Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 282/336 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Get dragged / saved items state back from Sql Server

    - by user571507
    Ok i saw many post's on how to serialize the value of dragged items to get hash and they tell how to save them. Now the question is how do i persist the dragged items the next time when user log's in using the has value that i got eg: <ul class="list"> <li id="id_1"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_2"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_3"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_4"> <div class="item ui-corner-all ui-widget"> </div> </li> </ul> which on serialize will give "id[]=1&id[]=2&id[]=3&id[]=4" Now think that i saved it to Sql server database in a single field called SortOrder. Now how do i get the items to these order again ? the code to make these sort is below,without which people didn't know which library i had used to sort and serialize <script type="text/javascript"> $(document).ready(function() { $(".list li").css("cursor", "move"); $(".list").sortable(); }); </script>

    Read the article

  • Eclipse > Javascript > Code highlighting not working with Object Notation

    - by Redsandro
    I am using Eclipse Helios with PDT, and when I am editing JavaScript files with the default JavaScript Editor (JSDT), code highlighting (Mark Occurrences) is not working for half of the code, for example JSON-style (or Object Literal if you will) declarations. Little example: Foo = {}; Foo.Bar = Foo.Bar || {}; Foo.Bar = { bar: function(str) { alert(str) }, baz: function(str) { this.bar(str); // This bar *is* highlighted though } }; Foo.Bar.baz('text'); No Bar, bar or baz is highlighted. For now, I humbly edit the JavaScript part of projects in Notepad++ because it just highlights every occurrence of whatever is currently selected. Is there a common practice for Eclipse JavaScript developers to get code highlighting work correctly, using the popular Object Literal notation? An option or update I missed? -update- I have found that code highlighting depends on the code being properly outlined. Altough commonly used, Object Literal outlining still seems rare in javascript editors. the Spket Javascript Editor does partial Object Literal outlining, and the Aptana Javascript Editor does full Object Literal outlining. But both loses other important functionality. A quest for the editor with the least loss of functionality is currently in progress in this question.

    Read the article

  • twitter streaming api instead of search api

    - by user1711576
    I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

    Read the article

  • Link Button on asp.net user control not firing

    - by andyriome
    Hi I have a user control, which is added to another user control. The nested user control is built up of a gridview, an image button and a link button. The nested user control is added to the outer control as a collection object based upon the results bound to the gridview. The problem that I have is that my link button doesn't work. I click on it and the event doesn't fire. Even adding a break point was not reached. As the nested user control is added a number of times, I have set image button to have unique ids and also the link button. Whilst image button works correctly with its java script. The link button needs to fire an event in the code behind, but despite all my efforts, I can't make it work. I am adding the link button to the control dynamically. Below is the relevant code that I am using: public partial class ucCustomerDetails : System.Web.UI.UserControl { protected override void CreateChildControls( ) { base.CreateChildControls( ); string strUniqueID = lnkShowAllCust.UniqueID; strUniqueID = strUniqueID.Replace('$','_'); this.lnkShowAllCust.ID = strUniqueID; this.lnkShowAllCust.Click += new EventHandler(this.lnkShowAllCust_Click); this.Controls.Add(lnkShowAllCust); } protected override void OnInit (EventArgs e) { CreateChildControls( ); base.OnInit(e); } protected override void OnLoad(EventArgs e) { base.EnsureChildControls( ); } protected void Page_Load(object sender, EventArgs e) { if (IsPostBack) { CreateChildControls( ); } } protected void lnkShowAllCust_Click(object sender, EventArgs e) { this.OnCustShowAllClicked(new EventArgs ( )); } protected virtual void OnCustShowAllClicked(EventArgs args) { if (this.ViewAllClicked != null) { this.ViewAllClicked(this, args); } } public event EventHandler ViewAllClicked; } I have been stuggling with this problem for the last 3 days and have had no success with it, and I really do need some help. Can anyone please help me?

    Read the article

  • Problem with incomplete input when using Attoparsec

    - by Dan Dyer
    I am converting some functioning Haskell code that uses Parsec to instead use Attoparsec in the hope of getting better performance. I have made the changes and everything compiles but my parser does not work correctly. I am parsing a file that consists of various record types, one per line. Each of my individual functions for parsing a record or comment works correctly but when I try to write a function to compile a sequence of records the parser always returns a partial result because it is expecting more input. These are the two main variations that I've tried. Both have the same problem. items :: Parser [Item] items = sepBy (comment <|> recordType1 <|> recordType2) endOfLine For this second one I changed the record/comment parsers to consume the end-of-line characters. items :: Parser [Item] items = manyTill (comment <|> recordType1 <|> recordType2) endOfInput Is there anything wrong with my approach? Is there some other way to achieve what I am attempting?

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Kohana Auth Library Deployment

    - by Steve
    My Kohana app runs perfectly on my local machine. When I deployed my app to a server (and adjust the config files appropriately), I can no longer log into the app. I've traced through the app login routine on both my local version and the server version and they both agree with each other all the way through until you get to the auth.php controller logged_in() routine where suddenly, at line 140 - the is_object($this-user) test - the $user object no longer exists!?!?!? The login() function call that calls the logged_in() function successfully passes the following test, which causes a redirect to the logged_in() function. if(Auth::instance()->login($user, $post['password'])) Yes, the password and hash, etc all work perfectly. Here is the offending code: public function logged_in() { if ( ! is_object($this->user)) { // No user is currently logged in url::redirect('auth/login'); } etc... } As the code is the same between my local installation and the server, I reckon it must be some server setting that is messing with me. FYI: All the rest of the code works because I have a temporary backdoor available that allows me to use the application (view pages of tables, etc) without being logged in. Any ideas?

    Read the article

  • Update list dom only if list displayed

    - by Nikolaj Borisik
    Sometimes we use one store for few views(list, carousel,dataviews) and when we refresh(load, filter) store data, dom of all view that use this store will be rebuild, but some views is not displayed in this time, and may be will not show with these data. How we can refresh list dom only if it displayed, not every time when it store refresh? Issue examle Ext.define("Test.view.Main", { extend: 'Ext.tab.Panel', config: { tabBarPosition: 'bottom', items: [ ] }, constructor : function(){ this.callParent(arguments); var store = Ext.create('Ext.data.Store',{ data :[ {title : 'One'}, {title : 'Two'}, {title : 'Three'} ] }), firstList = Ext.create('Ext.List',{ title : 'tab1', store : store, itemTpl : '{title}', onItemDisclosure : function(){ store.add({title : 'Four'}); } }), secondList = Ext.create('Ext.List',{ title : 'tab2' , store : store, itemTpl : '{title}' }), thirdList = Ext.create('Ext.List',{ title : 'tab3', store : store, itemTpl : '{title}' }); this.add([ firstList, secondList, thirdList ]) ; } }); When tap on item in the first list, in store will be added new item. And dom of all list will be change although second and third list not displayed I see one option. Create one main store and create separate stores for each views. And when view show fill it store from Main store. But it look not good. Any other ideas?

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • jquery tabbed interface breaks when using images

    - by Steve
    hello all, using jquery to create a tabbed interface. coding is quite typical: html: <div id="tabbed-interface"> <ul> <li><a href="#option1">Option1</a></li> <li><a href="#option2">Option2</a></li> <li><a href="#option3">Option3</a></li> </ul> </div> jquery: $(document).ready(function(){ $('#tabbed-interface li:first').addClass('active'); $('#tabbed-interface div').not(':first').hide(); $('#tabbed-interface>ul>li>a').click(function(event){ $('#tabbed-interface>ul>li').removeClass('active'); $(event.target).parent().addClass('active'); $('#tabbed-interface>div').fadeOut().filter(this.hash).fadeIn(250); return false;});}); css: ul li {background: #232323; list-style: none; border: 1px solid #616161; } ul li.active {background: none; list-style: none; border: 1px solid: #616161; border-bottom: 1px solid #121212; z-index: 1; } as you can see, all this does is add the class 'active' to the li that is clicked, and this corresponds to whether a background is shown or not. this works perfectly with text, but i am required to use non standard fonts. when i try to side step the issue using transparent .png images, it is unreliable. For instance, changing the HTML to: <div id="tabbed-interface"> <ul> <li><a href="#option1"><img src="option1.png" /></a></li>

    Read the article

  • How do I get rid of this "(" using regex?

    - by Solignis
    Hi there, I was moving along on a regex expression and I have hit a road block I can't seem to get around. I am trying to get rid of "(" in the middle of a line of text using regex, there were 2 but I figured out how to get the one on the end of the line. its the one in the middle I can hack out. Here is the snippet I am searching for in the config file. I put 2 examples. guestOSAltName = "Ubuntu Linux (64-bit)" guestOSAltName = "Microsoft Windows 2000 Professional" Here is the snippet I am working on. if ($vmx_file =~ m/^\bguestOSAltName\b\s+\S\s+\W(?<GUEST_OS> .+[^")])\W/xm) { $virtual_machines{$vm}{"OS"} = "$+{GUEST_OS}"; } else { $virtual_machines{$vm}{"OS"} = "N/A"; } I am thinking the problem is I cannot make a match to "(" because the expression before that is to ".+" so that it matches everything in the line of text, be it alphanumeric or whitespace or even symbols like hypens. Any ideas how I can get this to work? This is what I am getting for an output from a hash dump. $VAR1 = { 'NS02' => { 'ID' => '144', 'Version' => '7', 'OS' => 'Ubuntu Linux (64-bit', 'VMX' => '/vmfs/volumes/datastore2/NS02/NS02.vmx', 'Architecture' => '64-bit' },

    Read the article

  • what is the best practice approach for n-tier application development with entity framework?

    - by samsur
    I am building an application using entity framework. I am using the T4 template to generate self tracking entities. Currently, I am thinking of creating the entity framework code in a separate project. In this same project, I would have partial classes with additional methods for the entities. I am thinking of creating a separate project for a service layer (WCF) with methods for the upper/presentation tier. The WCF layer will reference the entity framework project. The methods in the WCF layer will return the entities or accept the entities as the parameters. I am thinkg of creating a third project for the presentation layer (ASP.net), this will make calls to the WCF service but will also need to reference the entities as the WCF methods take these types as the parameters/return types. In short, i want to use the STE entities generated by the T4 template as a DTO to be used in all layers. I was originally thinking of creating a business logic layer that maps to each entities. Example: If i have a customer class, the Business Layer would have a CustomerBLL class and then methods in the customerBLL will be used by the service layer. I was also trying to create a DTO in this business layer. I however found that this approach is very time consuming and i do not see a major benefit as it would create more maintenance work. What is the best practice for n-tier application development using entity framework 4?

    Read the article

  • Password security; Is this safe?

    - by Camran
    I asked a question yesterday about password safety... I am new at security... I am using a mysql db, and need to store users passwords there. I have been told in answers that hashing and THEN saving the HASHED value of the password is the correct way of doing this. So basically I want to verify with you guys this is correct now. It is a classifieds website, and for each classified the user puts, he has to enter a password so that he/she can remove the classified using that password later on (when product is sold for example). In a file called "put_ad.php" I use the $_POST method to fetch the pass from a form. Then I hash it and put it into a mysql table. Then whenever the users wants to delete the ad, I check the entered password by hashing it and comparing the hashed value of the entered passw against the hashed value in the mysql db, right? BUT, what if I as an admin want to delete a classified, is there a method to "Unhash" the password easily? sha1 is used currently btw. some code is very much appreciated. Thanks

    Read the article

  • How to make ActiveRecord work with legacy partitioned/sharded databases/tables?

    - by Utensil
    thanks for your time first...after all the searching on google, github and here, and got more confused about the big words(partition/shard/fedorate),I figure that I have to describe the specific problem I met and ask around. My company's databases deals with massive users and orders, so we split databases and tables in various ways, some are described below: way database and table name shard by (maybe it's should be called partitioned by?) YZ.X db_YZ.tb_X order serial number last three digits YYYYMMDD. db_YYYYMMDD.tb date YYYYMM.DD db_YYYYMM.tb_ DD date too The basic concept is that databases and tables are seperated acording to a field(not nessissarily the primary key), and there are too many databases and too many tables, so that writing or magically generate one database.yml config for each database and one model for each table isn't possible or at least not the best solution. I looked into drnic's magic solutions, and datafabric, and even the source code of active record, maybe I could use ERB to generate database.yml and do database connection in around filter, and maybe I could use named_scope to dynamically decide the table name for find, but update/create opertions are bounded to "self.class.quoted_table_name" so that I couldn't easily get my problem solved. And even I could generate one model for each table, because its amount is up to 30 most. But this is just not DRY! What I need is a clean solution like the following DSL: class Order < ActiveRecord::Base shard_by :order_serialno do |key| [get_db_config_by(key), #because some or all of the databaes might share the same machine in a regular way or can be configed by a hash of regex, and it can also be a const get_db_name_by(key), get_tb_name_by(key), ] end end Can anybody enlight me? Any help would be greatly appreciated~~~~

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • How to Bind a Command in WPF

    - by MegaMind
    Sometimes we used complex ways so many times, we forgot the simplest ways to do the task. I know how to do command binding, but i always use same approach. Create a class that implements ICommand interface and from the view model i create new instance of that class and binding works like a charm. This is the code that i used for command binding public partial class MainWindow : Window { public MainWindow() { InitializeComponent(); DataContext = this; testCommand = new MeCommand(processor); } ICommand testCommand; public ICommand test { get { return testCommand; } } public void processor() { MessageBox.Show("hello world"); } } public class MeCommand : ICommand { public delegate void ExecuteMethod(); private ExecuteMethod meth; public MeCommand(ExecuteMethod exec) { meth = exec; } public bool CanExecute(object parameter) { return false; } public event EventHandler CanExecuteChanged; public void Execute(object parameter) { meth(); } } But i want to know the basic way to do this, no third party dll no new class creation. Do this simple command binding using a single class. Actual class implements from ICommand interface and do the work.

    Read the article

  • Regular Expressions .NET

    - by Fosa
    I need a regular expression for some arguments that must match on a string. here it is... The string exists out of minimum 8 en maximum 20 characters. These characters of this string may be characters of the alfabet or special chars --With other words..all charachters except from the whitespaces In the complete string there must be atleast 1 number. The string cannot start with a number or an underscore The last 2 characters of the string must be identical, But it doenst matter if those last --identical characters are capital or non-capital (case insensitive) Must match all : +234567899 a_1de*Gg xy1Me*__ !41deF_hij2lMnopq3ss C234567890123$^67800 *5555555 sDF564zer"" !!!!!!!!!4!!!!!!!!!! abcdefghijklmnopq9ss May not match : Cannot be less then 8 or more then 20 chars: a_1+Eff B41def_hIJ2lmnopq3stt Cannot contain a whitespace: A_4 e*gg b41def_Hij2l nopq3ss Cannot start with a number or an underscore: __1+Eff 841DEf_hij2lmnopq3stt cannot end on 2 diffrent characters: a_1+eFg b41DEf_hij2lmnopq3st Cannot be without a number in the string: abCDefghijklmnopqrss abcdef+++dF !!!!!!!!!!!!!!!!!!!! ------------------------------------------------------ This is what I have so far...But I'm really breaking my head on this... If you Don't know the answer completely it's not a problem... I just want to get in the right direction ([^0-9_])(?=.*\d)(\S{8,20})(?i:[\S])\1

    Read the article

  • Continuous Flash music player while navigating site

    - by phx-zs
    I have a site that includes a Flash music player integrated into the layout. I want users to be able to navigate around the site without interrupting the music. I've done plenty of research and thinking and the following are the options I came up with (keeping in mind I want to be as SEO friendly as possible). Anyone have another idea? AJAX: I set up a version that changes the main content div to whatever nav link they click, thereby not interrupting the Flash player. I set it up in the proper search-engine-friendly manner with direct links and JQuery/Ajax functions. If someone goes to site.com/ and clicks the Contact nav link, it loads what's in the main content div on site.com/contact.php into the main content div and changes the URL bar to site.com/#Contact. The same goes for if they go to site.com/contact.php and click About in the nav, it loads the About content and changes the URL bar to site.com/contact.php#About. Obviously this opens up a whole new can of worms with AJAX and hash navigation/history issues, and I would end up with people possibly linking to things like site.com/contact.php#About (which I think looks terrible and can't be too great for SEO). Store the Flash player vars somewhere and reload them with the page: I'm not sure how to go about this, but I thought about keeping my regular navigation without AJAX and have it so when a user clicks a nav link, before it changes pages it stores the Flash player vars (current song and song position) somewhere, then loads them into Flash when the new page loads. Something with an iframe? Good alternative to a Flash player that will work for this type of application? Thanks!

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • class modifier issues in C# with "private" classes

    - by devoured elysium
    I had a class that had lots of methods: public class MyClass { public bool checkConditions() { return checkCondition1() && checkCondition2() && checkCondition3(); } ...conditions methods public void DoProcess() { FirstPartOfProcess(); SecondPartOfProcess(); ThirdPartOfProcess(); } ...process methods } I identified two "vital" work areas, and decided to extract those methods to classes of its own: public class MyClass { private readonly MyClassConditions _conditions = new ...; private readonly MyClassProcessExecution = new ...; public bool checkConditions() { return _conditions.checkConditions(); } public void DoProcess() { _process.DoProcess(); } } In Java, I'd define MyClassConditions and MyClassProcessExecution as package protected, but I can't do that in C#. How would you go about doing this in C#? Setting both classes as inner classes of MyClass? I have 2 options: I either define them inside MyClass, having everything in the same file, which looks confusing and ugly, or I can define MyClass as a partial class, having one file for MyClass, other for MyClassConditions and other for MyClassProcessExecution. Defining them as internal? I don't really like that much of the internal modifier, as I don't find these classes add any value at all for the rest of my program/assembly, and I'd like to hide them if possible. It's not like they're gonna be useful/reusable in any other part of the program. Keep them as public? I can't see why, but I've let this option here. Any other? Name it! Thanks

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >