); The var click would contain the ref to the id of "help". I want to compare the var click to the string 'help' using the if statement below. if (click == 'about') {do something} The comparison does not work because the var click is not a string. When I use the alert(click) to debug, it shows click as "object HTMLElement". How would you compare whether the id 'help' is obtained from var click? I could write out something like if (click == document.getElementById('help')) {do something} but that would make a long statement. also if the var click is document.getElementById('help'), how would you make a new var "show" as document.getElementById('showhelp') basically, I want to use the same function to generate dynamic responses to each element that was clicked on, and not having to create a separate function for each element.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • This pagination script is doodoo - I need a better one!

    - by ClarkSKent
    Hello, I was looking at the pagination script (posted below) and found it to be gros,s and not very good at all especially when trying to customize it. This is what the main page looks like: <?php include('config.php'); $per_page = 9; //Calculating no of pages $sql = "select * from messages"; $result = mysql_query($sql); $count = mysql_num_rows($result); $pages = ceil($count/$per_page) ?> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/ libs/jquery/1.3.0/jquery.min.js"></script> <script type="text/javascript" src="jquery_pagination.js"></script> <div id="loading" ></div> <div id="content" ></div> <ul id="pagination"> <?php //Pagination Numbers for($i=1; $i<=$pages; $i++) { echo '<li id="'.$i.'">'.$i.'</li>'; } ?> </ul> The top part of the code gets the results from the mysql db and than uses this information to display the numbers in the body of this page. I am trying to put something like this on a separate page like count_page.php and then just include it. I guess my question is, if there is a better way of doing the above with better structure. A better way to go through the db and count the results and display the appropriate numbers. The above seems messy. Thanks for any help or suggestions on this.

    Read the article

  • Can this auto-stretcing scenario be realized undex XHTML/CSS?

    - by Vilx-
    I want two horizontal areas in my webpage. The first one is the menu. It's on the top. Unfortunately I don't know its size, and it might change in response to user actions. Below the menu is the main area which should stretch at least as far as the bottom of the window (if there is little content) or beyond (if there is a lot of content. To illustrate with ASCII art: +----------------------------------------------------+ | This area resizes vertically depending on contents | +----------------------------------------------------+ | This area stretches to the bottom of the window, | | but can be even larger if necessary. Note: this | | should be a separate area because it will contain | | children with height:100% as well. | | | +----------------------------------------------------+ Can this be done? Can it be done with Javascript? Added: To put things in perspective and avoid confusion, think of it this way: the top menu is generated by myself, but the bottom area is an IFrame which I want to fill the rest of the page. This is what it eventually comes down to anyway in my case.

    Read the article

  • Maven dependency for Servlet 3.0 API?

    - by deamon
    How can I tell Maven 2 to load the Servlet 3.0 API? I tried: <dependency> <groupId>javax.servlet</groupId> <artifactId>servlet-api</artifactId> <version>3.0</version> <scope>provided</scope> </dependency> I use http://repository.jboss.com/maven2/ but what repository would be correct? Addendum: It works with a dependency for the entire Java EE 6 API and the following settings: <repository> <id>java.net</id> <url>http://download.java.net/maven/2</url> </repository> <dependency> <groupId>javax</groupId> <artifactId>javaee-api</artifactId> <version>6.0</version> <scope>provided</scope> </dependency> I'd prefer to only add the Servlet API as dependency, but "Brabster" may be right that separate dependencies have been replaced by Java EE 6 Profiles. Is there a source that confirms this assumption?

    Read the article

  • How add class='active' to html menu with php

    - by meow
    Hello I want to put my html navigation in a separate php file so when I need to edit it, I only have to edit it once. The problem starts when I want to add the class active to the active page. I've got three pages and one common file. common.php : <?php $nav = <<<EOD <div id="nav"> <ul> <li><a <? if($page == 'one'): ?> class="active"<? endif ?> href="index.php">Tab1</a>/</li> <li><a href="two.php">Tab2</a></li> <li><a href="three.php">Tab3</a></li> </ul> </div> EOD; ?> index.php : All three pages are identical except their $page is different on each page. <?php $page = 'one'; require_once('common.php'); ?> <html> <head></head> <body> <?php echo $nav; ?> </body> </html> This simply won't work unless I put my nav on each page, but then the whole purpose of separating the nav from all pages is ruined. Is what I want to accomplish even possible? What am I doing wrong? Thanks EDIT: When doing this, the php code inside the li don't seem to run, it's just being printed as if it was html

    Read the article

< Previous Page | 255 256 257 258 259 260 261 262 263 264 265 266  | Next Page >