Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 281/336 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • Am I fundamentally misunderstanding how Silverlight runs? (debugging issues)

    - by SP
    I've got a vs2010 solution containing an ASP.Net 4 website, and a Silverlight 4 project. The website is linked to the Silverlight project ('Map') and the ClientBin folder contains a Map.xap file. The Map project is very simple. It contains the default App.xaml and App.xaml.cs files. The MainPage.xaml file looks like this <UserControl x:Class="Map.MainPage" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" mc:Ignorable="d" d:DesignHeight="380" d:DesignWidth="800"> <Canvas x:Name="MainCanvas" Width="800" Height="380"> <Canvas.Background> <ImageBrush ImageSource="map.png" Stretch="None"/> </Canvas.Background> </Canvas> The code behind for that looks like this: public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); throw new Exception(); } } Inside one of the website pages I have the default object pointing to my Silverlight xap When I run the website, I see my background image on the Canvas in the Silverlight window, so I know it's working in that sense. However, I cannot break on any breakpoints set in the MainPage.xaml.cs file (in IE). I have checked the correct settings for Silverlight debugging. And see that Exception I'm throwing in the MainPage constructor? I'm not seeing that either. In fact, nothing I put in there seems to be run at all, but I know the xaml is rendering because I can see my canvas background. What am I not getting here?

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • How can I build a generic dataset-handling Perl library?

    - by Pep.
    Hello, I want to build a generic Perl module for handling and analysing biomedical character separated datasets and which can, most certain, be used on any kind of datasets that contain a mixture of categorical (A,B,C,..) and continuous (1.2,3,881..) and identifier (XXX1,XXX2...). The plan is to have people initialize the module and then use some arguments to point to the data file(s), the place were the analysis reports should be placed and the structure of the data. By structure of data I mean which variable is in which place and its name/type. And this is where I need some enlightenment. I am baffled how to do this in a clean way. Obviously, having people create a simple schema file, be it XML or some other format would be the cleanest but maybe not all people enjoy doing something like this. The solutions I can think of are: Create a configuration file in XML or similar and with a prespecified format. Pass the information during initialization of the module. Use the first row of the data as headers and try to guess types (ouch) Surely there must be a "canonical" way of doing this that is also usable and efficient. Thanks p.

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • Refining Search Results [PHP/MySQL]

    - by Dae
    I'm creating a set of search panes that allow users to tweak their results set after submitting a query. We pull commonly occurring values in certain fields from the results and display them in order of their popularity - you've all seen this sort of thing on eBay. So, if a lot of rows in our results were created in 2009, we'll be able to click "2009" and see only rows created in that year. What in your opinion is the most efficient way of applying these filters? My working solution was to discard entries from the results that didn't match the extra arguments, like: while($row = mysql_fetch_assoc($query)) { foreach($_GET as $key => $val) { if($val !== $row[$key]) { continue 2; } } // Output... } This method should hopefully only query the database once in effect, as adding filters doesn't change the query - MySQL can cache and reuse one data set. On the downside it makes pagination a bit of a headache. The obvious alternative would be to build any additional criteria into the initial query, something like: $sql = "SELECT * FROM tbl MATCH (title, description) AGAINST ('$search_term')"; foreach($_GET as $key => $var) { $sql .= " AND ".$key." = ".$var; } Are there good reasons to do this instead? Or are there better options altogether? Maybe a temporary table? Any thoughts much appreciated!

    Read the article

  • Breaking dependencies when you can't make changes to other files?

    - by codemuncher
    I'm doing some stealth agile development on a project. The lead programmer sees unit testing, refactoring, etc as a waste of resources and there is no way to convince him otherwise. His philosophy is "If it ain't broke don't fix it" and I understand his point of view. He's been working on the project for over a decade and knows the code inside and out. I'm not looking to debate development practices. I'm new to the project and I've been tasked with adding a new feature. I've worked on legacy projects before and used agile development practices with good result but those teams were more receptive to the idea and weren't afraid of making changes to code. I've been told I can use whatever development methodology I want but I have to limit my changes to only those necessary to add the feature. I'm using tdd for the new classes I'm writing but I keep running into road blocks caused by the liberal use of global variables and the high coupling in the classes I need to interact with. Normally I'd start extracting interfaces for these classes and make their dependence on the global variables explicit by injecting them as constructor arguments or public properties. I could argue that the changes are necessary but considering the lead never had to make them I doubt he would see it my way. What techniques can I use to break these dependencies without ruffling the lead developer's feathers? I've made some headway using: Extract Interface (for the new classes I'm creating) Extend and override the wayward classes with test stubs. (luckily most methods are public virtual) But these two can only get me so far.

    Read the article

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • Generating jquery 'rules' from business model to UI in asp.net mvc

    - by jim
    Hi all, I've had a good look around and am certain that there's no matching question on SO, so here goes. Has anyone created a 'helper' method on their model that generates jquery (or plain javascript) rules validation dynamically, based on the criteria/rules that are contained within the object and taken from a repository (i.e. DB). What i'm thinking of is a discrete set of partial views (and associated models) that have rules at the business logic 'level' and rather than (or in combination with) validating the rule(s) at postback, translating the same rules into tightly focussed jquery methods that work identically at client (js) and server (c#) levels. I can see benefits here re performance. Also, the rules definitions could be created in a single place (in c#) and the jquery generated off of that, thus allowing single edits to update both code streams. I appreciate that there would be limitations imposed by language specific contstraints but the general principle could be quite interesting if used appropriately. I'm also aware that testibility could be an issue when using two different language structures and hoping to achieve similar test outcomes - but those aside... any thoughts or experiences of similar out there?? cheers jimi

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • winUserControl in VS2010 - properties are not visible in designer

    - by mj82
    I have a problem with (I suppose) my Visual Studio 2010 Express environment: when I design my own UserControl, in Properties grid I can't see public properties of that control. They are however visible in the project, that reference this control. As it's Express Edition, I create new empty project, then add new UserControl to it. Then, for a test, I put following code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Drawing; using System.Data; using System.Linq; using System.Text; using System.Windows.Forms; namespace Project1 { public partial class UserControl1 : UserControl { private int myNumber; [Browsable(true)] public int MyNumber { get { return myNumber; } set { myNumber = value; } } public UserControl1() { InitializeComponent(); } } } In VS 2008, as I remember, that should be enogh to show MyNumber property in Properties grid, even without [Browsable(true)] attribute. In VS 2010 however, when I double click UserControl1.cs in Solution Explorer and look in Properties, I don't see MyNumber. When I reference and use this control in another project, there is an access to it's properties. I've tried to competly reinstall VS 2010 environment, including SP1, but with no success. Do you have any idea what can be wrong? By the way: none of these attributes are working, either: [Browsable(true)] [EditorBrowsable(EditorBrowsableState.Always)] [DesignerSerializationVisibility(DesignerSerializationVisibility.Content)] [Bindable(true)] Best regards, Marcin

    Read the article

  • recvfrom returns invalid argument when *from* is passed

    - by Aditya Sehgal
    I am currently writing a small UDP server program in linux. The UDP server will receive packets from two different peers and will perform different operations based on from which peer it received the packet. I am trying to determine the source from where I receive the packet. However, when select returns and recvfrom is called, it returns with an error of Invalid Argument. If I pass NULL as the second last arguments, recvfrom succeeds. I have tried declaring fromAddr as struct sockaddr_storage, struct sockaddr_in, struct sockaddr without any success. Is their something wrong with this code? Is this the correct way to determine the source of the packet? The code snippet follows. ` /*TODO : update for TCP. use recv */ if((pkInfo->rcvLen=recvfrom(psInfo->sockFd, pkInfo->buffer, MAX_PKTSZ, 0, /* (struct sockaddr*)&fromAddr,*/ NULL, &(addrLen) )) < 0) { perror("RecvFrom failed\n"); } else { /*Apply Filter */ #if 0 struct sockaddr_in* tmpAddr; tmpAddr = (struct sockaddr_in* )&fromAddr; printf("Received Msg From %s\n",inet_ntoa(tmpAddr->sin_addr)); #endif printf("Packet Received of len = %d\n",pkInfo->rcvLen); } `

    Read the article

  • C: incompatible types in assignment

    - by The.Anti.9
    I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

    Read the article

  • Stuck trying to get Log4Net to work with Dependency Injection

    - by Pure.Krome
    I've got a simple winform test app i'm using to try some Log4Net Dependency Injection stuff. I've made a simple interface in my Services project :- public interface ILogging { void Debug(string message); // snip the other's. } Then my concrete type will be using Log4Net... public class Log4NetLogging : ILogging { private static ILog Log4Net { get { return LogManager.GetLogger( MethodBase.GetCurrentMethod().DeclaringType); } } public void Debug(string message) { if (Log4Net.IsDebugEnabled) { Log4Net.Debug(message); } } } So far so good. Nothing too hard there. Now, in a different project (and therefore namesapce), I try and use this ... public partial class Form1 : Form { public Form1() { FileInfo fileInfo = new FileInfo("Log4Net.config"); log4net.Config.XmlConfigurator.Configure(fileInfo); } private void Foo() { // This would be handled with DI, but i've not set it up // (on the constructor, in this code example). ILogging logging = new Log4NetLogging(); logging.Debug("Test message"); } } Ok .. also pretty simple. I've hardcoded the ILogging instance but that is usually dependency injected via the constructor. Anyways, when i check this line of code... return LogManager.GetLogger(MethodBase.GetCurrentMethod().DeclaringType); the DeclaringType type value is of the Service namespace, not the type of the Form (ie. X.Y.Z.Form1) which actually called the method. Without passing the type INTO method as another argument, is there anyway using reflection to figure out the real method that called it?

    Read the article

  • F# ref-mutable vars vs object fields

    - by rwallace
    I'm writing a parser in F#, and it needs to be as fast as possible (I'm hoping to parse a 100 MB file in less than a minute). As normal, it uses mutable variables to store the next available character and the next available token (i.e. both the lexer and the parser proper use one unit of lookahead). My current partial implementation uses local variables for these. Since closure variables can't be mutable (anyone know the reason for this?) I've declared them as ref: let rec read file includepath = let c = ref ' ' let k = ref NONE let sb = new StringBuilder() use stream = File.OpenText file let readc() = c := stream.Read() |> char // etc I assume this has some overhead (not much, I know, but I'm trying for maximum speed here), and it's a little inelegant. The most obvious alternative would be to create a parser class object and have the mutable variables be fields in it. Does anyone know which is likely to be faster? Is there any consensus on which is considered better/more idiomatic style? Is there another option I'm missing?

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • Need a refresher course on property access...

    - by Code Sherpa
    Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

    Read the article

  • ASP.MVC 2 Model Data Persistance

    - by toccig
    I'm and MVC1 programmer, new to the MVC2. The data will not persist to the database in an edit scenario. Create works fine. Controller: // // POST: /Attendee/Edit/5 [Authorize(Roles = "Admin")] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(Attendee attendee) { if (ModelState.IsValid) { UpdateModel(attendee, "Attendee"); repository.Save(); return RedirectToAction("Details", attendee); } else { return View(attendee); } } Model: [MetadataType(typeof(Attendee_Validation))] public partial class Attendee { } public class Attendee_Validation { [HiddenInput(DisplayValue = false)] public int attendee_id { get; set; } [HiddenInput(DisplayValue = false)] public int attendee_pin { get; set; } [Required(ErrorMessage = "* required")] [StringLength(50, ErrorMessage = "* Must be under 50 characters")] public string attendee_fname { get; set; } [StringLength(50, ErrorMessage = "* Must be under 50 characters")] public string attendee_mname { get; set; } } I tried to add [Bind(Exclude="attendee_id")] above the Class declaration, but then the value of the attendee_id attribute is set to '0'. View (Strongly-Typed): <% using (Html.BeginForm()) {%> ... <%=Html.Hidden("attendee_id", Model.attendee_id) %> ... <%=Html.SubmitButton("btnSubmit", "Save") %> <% } %> Basically, the repository.Save(); function seems to do nothing. I imagine it has something to do with a primary key constraint violation. But I'm not getting any errors from SQL Server. The application appears to runs fine, but the data is never persisted to the Database.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Java: fastest way to do random reads on huge disk file(s)

    - by cocotwo
    I've got a moderately big set of data, about 800 MB or so, that is basically some big precomputed table that I need to speed some computation by several orders of magnitude (creating that file took several mutlicores computers days to produce using an optimized and multi-threaded algo... I do really need that file). Now that it has been computed once, that 800MB of data is read only. I cannot hold it in memory. As of now it is one big huge 800MB file but splitting in into smaller files ain't a problem if it can help. I need to read about 32 bits of data here and there in that file a lot of time. I don't know before hand where I'll need to read these data: the reads are uniformly distributed. What would be the fastest way in Java to do my random reads in such a file or files? Ideally I should be doing these reads from several unrelated threads (but I could queue the reads in a single thread if needed). Is Java NIO the way to go? I'm not familiar with 'memory mapped file': I think I don't want to map the 800 MB in memory. All I want is the fastest random reads I can get to access these 800MB of disk-based data. btw in case people wonder this is not at all the same as the question I asked not long ago: http://stackoverflow.com/questions/2346722/java-fast-disk-based-hash-set

    Read the article

  • Eclipse > Javascript > Code highlighting not working with Object Notation

    - by Redsandro
    I am using Eclipse Helios with PDT, and when I am editing JavaScript files with the default JavaScript Editor (JSDT), code highlighting (Mark Occurrences) is not working for half of the code, for example JSON-style (or Object Literal if you will) declarations. Little example: Foo = {}; Foo.Bar = Foo.Bar || {}; Foo.Bar = { bar: function(str) { alert(str) }, baz: function(str) { this.bar(str); // This bar *is* highlighted though } }; Foo.Bar.baz('text'); No Bar, bar or baz is highlighted. For now, I humbly edit the JavaScript part of projects in Notepad++ because it just highlights every occurrence of whatever is currently selected. Is there a common practice for Eclipse JavaScript developers to get code highlighting work correctly, using the popular Object Literal notation? An option or update I missed? -update- I have found that code highlighting depends on the code being properly outlined. Altough commonly used, Object Literal outlining still seems rare in javascript editors. the Spket Javascript Editor does partial Object Literal outlining, and the Aptana Javascript Editor does full Object Literal outlining. But both loses other important functionality. A quest for the editor with the least loss of functionality is currently in progress in this question.

    Read the article

  • Symbols (pdb) for native dll are not loaded due to post build step

    - by sean e
    I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

    Read the article

  • how can access public properties of MasterPage from external Class ?

    - by eugeneK
    Why i can't access MasterPage's public property (MessagePlaceholder) from other Class (Errors) ? Error compiler gives me is "Error 1 The type or namespace name 'MyMasterPage' could not be found (are you missing a using directive or an assembly reference?)" my master page code behind using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; public partial class MyMasterPage : System.Web.UI.MasterPage { public string MessagePlaceholder { get { return messagePlaceholder.InnerHtml; } set { messagePlaceholder.InnerHtml = value; } } protected void Page_Load(object sender, EventArgs e) { if (!IsPostBack) { messagePlaceholder.InnerHtml = Errors.getMessage(); } } } my Errors Class public static string getMessage() { HttpContext c = HttpContext.Current; string messageType = ""; if (c.Session["errorMessage"] != null) { messageType = "errorMessage"; } else if (c.Session["successMessage"] != null) { messageType = "successMessage"; } if (!string.IsNullOrEmpty(messageType)) { StringBuilder userMessageSb = new StringBuilder(); userMessageSb.Append(string.Format("<div id=\"{0}\" title=\"{1}\">{2}</div>", messageType, messageType.Replace("Message",string.Empty), c.Session[messageType])); // fix so message will not re-appear c.Session.Remove(messageType); messageType = userMessageSb.ToString(); } return messageType; } public static void setSuccess(string successMessage, bool isRedirect) { HttpContext.Current.Session["successMessage"] = successMessage; } public static void setError(string errorMessage, bool isRedirect) { HttpContext.Current.Session["errorMessage"] = errorMessage; if (!isRedirect) { ((HttpContext.Current.CurrentHandler as System.Web.UI.Page).Master as MyMasterPage).MessagePlaceholder = getMessage(); } } this is how i set error if (true) { Errors.setError("this is an error demo", false); return; } or with redirect after error if (true) { Errors.setError("yet another error", true); Response.Redirect("~/error.aspx"); }

    Read the article

  • How do I get rid of this "(" using regex?

    - by Solignis
    Hi there, I was moving along on a regex expression and I have hit a road block I can't seem to get around. I am trying to get rid of "(" in the middle of a line of text using regex, there were 2 but I figured out how to get the one on the end of the line. its the one in the middle I can hack out. Here is the snippet I am searching for in the config file. I put 2 examples. guestOSAltName = "Ubuntu Linux (64-bit)" guestOSAltName = "Microsoft Windows 2000 Professional" Here is the snippet I am working on. if ($vmx_file =~ m/^\bguestOSAltName\b\s+\S\s+\W(?<GUEST_OS> .+[^")])\W/xm) { $virtual_machines{$vm}{"OS"} = "$+{GUEST_OS}"; } else { $virtual_machines{$vm}{"OS"} = "N/A"; } I am thinking the problem is I cannot make a match to "(" because the expression before that is to ".+" so that it matches everything in the line of text, be it alphanumeric or whitespace or even symbols like hypens. Any ideas how I can get this to work? This is what I am getting for an output from a hash dump. $VAR1 = { 'NS02' => { 'ID' => '144', 'Version' => '7', 'OS' => 'Ubuntu Linux (64-bit', 'VMX' => '/vmfs/volumes/datastore2/NS02/NS02.vmx', 'Architecture' => '64-bit' },

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >