Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 283/336 | < Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >

  • Howw to add new value with generic Repository if there are foreign keys (EF-4)?

    - by Phsika
    i try to write a kind of generic repository to add method. Everything is ok to add but I have table which is related with two tables with FOREIGN KEY.But Not working because of foreign key public class DomainRepository<TModel> : IDomainRepository<TModel> where TModel : class { #region IDomainRepository<T> Members private ObjectContext _context; private IObjectSet<TModel> _objectSet; public DomainRepository() { } public DomainRepository(ObjectContext context) { _context = context; _objectSet = _context.CreateObjectSet<TModel>(); } //do something..... public TModel Add<TModel>(TModel entity) where TModel : IEntityWithKey { EntityKey key; object originalItem; key = _context.CreateEntityKey(entity.GetType().Name, entity); _context.AddObject(key.EntitySetName, entity); _context.SaveChanges(); return entity; } //do something..... } Calling REPOSITORY: //insert-update-delete public partial class AddtoTables { public table3 Add(int TaskId, int RefAircraftsId) { using (DomainRepository<table3> repTask = new DomainRepository<table3>(new TaskEntities())) { return repTask.Add<table3>(new table3() { TaskId = TaskId, TaskRefAircraftsID = RefAircraftsId }); } } } How to add a new value if this table includes foreign key relation

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • What else I must do allow my method to handle any type of objects

    - by NewHelpNeeder
    So to allow any type object I must use generics in my code. I have rewrote this method to do so, but then when I create an object, for example Milk, it won't let me pass it to my method. Ether there's something wrong with my generic revision, or Milk object I created is not good. How should I pass my object correctly and add it to linked list? This is a method that causes error when I insert an item: public void insertFirst(T dd) // insert at front of list { Link newLink = new Link(dd); // make new link if( isEmpty() ) // if empty list, last = newLink; // newLink <-- last else first.previous = newLink; // newLink <-- old first newLink.next = first; // newLink --> old first first = newLink; // first --> newLink } This is my class I try to insert into linked list: class Milk { String brand; double size; double price; Milk(String a, double b, double c) { brand = a; size = b; price = c; } } This is test method to insert the data: public static void main(String[] args) { // make a new list DoublyLinkedList theList = new DoublyLinkedList(); // this causes: // The method insertFirst(Comparable) in the type DoublyLinkedList is not applicable for the arguments (Milk) theList.insertFirst(new Milk("brand", 1, 2)); // insert at front theList.displayForward(); // display list forward theList.displayBackward(); // display list backward } // end main() } // end class DoublyLinkedApp Declarations: class Link<T extends Comparable<T>> {} class DoublyLinkedList<T extends Comparable<T>> {}

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • WPF app startup problems

    - by Dave
    My brain is all over the map trying to fully understand Unity right now. So I decided to just dive in and start adding it in a branch to see where it takes me. Surprisingly enough (or maybe not), I am stuck just getting my darn Application to load properly. It seems like the right way to do this is to override OnStartup in App.cs. I've removed my StartupUri from App.xaml so it doesn't create my GUI XAML. My App.cs now looks something like this: public partial class App : Application { private IUnityContainer container { get; set; } protected override void OnStartup(StartupEventArgs e) { container = new UnityContainer(); GUI gui = new GUI(); gui.Show(); } protected override void OnExit(ExitEventArgs e) { container.Dispose(); base.OnExit(e); } } The problem is that nothing happens when I start the app! I put a breakpoint at the container assignment, and it never gets hit. What am I missing? App.xaml is currently set to ApplicationDefinition, but I'd expect this to work because some sample Unity + WPF code I'm looking at (from Codeplex) does the exact same thing, except that it works! I've also started the app by single-stepping, and it eventually hits the first line in App.xaml. When I step into this line, that's when the app just starts "running", but I don't see anything (and my breakpoint isn't hit). If I do the exact same thing in the sample application, stepping into App.xaml puts me right into OnStartup, which is what I'd expect to happen. Argh! Is it a Bad Thing to just put the Unity construction in my GUI's Window_Loaded event handler? Does it really need to be at the App level?

    Read the article

  • creating an object within a function of a program

    - by user1066524
    could someone please tell me what I need to do in order to create an object in a function. I will try to explain by making up some sort of example... Let's say I have a program named TimeScheduler.cpp that implements the class Schedule.h (and I have the implementation in a separate file Schedule.cpp where we define the methods). In the declaration file we have declared two constructors Schedule(); //the default and Schedule(int, int, int);//accepts three arguments to get to the point--let's say in the main program file TimeScheduler.cpp we created our own functions in this program apart from the functions inherited from the class Schedule. so we have our prototypes listed at the top. /*prototypes*/ void makeSomeTime(); etc..... we have main(){ //etc etc... } we then define these program functions void makeSomeTime(){ //process } let's say that inside the function makeSomeTime(), we would like to create an array of Schedule objects like this Schedule ob[]={ summer(5,14, 49), fall(9,25,50) }; what do I have to do to the function makeSomeTime() in order for it to allow me to create this array of objects. The reason I ask is currently i'm having difficulty with my own program in that it WILL allow me to create this array of objects in main()....but NOT in a function like I just gave an example of. The strange thing is it will allow me to create a dynamic array of objects in the function..... like Schedule *ob = new Schedule[n+1]; ob[2]= Schedule(x,y,z); Why would it let me assign to a non-dynamic array in main(), but not let me do that in the function?

    Read the article

  • Android : start intent in setOnClickListener

    - by Derek
    I have a button, and this button is going to get the values from EditText, then using this value to start a new Intent protected void onCreate(Bundle savedInstanceState) { textDay = (EditText) findViewById(R.id.textDay); textMonth = (EditText) findViewById(R.id.textMonth); textYear = (EditText) findViewById(R.id.textYear); gen = (Button) findViewById(R.id.getGraph); gen.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { getthisIntent(); } public Intent getthisIntent(Context context) { day = textDay.getText(); month = textMonth.getText(); year = textYear.getText(); date = day + "/" + month + "/" + year; . .// Plot graph using AchartEngine, then return an Intent // . } } }); but i get the error "The method getthisIntent(Context) in the type new View.OnClickListener(){} is not applicable for the arguments ()" Can i get some help? or do i have another alternative solution, when i click the button, then the button pass the values to the new intent, and start it without having a new xxx.java file? Edit This is basically what I am doing now, i need to get the things inserted by user, and plot a graph, the only way i know how to plot graph using AchartEngine is create a new activity with define this public Intent getthisIntent(Context context) To be honest, i dont really know what the hell I am doing, please correct me...

    Read the article

  • How to get drag working properly in silverlight when mouse is not pressed ?

    - by Mrt
    Hello, I have the following code xaml <Canvas x:Name="LayoutRoot" > <Rectangle Canvas.Left="40" Canvas.Top="40" Width="20" Height="20" Name="rec" Fill="Red" MouseLeftButtonDown="rec_MouseLeftButtonDown" MouseMove="rec_MouseMove" /> </Canvas> code behind public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); } public Point LastDragPosition { get; set; } private bool isDragging; private void rec_MouseMove(object sender, MouseEventArgs e) { if(!isDragging) { return; } var position = e.GetPosition(rec as UIElement); var newPosition = new Point( Canvas.GetLeft(rec) + position.X - LastDragPosition.X, Canvas.GetTop(rec) + position.Y - LastDragPosition.Y); Canvas.SetLeft(rec, newPosition.X); Canvas.SetTop(rec, newPosition.Y); LastDragPosition = e.GetPosition(rec as UIElement); } private void rec_MouseLeftButtonDown(object sender, MouseButtonEventArgs e) { isDragging = true; LastDragPosition = e.GetPosition(sender as UIElement); rec.CaptureMouse(); } } This issue is the rectangle follows the mouse if the mouse left button is down, but I would like the rectangle to move even when the mouse left button isn't down. It works, but if you move the mouse very slowly. If you move the mouse to quickly the rectangle stops moving (is the mouse capture lost ?) Cheers,

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Sharing rails fragments between formats

    - by Julian
    Hi I'm toying with mobile_fu and want to share some fragments between the different views. E.g. views/ item/ view.html.erb view.mobile.rb shared/ _common.erb In both view.html.erb and view.mobile.erb I want to share the same fragment '_common.erb' without having to specify the format (should you ever have to specify the format inside a fragment? It doesn't seem like The Rails Way?). Let's say for arguments's sake it's because it's in a helper or whatever -- the point is that I need to share fragments in a 'well-defined and Railsy way' across formats. Let's take this fairly innocuous snippet <% render :fragment => 'shared/common' %> I've tried 3 file name conventions: _common.html.erb only works for html /item/view/xx fails with 'shared/_common.erb not found') however _common.erb fails for html and works for mobile (maybe mobile_fu is doing something wacky?) -- same error as for .html.erb version above _common.rhtml does work for both I'm thinking that: that rhtml works for both is a legacy hack and I'm loathe to rename all the shared fragments .rhtml to get the behaviour I want. Any feedback gratefully welcome! Including 'you fundamentally don't understand how Rails works please RTFM here: http://....' :)

    Read the article

  • Pass List of models to controller ASP.NET MVC 5

    - by user3697231
    I have a view where user can enter some data. But problem is this: Let's say you have 3 text box on view. Every time user can fill multiple times this 3 text boxes. To clarify, let's say user fills this 3 text boxes and press button which adds on form again these 3 text boxes. Now when user clicks submit this form is sent to controller, but how do I sent List of models as parameter. My architecture for this problem is something like this: MyModel public int ID { get;set; } public string Something { get; set; } /*This three textboxes can user set multiple times*/ /*Perhaps i Can create new model with these properties and then /*put List of that model as property here, but how to fill that list inside view ??*/ public string TextBoxOneValue { get; set; } public string TextBoxTwoValue { get; set; } public string TextBoxThreeValue { get; set; } Now, i was thinking that i Create PartialView with this 3 text boxes, and then when user clicks button on view another PartialView is loaded. And now, let's say I have Two partial views loaded, and user clicks submit, how that I pass list with values of these 3 text boxes to controller ??

    Read the article

  • Does anyone know why jquery dialog is showing stale content on ajax update ?

    - by oo
    I have a series of links and when i click on a link i want to show a dialog with detail information. This detail is returned from an jquery ajax request. I am using the following code below to show a partial result through ajax onto a jquery dialog. Here is the jquery code: $(document).ready(function() { $('a.click').live('click', function() { var url = '/Tracker/Info?id=' + $(this).attr("id"); var dialogOpts = { modal: true, bgiframe: true, autoOpen: false, height: 600, width: 450, overlay: { opacity: 0.7, background: "black" }, draggable: true, resizeable: true, open: function() { //display correct dialog content $("#dialogDiv").load(url); } }; $("#dialogDiv").dialog(dialogOpts); //end dialog $("#dialogDiv").dialog("open"); }); }); Here is my controller action code: public ActionResult Info(int id) { return PartialView("LabelPartialView", _Repository.GetItem(id)); } Here is the issue: When i click this the first time (lets say i send id = 1234) it works fine. When i click on another item (lets say i send id = 4567) it shows the content from 1234 still. Which i click this second item again (again its 4567), then it will show the content from 4567. Does anyone know why it might not be refreshed the first time? Is this a timing issue?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Problems with binding to Window Height and Width

    - by D.H.
    I have some problems when I try to bind the height and width of a window to properties in my view model. Here is a small sample app to illustrate the problem. This is the code in app.xaml.xs public partial class App : Application { protected override void OnStartup(StartupEventArgs e) { base.OnStartup(e); MainWindow mainWindow = new MainWindow(); MainWindowViewModel mainWindowViewModel = new MainWindowViewModel(); mainWindow.DataContext = mainWindowViewModel; mainWindow.Show(); } } This is MainWindow.xaml: <Window x:Class="TestApp.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Height="{Binding WindowHeight}" Width="{Binding WindowWidth}" BorderThickness="{Binding WindowBorderThickness}"> </Window> And this is the view model: public class MainWindowViewModel { public int WindowWidth { get { return 100; } } public int WindowHeight { get { return 200; } } public int WindowBorderThickness { get { return 8; } } } When the program is started the getters of WindowHeight and WindowBorderThickness (but not WindowWidth) are called, so the height and the border of the window is set properly, but not the width. I then add button that will trigger PropertyChanged for all properties, so that the view model now looks like this: public class MainWindowViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public void TriggerPropertyChanges() { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs("WindowWidth")); PropertyChanged(this, new PropertyChangedEventArgs("WindowHeight")); PropertyChanged(this, new PropertyChangedEventArgs("WindowBorderThickness")); } } public ICommand ButtonCommand { get { return new RelayCommand(delegate { TriggerPropertyChanges(); }); } } public int WindowWidth { get { return 100; } } public int WindowHeight { get { return 200; } } public int WindowBorderThickness { get { return 8; } } } Now, when I click the button, the getter of WindowBorderThickness is called, but not the ones for WindowWidth and WindowHeight. It all just seems very weird and inconsistent to me. What am I missing?

    Read the article

  • How to throw meaningful data in exceptions ?

    - by ZeroCool
    I would like to throw exceptions with meaningful explanation ! I thought of using variable arguments worked fine but lately I figured out it's impossible to extend the class in order to implement other exception types. So I figured out using an std::ostreamstring as a an internal buffer to deal with formatting ... but doesn't compile! I guess it has something to deal with copy constructors. Anyhow here is my piece of code: class Exception: public std::exception { public: Exception(const char *fmt, ...); Exception(const char *fname, const char *funcname, int line, const char *fmt, ...); //std::ostringstream &Get() { return os_ ; } ~Exception() throw(); virtual const char *what() const throw(); protected: char err_msg_[ERRBUFSIZ]; //std::ostringstream os_; }; The variable argumens constructor can't be inherited from! this is why I thought of std::ostringstream! Any advice on how to implement such approach ?

    Read the article

  • Where should my "filtering" logic reside with Linq-2-SQL and ASP.NET-MVC in View or Controller?

    - by Nate Bross
    I have a main Table, with several "child" tables. TableA and TableAChild1 and TableAChild2. I have a view which shows the information in TableA, and then has two columns of all items in TableAChild1 and TableAChild2 respectivly, they are rendered with Partial views. Both child tables have a bit field for VisibleToAll, and depending on user role, I'd like to either display all related rows, or related rows where VisibleToAll = true. This code, feels like it should be in the controller, but I'm not sure how it would look, because as it stands, the controller (limmited version) looks like this: return View("TableADetailView", repos.GetTableA(id)); Would something like this be even work, and would it be bad what if my DataContext gets submitted, would that delete all the rows that have VisibleToAll == false? var tblA = repos.GetTableA(id); tblA.TableAChild1 = tblA.TableAChild1.Where(tmp => tmp.VisibleToAll == true); tblA.TableAChild2 = tblA.TableAChild2.Where(tmp => tmp.VisibleToAll == true); return View("TableADetailView", tblA); It would also be simple to add that logic to the RendarPartial call from the main view: <% Html.RenderPartial("TableAChild1", Model.TableAChild1.Where(tmp => tmp.VisibleToAll == true); %>

    Read the article

  • Adding text read from a file to an array list in java

    - by user1824856
    I am having trouble putting text read from a file into an array list. My text looks like this: 438;MIA;JFK;10:55;1092;447 638;JFK;MIA;19:45;1092;447 689;ATL;DFW;12:50;732;448 etc... My code looks like this: package filesexample; import java.io.*; import java.io.FileNotFoundException; import java.util.Scanner; import java.util.ArrayList; /** * * @author */ public class FilesExample { /** * @param args the command line arguments */ public static void main(String[] args) throws IOException { File file = new File ("/Schedule.txt"); try { Scanner scanner= new Scanner(file);; while (scanner.hasNextLine()) { String line = scanner.nextLine(); Scanner lineScanner= new Scanner(line); lineScanner.useDelimiter(";"); while(lineScanner.hasNext()){ String part = lineScanner.next(); System.out.print(part + " "); } System.out.println(); } }catch (FileNotFoundException e){ e.printStackTrace(); } } } Some help on getting started would be much appreciated thank you!

    Read the article

  • Ruby on Rails - pass variable to nested form

    - by Krule
    I am trying to build a multilingual site using Rails, but I can't figure out how to pass variable to nested form. Right now I am creating nested form like this. @languages.each do @article.article_locale.build(:language_id => language.id) end But i would like to pass value of language to it so i can distinguish fields. Something like this. @languages.each do |language| @language = language @article.article_locale.build(:language_id => language.id) end However, I always end up with language of the last loop iteration. Any way to pass this variable? -- edit -- In the end, since I've got no answer I have solved this problem so it, at least, works as it should. Following code is my partial solution. In model: def self.languages Language.all end def self.language_name language = [] self.languages.each_with_index do |lang, i| language[i] = lang.longname end return language end In Controller: def new @article = Article.new Article.languages.each do |language| @article.article_locale.build(:language_id => language.id) end end In HAML View: -count = 0 -f.fields_for :article_locale do |al| %h3= Article.language_name[count] -count+=1 -field_set_tag do %p =al.label :name, t(:name) =al.text_field :name %p =al.label :description, t(:description) =al.text_area :description =al.hidden_field :language_id It's not the most elegant solution I suppose, but it works. I would really love if I could get rid of counter in view for instance.

    Read the article

  • Get Multiple Values From Database ASP.NET/C#

    - by user1043177
    I am trying to get/return multiple values from an SQL-Server database using and display them on an ASP.NET page. I am using a stored procedure to perform the SELECT command on the Database side. I am able to return the first value that matches the variable @PERSON but only one row is returned each time. Any help would be much appreciated. Database handler class public MainSQL() { _productConn = new SqlConnection(); _productConnectionString += "data source=mssql.database.co.uk;InitialCatalog=test_data;User ID=username;Password=password"; _productConn.ConnectionString = _productConnectionString; } public string GetItemName(int PersonID) { string returnvalue = string.Empty; SqlCommand myCommand = new SqlCommand("GetItem", _productConn); myCommand.CommandType = CommandType.StoredProcedure; myCommand.Parameters.Add(new SqlParameter("@PERSON", SqlDbType.Int)); myCommand.Parameters[0].Value = PersonID; _productConn.Open(); returnvalue = (string)myCommand.ExecuteScalar(); _productConn.Close(); return (string)returnvalue; } Stored Procedure USE [test_data] GO SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO ALTER PROCEDURE [ppir].[GetItem] ( @PERSON int ) AS /*SET NOCOUNT ON;*/ SELECT Description FROM [Items] WHERE PersonID = @PERSON RETURN return.aspx namespace test { public partial class Final_Page : System.Web.UI.Page { MainSQL GetInfo; protected void Page_Load(object sender, EventArgs e) { int PersonId = (int)Session["PersonID"]; GetInfo = new MainSQL(); string itemname = GetInfo.GetItemName(PersonId); ReturnItemName.Text = itemname; } // End Page_Load } // End Class } // End Namespace

    Read the article

  • Meaning of NEXT in Linked List creation in perl

    - by seleniumnewbie
    So I am trying to learn Linked Lists using Perl. I am reading "Mastering Algorithms with Perl" by Job Orwant. In the book he explains how to create a linked list I understand most of it, but I just simply fail to understand the command/index/key NEXT in the second last line of the code snippet. $list=undef; $tail=\$list; foreach (1..5){ my $node = [undef, $_ * $_]; $$tail = $node; $tail = \${$node->[NEXT]}; # The NEXT on this line? } What is he trying to do there? Isn $node a scalar, which stores the address of the unnamed array. Also even if we are de-referencing $node, should we not refer to the individual elements by an index number example (0,1). If we do use "NEXT" as a key, is $node a reference to a hash? I am very confused. Something in plain English will be highly appreciated.

    Read the article

  • Troubleshooting multiple GET variables In PHP

    - by V413HAV
    This may be a very simple question but I don't what's the wrong thing am doing here... To explain you clearly, I've set a real simple example below: <ul> <li><a href="test.php?link1=true">Link 1</a></li> <li><a href="test.php?link2=true">Link 2</a></li> <li><a href="test.php?link3=true">Link 3</a></li> </ul> <?php if(isset($_GET['link1'])) { if(($_GET['link1']) == 'true') { echo 'This Is Link 1'; } } if(isset($_GET['link2'])) { if(($_GET['link2']) == 'true') { echo 'This Is Link 2'; } } if(isset($_GET['link3'])) { if(($_GET['link3']) == 'true') { echo 'This Is Link 3'; } } ?> This is a test.php page, here I've set 3 different arguments for $_GET, and show contents accordingly, now everything works perfect, the only thing am not understanding is how to block this kind of url say if user clicks on link 1 the url will be : http://localhost/test.php?link1=true And the Output of this url is This is Link 1 Now if I change this url to : http://localhost/test.php?link3=true&link2=true&link1=true And the Output what I get is This Is Link 1This Is Link 2This Is Link 3 Now this is ok here, but it's very annoying if someone types this and see's forms one below the other, any way I can stop this tampering?

    Read the article

  • What can cause a spontaneous EPIPE error without either end calling close() or crashing?

    - by Hongli
    I have an application that consists of two processes (let's call them A and B), connected to each other through Unix domain sockets. Most of the time it works fine, but some users report the following behavior: A sends a request to B. This works. A now starts reading the reply from B. B sends a reply to A. The corresponding write() call returns an EPIPE error, and as a result B close() the socket. However, A did not close() the socket, nor did it crash. A's read() call returns 0, indicating end-of-file. A thinks that B prematurely closed the connection. Users have also reported variations of this behavior, e.g.: A sends a request to B. This works partially, but before the entire request is sent A's write() call returns EPIPE, and as a result A close() the socket. However B did not close() the socket, nor did it crash. B reads a partial request and then suddenly gets an EOF. The problem is I cannot reproduce this behavior locally at all. I've tried OS X and Linux. The users are on a variety of systems, mostly OS X and Linux. Things that I've already tried and considered: Double close() bugs (close() is called twice on the same file descriptor): probably not as that would result in EBADF errors, but I haven't seen them. Increasing the maximum file descriptor limit. One user reported that this worked for him, the rest reported that it did not. What else can possibly cause behavior like this? I know for certain that neither A nor B close() the socket prematurely, and I know for certain that neither of them have crashed because both A and B were able to report the error. It is as if the kernel suddenly decided to pull the plug from the socket for some reason.

    Read the article

  • Problem with incomplete input when using Attoparsec

    - by Dan Dyer
    I am converting some functioning Haskell code that uses Parsec to instead use Attoparsec in the hope of getting better performance. I have made the changes and everything compiles but my parser does not work correctly. I am parsing a file that consists of various record types, one per line. Each of my individual functions for parsing a record or comment works correctly but when I try to write a function to compile a sequence of records the parser always returns a partial result because it is expecting more input. These are the two main variations that I've tried. Both have the same problem. items :: Parser [Item] items = sepBy (comment <|> recordType1 <|> recordType2) endOfLine For this second one I changed the record/comment parsers to consume the end-of-line characters. items :: Parser [Item] items = manyTill (comment <|> recordType1 <|> recordType2) endOfInput Is there anything wrong with my approach? Is there some other way to achieve what I am attempting?

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

< Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >