Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 281/336 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

• recvfrom returns invalid argument when *from* is passed

  - by Aditya Sehgal

  I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

  Read the article

• Generating jquery 'rules' from business model to UI in asp.net mvc

  - by jim

  Hi all, I've had a good look around and am certain that there's no matching question on SO, so here goes. Has anyone created a 'helper' method on their model that generates jquery (or plain javascript) rules validation dynamically, based on the criteria/rules that are contained within the object and taken from a repository (i.e. DB). What i'm thinking of is a discrete set of partial views (and associated models) that have rules at the business logic 'level' and rather than (or in combination with) validating the rule(s) at postback, translating the same rules into tightly focussed jquery methods that work identically at client (js) and server (c#) levels. I can see benefits here re performance. Also, the rules definitions could be created in a single place (in c#) and the jquery generated off of that, thus allowing single edits to update both code streams. I appreciate that there would be limitations imposed by language specific contstraints but the general principle could be quite interesting if used appropriately. I'm also aware that testibility could be an issue when using two different language structures and hoping to achieve similar test outcomes - but those aside... any thoughts or experiences of similar out there?? cheers jimi

  Read the article

• C: incompatible types in assignment

  - by The.Anti.9

  I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

  Read the article

• winUserControl in VS2010 - properties are not visible in designer

  - by mj82

  I have a problem with (I suppose) my Visual Studio 2010 Express environment: when I design my own UserControl, in Properties grid I can't see public properties of that control. They are however visible in the project, that reference this control. As it's Express Edition, I create new empty project, then add new UserControl to it. Then, for a test, I put following code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Drawing; using System.Data; using System.Linq; using System.Text; using System.Windows.Forms; namespace Project1 { public partial class UserControl1 : UserControl { private int myNumber; [Browsable(true)] public int MyNumber { get { return myNumber; } set { myNumber = value; } } public UserControl1() { InitializeComponent(); } } } In VS 2008, as I remember, that should be enogh to show MyNumber property in Properties grid, even without [Browsable(true)] attribute. In VS 2010 however, when I double click UserControl1.cs in Solution Explorer and look in Properties, I don't see MyNumber. When I reference and use this control in another project, there is an access to it's properties. I've tried to competly reinstall VS 2010 environment, including SP1, but with no success. Do you have any idea what can be wrong? By the way: none of these attributes are working, either: [Browsable(true)] [EditorBrowsable(EditorBrowsableState.Always)] [DesignerSerializationVisibility(DesignerSerializationVisibility.Content)] [Bindable(true)] Best regards, Marcin

  Read the article

• PhotoChooserTask + Navigation.

  - by user562405

  I taken two Images & added event (MouseButtonDown) for them. When first image handles event to open Gallery. Second image handles events for open camera. When user has choosed his image from the gallery, I want to navigate to next page. Its navigates. But before completing navigation process, it displays MainPage & then moves toward next page. I didnt want to display the MainPage once user chooses the image from the gallery. Plz help. Thanks in advance. public partial class MainPage : PhoneApplicationPage { PhotoChooserTask objPhotoChooser; CameraCaptureTask cameraCaptureTask; // Constructor public MainPage() { InitializeComponent(); objPhotoChooser = new PhotoChooserTask(); objPhotoChooser.Completed += new EventHandler<PhotoResult>(objPhotoChooser_Completed); cameraCaptureTask = new CameraCaptureTask(); cameraCaptureTask.Completed += new EventHandler<PhotoResult>(objCameraCapture_Completed); } void objPhotoChooser_Completed(object sender, PhotoResult e) { if (e != null && e.TaskResult == TaskResult.OK) { //Take JPEG stream and decode into a WriteableBitmap object App.CapturedImage = PictureDecoder.DecodeJpeg(e.ChosenPhoto); //Delay navigation until the first navigated event NavigationService.Navigated += new NavigatedEventHandler(navigateCompleted); } } void navigateCompleted(object sender, EventArgs e) { //Do the delayed navigation from the main page this.NavigationService.Navigate(new Uri("/ImageViewer.xaml", UriKind.RelativeOrAbsolute)); NavigationService.Navigated -= new NavigatedEventHandler(navigateCompleted); } void objCameraCapture_Completed(object sender, PhotoResult e) { if (e.TaskResult == TaskResult.OK) { //Take JPEG stream and decode into a WriteableBitmap object App.CapturedImage = PictureDecoder.DecodeJpeg(e.ChosenPhoto); //Delay navigation until the first navigated event NavigationService.Navigated += new NavigatedEventHandler(navigateCompleted); } } protected override void OnBackKeyPress(System.ComponentModel.CancelEventArgs e) { e.Cancel = true; } private void image1_MouseLeftButtonDown(object sender, MouseButtonEventArgs e) { objPhotoChooser.Show(); } private void image2_MouseLeftButtonDown(object sender, MouseButtonEventArgs e) { cameraCaptureTask.Show(); }

  Read the article

• Breaking dependencies when you can't make changes to other files?

  - by codemuncher

  I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

  Read the article

• Method not being resolved for dynamic generic type

  - by kelloti

  I have these types: public class GenericDao<T> { public T Save(T t) { return t; } } public abstract class DomainObject { // Some properties protected abstract dynamic Dao { get; } public virtual void Save() { var dao = Dao; dao.Save(this); } } public class Attachment : DomainObject { protected dynamic Dao { get { return new GenericDao<Attachment>(); } } } Then when I run this code it fails with RuntimeBinderException: Best overloaded method match for 'GenericDAO<Attachment.Save(Attachment)' has some invalid arguments var obj = new Attachment() { /* set properties */ }; obj.Save(); I've verified that in DomainObject.Save() "this" is definitely Attachment, so the error doesn't really make sense. Can anyone shed some light on why the method isn't resolving? Some more information - It succeeds if I change the contents of DomainObject.Save() to use reflection: public virtual void Save() { var dao = Dao; var type = dao.GetType(); var save = ((Type)type).GetMethod("Save"); save.Invoke(dao, new []{this}); }

  Read the article

• MVC + Is validation attributes enough?

  - by ebb

  My ViewModel has validation attributes that ensure that it wont be empty etc. - Is that enough or should I let my the code contracts I have made be in the ActionResult too? Example: // CreateCaseViewModel.cs public class CreateCaseViewModel { [Required] public string Topic { get; set; } [Required] public string Message { get; set; } } // CaseController.cs [AuthWhere(AuthorizeRole.Developer)] [HttpPost] public ActionResult Create(CreateCaseViewModel model) { if(!ModelState.IsValid) { // TODO: some cool stuff? } if (string.IsNullOrWhiteSpace(model.Message)) { throw new ArgumentException("Message cannot be null or empty", model.Message); } if (string.IsNullOrWhiteSpace(model.Topic)) { throw new ArgumentException("Topic cannot be null or empty", model.Topic); } var success = false; string message; var userId = new Guid(_membershipService.GetUserByUserName(User.Identity.Name).ProviderUserKey.ToString()); if(userId == Guid.Empty) { throw new ArgumentException("UserId cannot be empty"); } Case createCase = _caseService.CreateCase(model.Topic, model.Message); if(createCase == null) { throw new ArgumentException("Case cannot be null"); } if(_caseService.AddCase(createCase, userId)) { message = ControllerResources.CaseCreateFail; } else { success = true; message = ControllerResources.CaseCreateSuccess; } return Json(new { Success = success, Message = message, Partial = RenderPartialViewToString(ListView, GetCases) }); }

  Read the article

• Am I fundamentally misunderstanding how Silverlight runs? (debugging issues)

  - by SP

  I've got a vs2010 solution containing an ASP.Net 4 website, and a Silverlight 4 project. The website is linked to the Silverlight project ('Map') and the ClientBin folder contains a Map.xap file. The Map project is very simple. It contains the default App.xaml and App.xaml.cs files. The MainPage.xaml file looks like this <UserControl x:Class="Map.MainPage" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" mc:Ignorable="d" d:DesignHeight="380" d:DesignWidth="800"> <Canvas x:Name="MainCanvas" Width="800" Height="380"> <Canvas.Background> <ImageBrush ImageSource="map.png" Stretch="None"/> </Canvas.Background> </Canvas> The code behind for that looks like this: public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); throw new Exception(); } } Inside one of the website pages I have the default object pointing to my Silverlight xap When I run the website, I see my background image on the Canvas in the Silverlight window, so I know it's working in that sense. However, I cannot break on any breakpoints set in the MainPage.xaml.cs file (in IE). I have checked the correct settings for Silverlight debugging. And see that Exception I'm throwing in the MainPage constructor? I'm not seeing that either. In fact, nothing I put in there seems to be run at all, but I know the xaml is rendering because I can see my canvas background. What am I not getting here?

  Read the article

• Select rows from table1 and all the children from table2 into an object

  - by Patrick

  I want to pull data from table "Province_Notifiers" and also fetch all corresponding items from table "Province_Notifier_Datas". The table "Province_Notifier" has a guid to identify it (PK), table "Province_Notifier_Datas" has a column called BelongsToProvinceID witch is a foreign key to the "Province_Notifier" tables guid. I tried something like this: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) }; This line is not working and i am trying to figure out how topull the data from table2 into that Province_Notifier_Datas variable. Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) I can add a record easily by adding the second table row into the Province_Notifier_Datas but i can't fetch it back. Province_Notifier dbNotifier = new Province_Notifier(); // set some values for dbNotifier dbNotifier.Province_Notifier_Datas.Add( new Province_Notifier_Data { BelongsToProvince_ID = userInput.Value.ProvinceId, EventText = GenerateNotificationDetail(notifierDetail) }); This works and inserts the data correctly into both tables. Edit: These error messages is thrown: Cannot convert from 'Province_Notifier_Data' to 'System.Collections.Generic.IEnumerable' If i look in Visual Studio, the variable "Province_Notifier_Datas" is of type System.Data.Linq.EntitySet The best overloaded method match for 'System.Collections.Generic.List.AddRange(System.Collections.Generic.IEnumerable)' has some invalid arguments Edit: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID into data2list select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = new EntitySet<Province_Notifier_Data>().AddRange(data2List) }; Error 3 The name 'data2List' does not exist in the current context.

  Read the article

• calculating the index of an array C#

  - by Kerry G

  I want to display a list of the answers a student entered incorrectly. How do I identify the index of these questions? I am hoping to change the contents of a textbox to a list of the questions answered incorrectly, which would require calculating the index of each incorrect question. using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Threading.Tasks; using System.Windows.Forms; namespace WindowsFormsApplication5 { public partial class Form1 : Form { public Form1() { InitializeComponent(); } //return a pass/fail //return number of correct answers //return number of incorrect answers //return index figures of incorrect values public void examResults () { string[] correctAnswers = {B,D,A,A,C,A,B,A,C,D,B,C,D,A,D,C,C,B,D,A}; string[] studentResults = File.ReadAllLines("studentResults.txt"); var c = correctAnswers.Where((x, i) => x.Equals(studentResults[i])).Count(); if ( c <= 14) passFailBox.Text = "Student has failed the exam"; else passFailBox.Text = "Student has passed the exam"; numberCorrectBox.Text = "Student has answered" + c + "answers correctly"; int f; f= 21-c; numberIncorrectBox.Text = "Student has answered" + f + "answers incorrectly"; } } }

  Read the article

• converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

  - by Delirium tremens

  before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

  Read the article

• How to solve this problem with Python

  - by morpheous

  I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

  Read the article

• C#: Need one of my classes to trigger an event in another class to update a text box

  - by Matt

  Total n00b to C# and events although I have been programming for a while. I have a class containing a text box. This class creates an instance of a communication manager class that is receiving frames from the Serial Port. I have this all working fine. Every time a frame is received and its data extracted, I want a method to run in my class with the text box in order to append this frame data to the text box. So, without posting all of my code I have my form class... public partial class Form1 : Form { CommManager comm; public Form1() { InitializeComponent(); comm = new CommManager(); } private void updateTextBox() { //get new values and update textbox } . . . and I have my CommManager class class CommManager { //here we manage the comms, recieve the data and parse the frame } SO... essentially, when I parse that frame, I need the updateTextBox method from the form class to run. I'm guessing this is possible with events but I can't seem to get it to work. I tried adding an event handler in the form class after creating the instance of CommManager as below... comm = new CommManager(); comm.framePopulated += new EventHandler(updateTextBox); ...but I must be doing this wrong as the compiler doesn't like it... Any ideas?!

  Read the article

• Symbols (pdb) for native dll are not loaded due to post build step

  - by sean e

  I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

  Read the article

• Is there an efficient way in LINQ to use a contains match if and only if there is no exact match?

  - by Peter

  I have an application where I am taking a large number of 'product names' input by a user and retrieving some information about each product. The problem is, the user may input a partial name or even a wrong name, so I want to return the closest matches for further selection. Essentially if product name A exactly matches a record, return that, otherwise return any contains matches. Otherwise return null. I have done this with three separate statements, and I was wondering if there was a more efficient way to do this. I am using LINQ to EF, but I materialize the products to a list first for performance reasons. productNames is a List of product names (input by the user). products is a List of product 'records' var directMatches = (from s in productNames join p in products on s.ToLower() equals p.name.ToLower() into result from r in result.DefaultIfEmpty() select new {Key = s, Product = r}); var containsMatches = (from d in directMatches from p in products where d.Product == null && p.name.ToLower().Contains(d.Key) select new { d.Key, Product = p }); var matches = from d in directMatches join c in containsMatches on d.Key equals c.Key into result from r in result.DefaultIfEmpty() select new {d.Key, Product = d.Product ?? (r != null ? r.Product: null) };

  Read the article

• Howw to add new value with generic Repository if there are foreign keys (EF-4)?

  - by Phsika

  i try to write a kind of generic repository to add method. Everything is ok to add but I have table which is related with two tables with FOREIGN KEY.But Not working because of foreign key public class DomainRepository<TModel> : IDomainRepository<TModel> where TModel : class { #region IDomainRepository<T> Members private ObjectContext _context; private IObjectSet<TModel> _objectSet; public DomainRepository() { } public DomainRepository(ObjectContext context) { _context = context; _objectSet = _context.CreateObjectSet<TModel>(); } //do something..... public TModel Add<TModel>(TModel entity) where TModel : IEntityWithKey { EntityKey key; object originalItem; key = _context.CreateEntityKey(entity.GetType().Name, entity); _context.AddObject(key.EntitySetName, entity); _context.SaveChanges(); return entity; } //do something..... } Calling REPOSITORY: //insert-update-delete public partial class AddtoTables { public table3 Add(int TaskId, int RefAircraftsId) { using (DomainRepository<table3> repTask = new DomainRepository<table3>(new TaskEntities())) { return repTask.Add<table3>(new table3() { TaskId = TaskId, TaskRefAircraftsID = RefAircraftsId }); } } } How to add a new value if this table includes foreign key relation

  Read the article

• Need a refresher course on property access...

  - by Code Sherpa

  Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

  Read the article

• F# ref-mutable vars vs object fields

  - by rwallace

  I'm writing a parser in F#, and it needs to be as fast as possible (I'm hoping to parse a 100 MB file in less than a minute). As normal, it uses mutable variables to store the next available character and the next available token (i.e. both the lexer and the parser proper use one unit of lookahead). My current partial implementation uses local variables for these. Since closure variables can't be mutable (anyone know the reason for this?) I've declared them as ref: let rec read file includepath = let c = ref ' ' let k = ref NONE let sb = new StringBuilder() use stream = File.OpenText file let readc() = c := stream.Read() |> char // etc I assume this has some overhead (not much, I know, but I'm trying for maximum speed here), and it's a little inelegant. The most obvious alternative would be to create a parser class object and have the mutable variables be fields in it. Does anyone know which is likely to be faster? Is there any consensus on which is considered better/more idiomatic style? Is there another option I'm missing?

  Read the article

• summing functions handles in matlab

  - by user552231

  Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

  Read the article

• Java: fastest way to do random reads on huge disk file(s)

  - by cocotwo

  I've got a moderately big set of data, about 800 MB or so, that is basically some big precomputed table that I need to speed some computation by several orders of magnitude (creating that file took several mutlicores computers days to produce using an optimized and multi-threaded algo... I do really need that file). Now that it has been computed once, that 800MB of data is read only. I cannot hold it in memory. As of now it is one big huge 800MB file but splitting in into smaller files ain't a problem if it can help. I need to read about 32 bits of data here and there in that file a lot of time. I don't know before hand where I'll need to read these data: the reads are uniformly distributed. What would be the fastest way in Java to do my random reads in such a file or files? Ideally I should be doing these reads from several unrelated threads (but I could queue the reads in a single thread if needed). Is Java NIO the way to go? I'm not familiar with 'memory mapped file': I think I don't want to map the 800 MB in memory. All I want is the fastest random reads I can get to access these 800MB of disk-based data. btw in case people wonder this is not at all the same as the question I asked not long ago: http://stackoverflow.com/questions/2346722/java-fast-disk-based-hash-set

  Read the article

• ASP.MVC 2 Model Data Persistance

  - by toccig

  I'm and MVC1 programmer, new to the MVC2. The data will not persist to the database in an edit scenario. Create works fine. Controller: // // POST: /Attendee/Edit/5 [Authorize(Roles = "Admin")] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(Attendee attendee) { if (ModelState.IsValid) { UpdateModel(attendee, "Attendee"); repository.Save(); return RedirectToAction("Details", attendee); } else { return View(attendee); } } Model: [MetadataType(typeof(Attendee_Validation))] public partial class Attendee { } public class Attendee_Validation { [HiddenInput(DisplayValue = false)] public int attendee_id { get; set; } [HiddenInput(DisplayValue = false)] public int attendee_pin { get; set; } [Required(ErrorMessage = "* required")] [StringLength(50, ErrorMessage = "* Must be under 50 characters")] public string attendee_fname { get; set; } [StringLength(50, ErrorMessage = "* Must be under 50 characters")] public string attendee_mname { get; set; } } I tried to add [Bind(Exclude="attendee_id")] above the Class declaration, but then the value of the attendee_id attribute is set to '0'. View (Strongly-Typed): <% using (Html.BeginForm()) {%> ... <%=Html.Hidden("attendee_id", Model.attendee_id) %> ... <%=Html.SubmitButton("btnSubmit", "Save") %> <% } %> Basically, the repository.Save(); function seems to do nothing. I imagine it has something to do with a primary key constraint violation. But I'm not getting any errors from SQL Server. The application appears to runs fine, but the data is never persisted to the Database.

  Read the article

• DBD::CSV: Problem with userdefined functions

  - by sid_com

  From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• WPF app startup problems

  - by Dave

  My brain is all over the map trying to fully understand Unity right now. So I decided to just dive in and start adding it in a branch to see where it takes me. Surprisingly enough (or maybe not), I am stuck just getting my darn Application to load properly. It seems like the right way to do this is to override OnStartup in App.cs. I've removed my StartupUri from App.xaml so it doesn't create my GUI XAML. My App.cs now looks something like this: public partial class App : Application { private IUnityContainer container { get; set; } protected override void OnStartup(StartupEventArgs e) { container = new UnityContainer(); GUI gui = new GUI(); gui.Show(); } protected override void OnExit(ExitEventArgs e) { container.Dispose(); base.OnExit(e); } } The problem is that nothing happens when I start the app! I put a breakpoint at the container assignment, and it never gets hit. What am I missing? App.xaml is currently set to ApplicationDefinition, but I'd expect this to work because some sample Unity + WPF code I'm looking at (from Codeplex) does the exact same thing, except that it works! I've also started the app by single-stepping, and it eventually hits the first line in App.xaml. When I step into this line, that's when the app just starts "running", but I don't see anything (and my breakpoint isn't hit). If I do the exact same thing in the sample application, stepping into App.xaml puts me right into OnStartup, which is what I'd expect to happen. Argh! Is it a Bad Thing to just put the Unity construction in my GUI's Window_Loaded event handler? Does it really need to be at the App level?

  Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >