Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 282/336 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

  • C#: Need one of my classes to trigger an event in another class to update a text box

    - by Matt
    Total n00b to C# and events although I have been programming for a while. I have a class containing a text box. This class creates an instance of a communication manager class that is receiving frames from the Serial Port. I have this all working fine. Every time a frame is received and its data extracted, I want a method to run in my class with the text box in order to append this frame data to the text box. So, without posting all of my code I have my form class... public partial class Form1 : Form { CommManager comm; public Form1() { InitializeComponent(); comm = new CommManager(); } private void updateTextBox() { //get new values and update textbox } . . . and I have my CommManager class class CommManager { //here we manage the comms, recieve the data and parse the frame } SO... essentially, when I parse that frame, I need the updateTextBox method from the form class to run. I'm guessing this is possible with events but I can't seem to get it to work. I tried adding an event handler in the form class after creating the instance of CommManager as below... comm = new CommManager(); comm.framePopulated += new EventHandler(updateTextBox); ...but I must be doing this wrong as the compiler doesn't like it... Any ideas?!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Is there an efficient way in LINQ to use a contains match if and only if there is no exact match?

    - by Peter
    I have an application where I am taking a large number of 'product names' input by a user and retrieving some information about each product. The problem is, the user may input a partial name or even a wrong name, so I want to return the closest matches for further selection. Essentially if product name A exactly matches a record, return that, otherwise return any contains matches. Otherwise return null. I have done this with three separate statements, and I was wondering if there was a more efficient way to do this. I am using LINQ to EF, but I materialize the products to a list first for performance reasons. productNames is a List of product names (input by the user). products is a List of product 'records' var directMatches = (from s in productNames join p in products on s.ToLower() equals p.name.ToLower() into result from r in result.DefaultIfEmpty() select new {Key = s, Product = r}); var containsMatches = (from d in directMatches from p in products where d.Product == null && p.name.ToLower().Contains(d.Key) select new { d.Key, Product = p }); var matches = from d in directMatches join c in containsMatches on d.Key equals c.Key into result from r in result.DefaultIfEmpty() select new {d.Key, Product = d.Product ?? (r != null ? r.Product: null) };

    Read the article

  • Link Button on asp.net user control not firing

    - by andyriome
    Hi I have a user control, which is added to another user control. The nested user control is built up of a gridview, an image button and a link button. The nested user control is added to the outer control as a collection object based upon the results bound to the gridview. The problem that I have is that my link button doesn't work. I click on it and the event doesn't fire. Even adding a break point was not reached. As the nested user control is added a number of times, I have set image button to have unique ids and also the link button. Whilst image button works correctly with its java script. The link button needs to fire an event in the code behind, but despite all my efforts, I can't make it work. I am adding the link button to the control dynamically. Below is the relevant code that I am using: public partial class ucCustomerDetails : System.Web.UI.UserControl { protected override void CreateChildControls( ) { base.CreateChildControls( ); string strUniqueID = lnkShowAllCust.UniqueID; strUniqueID = strUniqueID.Replace('$','_'); this.lnkShowAllCust.ID = strUniqueID; this.lnkShowAllCust.Click += new EventHandler(this.lnkShowAllCust_Click); this.Controls.Add(lnkShowAllCust); } protected override void OnInit (EventArgs e) { CreateChildControls( ); base.OnInit(e); } protected override void OnLoad(EventArgs e) { base.EnsureChildControls( ); } protected void Page_Load(object sender, EventArgs e) { if (IsPostBack) { CreateChildControls( ); } } protected void lnkShowAllCust_Click(object sender, EventArgs e) { this.OnCustShowAllClicked(new EventArgs ( )); } protected virtual void OnCustShowAllClicked(EventArgs args) { if (this.ViewAllClicked != null) { this.ViewAllClicked(this, args); } } public event EventHandler ViewAllClicked; } I have been stuggling with this problem for the last 3 days and have had no success with it, and I really do need some help. Can anyone please help me?

    Read the article

  • Howw to add new value with generic Repository if there are foreign keys (EF-4)?

    - by Phsika
    i try to write a kind of generic repository to add method. Everything is ok to add but I have table which is related with two tables with FOREIGN KEY.But Not working because of foreign key public class DomainRepository<TModel> : IDomainRepository<TModel> where TModel : class { #region IDomainRepository<T> Members private ObjectContext _context; private IObjectSet<TModel> _objectSet; public DomainRepository() { } public DomainRepository(ObjectContext context) { _context = context; _objectSet = _context.CreateObjectSet<TModel>(); } //do something..... public TModel Add<TModel>(TModel entity) where TModel : IEntityWithKey { EntityKey key; object originalItem; key = _context.CreateEntityKey(entity.GetType().Name, entity); _context.AddObject(key.EntitySetName, entity); _context.SaveChanges(); return entity; } //do something..... } Calling REPOSITORY: //insert-update-delete public partial class AddtoTables { public table3 Add(int TaskId, int RefAircraftsId) { using (DomainRepository<table3> repTask = new DomainRepository<table3>(new TaskEntities())) { return repTask.Add<table3>(new table3() { TaskId = TaskId, TaskRefAircraftsID = RefAircraftsId }); } } } How to add a new value if this table includes foreign key relation

    Read the article

  • twitter streaming api instead of search api

    - by user1711576
    I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

    Read the article

  • Update list dom only if list displayed

    - by Nikolaj Borisik
    Sometimes we use one store for few views(list, carousel,dataviews) and when we refresh(load, filter) store data, dom of all view that use this store will be rebuild, but some views is not displayed in this time, and may be will not show with these data. How we can refresh list dom only if it displayed, not every time when it store refresh? Issue examle Ext.define("Test.view.Main", { extend: 'Ext.tab.Panel', config: { tabBarPosition: 'bottom', items: [ ] }, constructor : function(){ this.callParent(arguments); var store = Ext.create('Ext.data.Store',{ data :[ {title : 'One'}, {title : 'Two'}, {title : 'Three'} ] }), firstList = Ext.create('Ext.List',{ title : 'tab1', store : store, itemTpl : '{title}', onItemDisclosure : function(){ store.add({title : 'Four'}); } }), secondList = Ext.create('Ext.List',{ title : 'tab2' , store : store, itemTpl : '{title}' }), thirdList = Ext.create('Ext.List',{ title : 'tab3', store : store, itemTpl : '{title}' }); this.add([ firstList, secondList, thirdList ]) ; } }); When tap on item in the first list, in store will be added new item. And dom of all list will be change although second and third list not displayed I see one option. Create one main store and create separate stores for each views. And when view show fill it store from Main store. But it look not good. Any other ideas?

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • How to Bind a Command in WPF

    - by MegaMind
    Sometimes we used complex ways so many times, we forgot the simplest ways to do the task. I know how to do command binding, but i always use same approach. Create a class that implements ICommand interface and from the view model i create new instance of that class and binding works like a charm. This is the code that i used for command binding public partial class MainWindow : Window { public MainWindow() { InitializeComponent(); DataContext = this; testCommand = new MeCommand(processor); } ICommand testCommand; public ICommand test { get { return testCommand; } } public void processor() { MessageBox.Show("hello world"); } } public class MeCommand : ICommand { public delegate void ExecuteMethod(); private ExecuteMethod meth; public MeCommand(ExecuteMethod exec) { meth = exec; } public bool CanExecute(object parameter) { return false; } public event EventHandler CanExecuteChanged; public void Execute(object parameter) { meth(); } } But i want to know the basic way to do this, no third party dll no new class creation. Do this simple command binding using a single class. Actual class implements from ICommand interface and do the work.

    Read the article

  • Regular Expressions .NET

    - by Fosa
    I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

    Read the article

  • Encode_JSON Errors in Lasso 8.6.2 After Period of Time

    - by ATP_JD
    We are in the process of converting apps from Lasso 8 to Lasso 9, and as an intermediate step, have upgraded from 8.5.5 to 8.6.2 (which runs alongside 9 on our new box, in different virtual hosts). I am finding that with 8.6.2 we are getting a slew of errors on pages that call encode_json. The weird thing with these errors is that they don't start happening until some period of time after the site starts. Then, some hours later, all encode_json calls begin to fail with error messages like this: An error occurred while processing your request. Error Information Error Message: No tag, type or constant was defined under the name "?????????????????" with arguments: array: (pair: (-find)=([\x{0020}-\x{21}\x{23}-\x{5b}\x{5d}-\x{10fff}])), (r) at: onCompare with params: 'r' at: JSON with params: 'reload', -Options=array: (-Internal) at: JSON with params: @map: (reload)=(false), (tcstring)=(LZU), (timestring)=(10:42 AM&nbsp;&nbsp;&nbsp;1442Z) at: [...].lasso with params: 'pageloadtime'='1383038310' on line: 31 at position: 1 Error Code: -9948 (Yes, those Chinese(?) characters are in the error message.) I have removed the 8.5.5 encode_json tag from LassoStartup, so we are using the correct built-in method. The encode_json method fails for any and all parameters I throw at it from simple strings to arrays of maps. Upon restarting the site, encode_json resumes working for an hour or two, seemingly depending on load. On 8.5.5, we don't have this problem. Does anyone have experience with this issue? Any advice regarding trying the 8.5.5 tag swap encode_json to see if I can override the built-in method? Maybe it will work better? Thanks in advance for your time and assistance. -Justin

    Read the article

  • WPF app startup problems

    - by Dave
    My brain is all over the map trying to fully understand Unity right now. So I decided to just dive in and start adding it in a branch to see where it takes me. Surprisingly enough (or maybe not), I am stuck just getting my darn Application to load properly. It seems like the right way to do this is to override OnStartup in App.cs. I've removed my StartupUri from App.xaml so it doesn't create my GUI XAML. My App.cs now looks something like this: public partial class App : Application { private IUnityContainer container { get; set; } protected override void OnStartup(StartupEventArgs e) { container = new UnityContainer(); GUI gui = new GUI(); gui.Show(); } protected override void OnExit(ExitEventArgs e) { container.Dispose(); base.OnExit(e); } } The problem is that nothing happens when I start the app! I put a breakpoint at the container assignment, and it never gets hit. What am I missing? App.xaml is currently set to ApplicationDefinition, but I'd expect this to work because some sample Unity + WPF code I'm looking at (from Codeplex) does the exact same thing, except that it works! I've also started the app by single-stepping, and it eventually hits the first line in App.xaml. When I step into this line, that's when the app just starts "running", but I don't see anything (and my breakpoint isn't hit). If I do the exact same thing in the sample application, stepping into App.xaml puts me right into OnStartup, which is what I'd expect to happen. Argh! Is it a Bad Thing to just put the Unity construction in my GUI's Window_Loaded event handler? Does it really need to be at the App level?

    Read the article

  • How to make ActiveRecord work with legacy partitioned/sharded databases/tables?

    - by Utensil
    thanks for your time first...after all the searching on google, github and here, and got more confused about the big words(partition/shard/fedorate),I figure that I have to describe the specific problem I met and ask around. My company's databases deals with massive users and orders, so we split databases and tables in various ways, some are described below: way database and table name shard by (maybe it's should be called partitioned by?) YZ.X db_YZ.tb_X order serial number last three digits YYYYMMDD. db_YYYYMMDD.tb date YYYYMM.DD db_YYYYMM.tb_ DD date too The basic concept is that databases and tables are seperated acording to a field(not nessissarily the primary key), and there are too many databases and too many tables, so that writing or magically generate one database.yml config for each database and one model for each table isn't possible or at least not the best solution. I looked into drnic's magic solutions, and datafabric, and even the source code of active record, maybe I could use ERB to generate database.yml and do database connection in around filter, and maybe I could use named_scope to dynamically decide the table name for find, but update/create opertions are bounded to "self.class.quoted_table_name" so that I couldn't easily get my problem solved. And even I could generate one model for each table, because its amount is up to 30 most. But this is just not DRY! What I need is a clean solution like the following DSL: class Order < ActiveRecord::Base shard_by :order_serialno do |key| [get_db_config_by(key), #because some or all of the databaes might share the same machine in a regular way or can be configed by a hash of regex, and it can also be a const get_db_name_by(key), get_tb_name_by(key), ] end end Can anybody enlight me? Any help would be greatly appreciated~~~~

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • How to make DataGrid Row really fully selectable (clicking on non-cell area)

    - by Samuel
    The question might be a little misleading. Here is a screenshot of a DataGrid that has some dummy values (code provided below) Is there a way to make the white area not covered by a cell clickable? My intention: I want to have full row selection. This can be achieved by SelectionUnit="FullRow" which is fine but how can I make the white area implicitly select the entire row without expanding available cells in width and avoiding code behind Here is the repro code: Xaml: <Window x:Class="DGVRowSelectTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525" DataContext="{Binding RelativeSource={RelativeSource Self}}"> <DataGrid ItemsSource="{Binding Names}" SelectionMode="Single" SelectionUnit="FullRow" > </DataGrid> </Window> Dummy Code behind of it (just sets the two entries up) using System.Collections.Generic; using System.Windows; namespace DGVRowSelectTest { public partial class MainWindow : Window { private IList<KeyValuePair<string, string>> _names = new List<KeyValuePair<string, string>>{new KeyValuePair<string, string>("A1", "A2"),new KeyValuePair<string, string>("B1","B2")}; public IList<KeyValuePair<string, string>> Names{get { return _names; }set { _names = value; }} public MainWindow() { InitializeComponent(); } } }

    Read the article

  • jquery tabbed interface breaks when using images

    - by Steve
    hello all, using jquery to create a tabbed interface. coding is quite typical: html: <div id="tabbed-interface"> <ul> <li><a href="#option1">Option1</a></li> <li><a href="#option2">Option2</a></li> <li><a href="#option3">Option3</a></li> </ul> </div> jquery: $(document).ready(function(){ $('#tabbed-interface li:first').addClass('active'); $('#tabbed-interface div').not(':first').hide(); $('#tabbed-interface>ul>li>a').click(function(event){ $('#tabbed-interface>ul>li').removeClass('active'); $(event.target).parent().addClass('active'); $('#tabbed-interface>div').fadeOut().filter(this.hash).fadeIn(250); return false;});}); css: ul li {background: #232323; list-style: none; border: 1px solid #616161; } ul li.active {background: none; list-style: none; border: 1px solid: #616161; border-bottom: 1px solid #121212; z-index: 1; } as you can see, all this does is add the class 'active' to the li that is clicked, and this corresponds to whether a background is shown or not. this works perfectly with text, but i am required to use non standard fonts. when i try to side step the issue using transparent .png images, it is unreliable. For instance, changing the HTML to: <div id="tabbed-interface"> <ul> <li><a href="#option1"><img src="option1.png" /></a></li>

    Read the article

  • Ruby integer to string key

    - by Gene
    A system I'm building needs to convert non-negative Ruby integers into shortest-possible UTF-8 string values. The only requirement on the strings is that their lexicographic order be identical to the natural order on integers. What's the best Ruby way to do this? We can assume the integers are 32 bits and the sign bit is 0. This is successful: (i >> 24).chr + ((i >> 16) & 0xff).chr + ((i >> 8) & 0xff).chr + (i & 0xff).chr But it appears to be 1) garbage-intense and 2) ugly. I've also looked at pack solutions, but these don't seem portable due to byte order. FWIW, the application is Redis hash field names. Building keys may be a performance bottleneck, but probably not. This question is mostly about the "Ruby way".

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • ForEach loop in Mathematica.

    - by dreeves
    I'd like something like this: ForEach[i_, {1,2,3}, Print[i] ] Or, more generally, to destructure arbitrary stuff in the list you're looping over, like: ForEach[{i_, j_}, {{1,10}, {2,20}, {3,30}}, Print[i*j] ] (Meta-question: is that a good way to call a ForEach loop, with the first argument a pattern like that?) ADDED: Some answerers have rightly pointed out that usually you want to use Map or other purely functional constructs and eschew a non-functional programming style where you use side effects. I agree! But here's an example where I think this ForEach construct is supremely useful: Say I have a list of options (rules) that pair symbols with expressions, like attrVals = {a -> 7, b -> 8, c -> 9} Now I want to make a hash table where I do the obvious mapping of those symbols to those numbers. I don't think there's a cleaner way to do that than ForEach[a_ -> v_, attrVals, h[a] = v] ADDED: I just realized that to do ForEach properly, it should support Break[] and Continue[]. I'm not sure how to implement that. Perhaps it will need to somehow be implemented in terms of For, While, or Do since those are the only loop constructs that support Break[] and Continue[]. If anyone interested in this wants to ask about that as a separate question, please do!

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • Kohana Auth Library Deployment

    - by Steve
    My Kohana app runs perfectly on my local machine. When I deployed my app to a server (and adjust the config files appropriately), I can no longer log into the app. I've traced through the app login routine on both my local version and the server version and they both agree with each other all the way through until you get to the auth.php controller logged_in() routine where suddenly, at line 140 - the is_object($this-user) test - the $user object no longer exists!?!?!? The login() function call that calls the logged_in() function successfully passes the following test, which causes a redirect to the logged_in() function. if(Auth::instance()->login($user, $post['password'])) Yes, the password and hash, etc all work perfectly. Here is the offending code: public function logged_in() { if ( ! is_object($this->user)) { // No user is currently logged in url::redirect('auth/login'); } etc... } As the code is the same between my local installation and the server, I reckon it must be some server setting that is messing with me. FYI: All the rest of the code works because I have a temporary backdoor available that allows me to use the application (view pages of tables, etc) without being logged in. Any ideas?

    Read the article

  • Problem with incomplete input when using Attoparsec

    - by Dan Dyer
    I am converting some functioning Haskell code that uses Parsec to instead use Attoparsec in the hope of getting better performance. I have made the changes and everything compiles but my parser does not work correctly. I am parsing a file that consists of various record types, one per line. Each of my individual functions for parsing a record or comment works correctly but when I try to write a function to compile a sequence of records the parser always returns a partial result because it is expecting more input. These are the two main variations that I've tried. Both have the same problem. items :: Parser [Item] items = sepBy (comment <|> recordType1 <|> recordType2) endOfLine For this second one I changed the record/comment parsers to consume the end-of-line characters. items :: Parser [Item] items = manyTill (comment <|> recordType1 <|> recordType2) endOfInput Is there anything wrong with my approach? Is there some other way to achieve what I am attempting?

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >