Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 282/336 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

• Encode_JSON Errors in Lasso 8.6.2 After Period of Time

  - by ATP_JD

  We are in the process of converting apps from Lasso 8 to Lasso 9, and as an intermediate step, have upgraded from 8.5.5 to 8.6.2 (which runs alongside 9 on our new box, in different virtual hosts). I am finding that with 8.6.2 we are getting a slew of errors on pages that call encode_json. The weird thing with these errors is that they don't start happening until some period of time after the site starts. Then, some hours later, all encode_json calls begin to fail with error messages like this: An error occurred while processing your request. Error Information Error Message: No tag, type or constant was defined under the name "?????????????????" with arguments: array: (pair: (-find)=([\x{0020}-\x{21}\x{23}-\x{5b}\x{5d}-\x{10fff}])), (r) at: onCompare with params: 'r' at: JSON with params: 'reload', -Options=array: (-Internal) at: JSON with params: @map: (reload)=(false), (tcstring)=(LZU), (timestring)=(10:42 AM&nbsp;&nbsp;&nbsp;1442Z) at: [...].lasso with params: 'pageloadtime'='1383038310' on line: 31 at position: 1 Error Code: -9948 (Yes, those Chinese(?) characters are in the error message.) I have removed the 8.5.5 encode_json tag from LassoStartup, so we are using the correct built-in method. The encode_json method fails for any and all parameters I throw at it from simple strings to arrays of maps. Upon restarting the site, encode_json resumes working for an hour or two, seemingly depending on load. On 8.5.5, we don't have this problem. Does anyone have experience with this issue? Any advice regarding trying the 8.5.5 tag swap encode_json to see if I can override the built-in method? Maybe it will work better? Thanks in advance for your time and assistance. -Justin

  Read the article

• C: incompatible types in assignment

  - by The.Anti.9

  I'm writing a program to check to see if a port is open in C. One line in particular copies one of the arguments to a char array. However, when I try to compile, it says: error: incompatible types in assignment Heres the code. The error is on the assignment of addr #include <sys/socket.h> #include <sys/time.h> #include <sys/types.h> #include <arpa/inet.h> #include <netinet/in.h> #include <errno.h> #include <fcntl.h> #include <stdio.h> #include <netdb.h> #include <stdlib.h> #include <string.h> #include <unistd.h> int main(int argc, char **argv) { u_short port; /* user specified port number */ char addr[1023]; /* will be a copy of the address entered by u */ struct sockaddr_in address; /* the libc network address data structure */ short int sock = -1; /* file descriptor for the network socket */ port = atoi(argv[1]); addr = strncpy(addr, argv[2], 1023); bzero((char *)&address, sizeof(address)); /* init addr struct */ address.sin_addr.s_addr = inet_addr(addr); /* assign the address */ address.sin_port = htons(port); /* translate int2port num */ sock = socket(AF_INET, SOCK_STREAM, 0); if (connect(sock,(struct sockaddr *)&address,sizeof(address)) == 0) { printf("%i is open\n", port); } if (errno == 113) { fprintf(stderr, "Port not open!\n"); } close(sock); return 0; } I'm new to C, so I'm not sure why it would do this.

  Read the article

• datepicker not working in chrome

  - by DotnetSparrow

  I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

  Read the article

• Ruby integer to string key

  - by Gene

  A system I'm building needs to convert non-negative Ruby integers into shortest-possible UTF-8 string values. The only requirement on the strings is that their lexicographic order be identical to the natural order on integers. What's the best Ruby way to do this? We can assume the integers are 32 bits and the sign bit is 0. This is successful: (i >> 24).chr + ((i >> 16) & 0xff).chr + ((i >> 8) & 0xff).chr + (i & 0xff).chr But it appears to be 1) garbage-intense and 2) ugly. I've also looked at pack solutions, but these don't seem portable due to byte order. FWIW, the application is Redis hash field names. Building keys may be a performance bottleneck, but probably not. This question is mostly about the "Ruby way".

  Read the article

• Need a refresher course on property access...

  - by Code Sherpa

  Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

  Read the article

• DBD::CSV: Problem with userdefined functions

  - by sid_com

  From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

  Read the article

• Convert enumeration to string

  - by emptyheaded

  I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

  Read the article

• How do i make multi call with SudzC

  - by laxonline

  I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

  Read the article

• Continuous Flash music player while navigating site

  - by phx-zs

  I have a site that includes a Flash music player integrated into the layout. I want users to be able to navigate around the site without interrupting the music. I've done plenty of research and thinking and the following are the options I came up with (keeping in mind I want to be as SEO friendly as possible). Anyone have another idea? AJAX: I set up a version that changes the main content div to whatever nav link they click, thereby not interrupting the Flash player. I set it up in the proper search-engine-friendly manner with direct links and JQuery/Ajax functions. If someone goes to site.com/ and clicks the Contact nav link, it loads what's in the main content div on site.com/contact.php into the main content div and changes the URL bar to site.com/#Contact. The same goes for if they go to site.com/contact.php and click About in the nav, it loads the About content and changes the URL bar to site.com/contact.php#About. Obviously this opens up a whole new can of worms with AJAX and hash navigation/history issues, and I would end up with people possibly linking to things like site.com/contact.php#About (which I think looks terrible and can't be too great for SEO). Store the Flash player vars somewhere and reload them with the page: I'm not sure how to go about this, but I thought about keeping my regular navigation without AJAX and have it so when a user clicks a nav link, before it changes pages it stores the Flash player vars (current song and song position) somewhere, then loads them into Flash when the new page loads. Something with an iframe? Good alternative to a Flash player that will work for this type of application? Thanks!

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Is there an efficient way in LINQ to use a contains match if and only if there is no exact match?

  - by Peter

  I have an application where I am taking a large number of 'product names' input by a user and retrieving some information about each product. The problem is, the user may input a partial name or even a wrong name, so I want to return the closest matches for further selection. Essentially if product name A exactly matches a record, return that, otherwise return any contains matches. Otherwise return null. I have done this with three separate statements, and I was wondering if there was a more efficient way to do this. I am using LINQ to EF, but I materialize the products to a list first for performance reasons. productNames is a List of product names (input by the user). products is a List of product 'records' var directMatches = (from s in productNames join p in products on s.ToLower() equals p.name.ToLower() into result from r in result.DefaultIfEmpty() select new {Key = s, Product = r}); var containsMatches = (from d in directMatches from p in products where d.Product == null && p.name.ToLower().Contains(d.Key) select new { d.Key, Product = p }); var matches = from d in directMatches join c in containsMatches on d.Key equals c.Key into result from r in result.DefaultIfEmpty() select new {d.Key, Product = d.Product ?? (r != null ? r.Product: null) };

  Read the article

• Should we retire the term "Context"?

  - by MrGumbe

  I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

  Read the article

• twitter streaming api instead of search api

  - by user1711576

  I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

  Read the article

• Gearman client doBackground always returns GEARMAN_TIMEOUT

  - by Ascherer

  So, ive got a simple gearman system running right now, with a worker running. The worker basically just takes the payload (a random number in this case, and is supposed to echo it back to the screen. Literally an echo, not returning to the client. The client sends the random number. Im trying to do a $client->doBackground( 'post', 65482, md5(uniqid())); but its coming back with a 47 error (GEARMAN_TIMEOUT) every time. getErrNo() returns 0, error() returns something about GEARMAN_TIMEOUT However, when i change it to just $client->do(blah, blah, blah), it works just fine. I've even occasionally seen it where the worker still echo's the number, even after getting the timeout error... public function execute() { $method = 'do'; if( !$this->getBlock() ) { $method .= ( $this->getPriority() == 'Normal' ? '' : $this->getPriority() ) . 'Background'; } else { $method .= $this->getPriority(); } echo "Method: $method \t Worker: {$this->getName()} \t Payload: {$this->getPayload()} \t Hash: {$this->getHash()}\n"; $this->setResult( $this->getClient() ->$method( $this->getName(), $this->getPayload(), $this->getHash() ) ); if( $this->getClient()->returnCode() != GEARMAN_SUCCESS ) { echo "Code: " . $this->getClient()->returnCode() . "\t" . GEARMAN_TIMEOUT . "\n"; } }

  Read the article

• Evenly distribute data into columns with JavaScript

  - by marius.cdm

  I'm looking for a way to evenly distribute my JSON data into HTML columns. Using javascript to pull the data $.ajax({ url: "url", dataType: 'json', data: "e="+escape(divID), cache: true, success: function(data) { var items = data; // ??? $('.result').html(list); } }); Input data: ["A", "B", "C", "D", "E", "F", "G", "H", "I", "J", "K"] Expected result: <ul> <li>A</li> <li>B</li> <li>C</li> <li>D</li> </ul> <ul> <li>E</li> <li>F</li> <li>G</li> <li>H</li> </ul> <ul> <li>I</li> <li>J</li> <li>K</li> </ul> I found a partial result here, but the output data is in console. Any help would be appreciated.

  Read the article

• Java: fastest way to do random reads on huge disk file(s)

  - by cocotwo

  I've got a moderately big set of data, about 800 MB or so, that is basically some big precomputed table that I need to speed some computation by several orders of magnitude (creating that file took several mutlicores computers days to produce using an optimized and multi-threaded algo... I do really need that file). Now that it has been computed once, that 800MB of data is read only. I cannot hold it in memory. As of now it is one big huge 800MB file but splitting in into smaller files ain't a problem if it can help. I need to read about 32 bits of data here and there in that file a lot of time. I don't know before hand where I'll need to read these data: the reads are uniformly distributed. What would be the fastest way in Java to do my random reads in such a file or files? Ideally I should be doing these reads from several unrelated threads (but I could queue the reads in a single thread if needed). Is Java NIO the way to go? I'm not familiar with 'memory mapped file': I think I don't want to map the 800 MB in memory. All I want is the fastest random reads I can get to access these 800MB of disk-based data. btw in case people wonder this is not at all the same as the question I asked not long ago: http://stackoverflow.com/questions/2346722/java-fast-disk-based-hash-set

  Read the article

• Symbols (pdb) for native dll are not loaded due to post build step

  - by sean e

  I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

  Read the article

• Link Button on asp.net user control not firing

  - by andyriome

  Hi I have a user control, which is added to another user control. The nested user control is built up of a gridview, an image button and a link button. The nested user control is added to the outer control as a collection object based upon the results bound to the gridview. The problem that I have is that my link button doesn't work. I click on it and the event doesn't fire. Even adding a break point was not reached. As the nested user control is added a number of times, I have set image button to have unique ids and also the link button. Whilst image button works correctly with its java script. The link button needs to fire an event in the code behind, but despite all my efforts, I can't make it work. I am adding the link button to the control dynamically. Below is the relevant code that I am using: public partial class ucCustomerDetails : System.Web.UI.UserControl { protected override void CreateChildControls( ) { base.CreateChildControls( ); string strUniqueID = lnkShowAllCust.UniqueID; strUniqueID = strUniqueID.Replace('$','_'); this.lnkShowAllCust.ID = strUniqueID; this.lnkShowAllCust.Click += new EventHandler(this.lnkShowAllCust_Click); this.Controls.Add(lnkShowAllCust); } protected override void OnInit (EventArgs e) { CreateChildControls( ); base.OnInit(e); } protected override void OnLoad(EventArgs e) { base.EnsureChildControls( ); } protected void Page_Load(object sender, EventArgs e) { if (IsPostBack) { CreateChildControls( ); } } protected void lnkShowAllCust_Click(object sender, EventArgs e) { this.OnCustShowAllClicked(new EventArgs ( )); } protected virtual void OnCustShowAllClicked(EventArgs args) { if (this.ViewAllClicked != null) { this.ViewAllClicked(this, args); } } public event EventHandler ViewAllClicked; } I have been stuggling with this problem for the last 3 days and have had no success with it, and I really do need some help. Can anyone please help me?

  Read the article

• Howw to add new value with generic Repository if there are foreign keys (EF-4)?

  - by Phsika

  i try to write a kind of generic repository to add method. Everything is ok to add but I have table which is related with two tables with FOREIGN KEY.But Not working because of foreign key public class DomainRepository<TModel> : IDomainRepository<TModel> where TModel : class { #region IDomainRepository<T> Members private ObjectContext _context; private IObjectSet<TModel> _objectSet; public DomainRepository() { } public DomainRepository(ObjectContext context) { _context = context; _objectSet = _context.CreateObjectSet<TModel>(); } //do something..... public TModel Add<TModel>(TModel entity) where TModel : IEntityWithKey { EntityKey key; object originalItem; key = _context.CreateEntityKey(entity.GetType().Name, entity); _context.AddObject(key.EntitySetName, entity); _context.SaveChanges(); return entity; } //do something..... } Calling REPOSITORY: //insert-update-delete public partial class AddtoTables { public table3 Add(int TaskId, int RefAircraftsId) { using (DomainRepository<table3> repTask = new DomainRepository<table3>(new TaskEntities())) { return repTask.Add<table3>(new table3() { TaskId = TaskId, TaskRefAircraftsID = RefAircraftsId }); } } } How to add a new value if this table includes foreign key relation

  Read the article

• Haskell quiz: a simple function

  - by levy

  I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

  Read the article

• Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

  - by Nosredna

  What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

  Read the article

• How to solve this problem with Python

  - by morpheous

  I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

  Read the article

• Thread mutex behaviour

  - by Alberteddu

  Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

  Read the article

• Optimizing a "set in a string list" to a "set as a matrix" operation

  - by Eric Fournier

  I have a set of strings which contain space-separated elements. I want to build a matrix which will tell me which elements were part of which strings. For example: "" "A B C" "D" "B D" Should give something like: A B C D 1 2 1 1 1 3 1 4 1 1 Now I've got a solution, but it runs slow as molasse, and I've run out of ideas on how to make it faster: reverseIn <- function(vector, value) { return(value %in% vector) } buildCategoryMatrix <- function(valueVector) { allClasses <- c() for(classVec in unique(valueVector)) { allClasses <- unique(c(allClasses, strsplit(classVec, " ", fixed=TRUE)[[1]])) } resMatrix <- matrix(ncol=0, nrow=length(valueVector)) splitValues <- strsplit(valueVector, " ", fixed=TRUE) for(cat in allClasses) { if(cat=="") { catIsPart <- (valueVector == "") } else { catIsPart <- sapply(splitValues, reverseIn, cat) } resMatrix <- cbind(resMatrix, catIsPart) } colnames(resMatrix) <- allClasses return(resMatrix) } Profiling the function gives me this: $by.self self.time self.pct total.time total.pct "match" 31.20 34.74 31.24 34.79 "FUN" 30.26 33.70 74.30 82.74 "lapply" 13.56 15.10 87.86 97.84 "%in%" 12.92 14.39 44.10 49.11 So my actual questions would be: - Where are the 33% spent in "FUN" coming from? - Would there be any way to speed up the %in% call? I tried turning the strings into factors prior to going into the loop so that I'd be matching numbers instead of strings, but that actually makes R crash. I've also tried going for partial matrix assignment (IE, resMatrix[i,x] <- 1) where i is the number of the string and x is the vector of factors. No dice there either, as it seems to keep on running infinitely.

  Read the article

• Problem with incomplete input when using Attoparsec

  - by Dan Dyer

  I am converting some functioning Haskell code that uses Parsec to instead use Attoparsec in the hope of getting better performance. I have made the changes and everything compiles but my parser does not work correctly. I am parsing a file that consists of various record types, one per line. Each of my individual functions for parsing a record or comment works correctly but when I try to write a function to compile a sequence of records the parser always returns a partial result because it is expecting more input. These are the two main variations that I've tried. Both have the same problem. items :: Parser [Item] items = sepBy (comment <|> recordType1 <|> recordType2) endOfLine For this second one I changed the record/comment parsers to consume the end-of-line characters. items :: Parser [Item] items = manyTill (comment <|> recordType1 <|> recordType2) endOfInput Is there anything wrong with my approach? Is there some other way to achieve what I am attempting?

  Read the article

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >