Search Results

Search found 16061 results on 643 pages for 'array indexing'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 282/643 | < Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >

  • assigning a list in python

    - by mekasperasky
    pt=[2] pt[0]=raw_input() when i do this , and give an input suppose 1011 , it says list indexing error- " list assignment index out of range" . may i know why? i think i am not able to assign a list properly . how to assign an array of 2 elements in python then?

    Read the article

  • Why ruby has to_s and inspect?

    - by prosseek
    The p calls inspect, and puts/print calls to_s for representing its object. If I run class Graph def initialize @nodeArray = Array.new @wireArray = Array.new end def to_s # called with print / puts "Graph : #{@nodeArray.size}" end def inspect # called with p "G" end end if __FILE__ == $0 gr = Graph.new p gr print gr puts gr end I get G Graph : 0Graph : 0 Then, why does ruby has two functions do the same thing? What makes the difference between to_s and inspect? If I comment out the to_s or inspect function, I get as follows. ##

    Read the article

  • Serialize or json in PHP?

    - by kavoir.com
    So I need to encode an array in PHP and store it in plain text in MySQL database, my question is should I use serialize() or json_encode()? What are the advantages and disadvantages of each of them? I think either of them would do in this situation. But which one would you prefer and why? If it is for something other than an array?

    Read the article

  • Creating a structure from bytes with ctypes and IronPython

    - by Adal
    I have the following CPython code which I now try to run in IronPython: import ctypes class BarHeader(ctypes.Structure): _fields_ = [ ("id", ctypes.c_char * 4), ("version", ctypes.c_uint32)] bar_file = open("data.bar", "rb") header_raw = bar_file.read(ctypes.sizeof(BarHeader)) header = BarHeader.from_buffer_copy(header_raw) The last line raises this exception: TypeError: expected array, got str I tried BarHeader.from_buffer_copy(bytes(header_raw)) instead of the above, but then the exception message changes to TypeError: expected array, got bytes. Any idea what I'm doing wrong?

    Read the article

  • How to find about structure of bitmap and JPEG files?

    - by Sorush Rabiee
    I'm trying to write a very simple image processing program for fun and practice. I was using System.Drawing. ... .Bitmap class to handle images and edit their data. but now I want to write my own class of Bitmap object implementation and want to know how bmp files (and other common bitmap formats) and their meta-data (indexing, color system & etc) are stored in files, and how to read and write them directly?

    Read the article

  • c++ quick sort running time

    - by chnet
    I have a question about quick sort algorithm. I implement quick sort algorithm and play it. The elements in initial unsorted array are random numbers chosen from certain range. I find the range of random number effects the running time. For example, the running time for 1, 000, 000 random number chosen from the range (1 - 2000) takes 40 seconds. While it takes 9 seconds if the 1,000,000 number chosen from the range (1 - 10,000). But I do not know how to explain it. In class, we talk about the pivot value can effect the depth of recursion tree. For my implementation, the last value of the array is chosen as pivot value. I do not use randomized scheme to select pivot value. int partition( vector<int> &vec, int p, int r) { int x = vec[r]; int i = (p-1); int j = p; while(1) { if (vec[j] <= x){ i = (i+1); int temp = vec[j]; vec[j] = vec[i]; vec[i] = temp; } j=j+1; if (j==r) break; } int temp = vec[i+1]; vec[i+1] = vec[r]; vec[r] = temp; return i+1; } void quicksort ( vector<int> &vec, int p, int r) { if (p<r){ int q = partition(vec, p, r); quicksort(vec, p, q-1); quicksort(vec, q+1, r); } } void random_generator(int num, int * array) { srand((unsigned)time(0)); int random_integer; for(int index=0; index< num; index++){ random_integer = (rand()%10000)+1; *(array+index) = random_integer; } } int main() { int array_size = 1000000; int input_array[array_size]; random_generator(array_size, input_array); vector<int> vec(input_array, input_array+array_size); clock_t t1, t2; t1 = clock(); quicksort(vec, 0, (array_size - 1)); // call quick sort int length = vec.size(); t2 = clock(); float diff = ((float)t2 - (float)t1); cout << diff << endl; cout << diff/CLOCKS_PER_SEC <<endl; }

    Read the article

  • Regular Expressions in PHP

    - by kelly
    Sorry for unclear description, my English is not good. My problem is that I want to decode a string, and this string has nested content delimited by {}. For example: The string: {any string0{any string 00{any string 000....}}}{any string1}any string. The result I want to get: array[0] = {any string0{any string 00{any string 000....}}} array[1] = {any string1} I hope it's clear enough.

    Read the article

  • Why aren't arrays expandable?

    - by Mustafa
    When we create an array, we cannot change its size; it's fixed. OK, seems nice, we can create a new bigger array and copy the values one by one and that's little slow. What's the technical background of it?

    Read the article

  • How do I use ViewScripts on Zend_Form File Elements?

    - by Sonny
    I am using this ViewScript for my standard form elements: <div class="field" id="field_<?php echo $this->element->getId(); ?>"> <?php if (0 < strlen($this->element->getLabel())) : ?> <?php echo $this->formLabel($this->element->getName(), $this->element->getLabel());?> <?php endif; ?> <span class="value"><?php echo $this->{$this->element->helper}( $this->element->getName(), $this->element->getValue(), $this->element->getAttribs() ) ?></span> <?php if (0 < $this->element->getMessages()->length) : ?> <?php echo $this->formErrors($this->element->getMessages()); ?> <?php endif; ?> <?php if (0 < strlen($this->element->getDescription())) : ?> <span class="hint"><?php echo $this->element->getDescription(); ?></span> <?php endif; ?> </div> Trying to use that ViewScript alone results in an error: Exception caught by form: No file decorator found... unable to render file element Looking at this FAQ revealed part of my problem, and I updated my form element decorators like this: 'decorators' => array( array('File'), array('ViewScript', array('viewScript' => 'form/field.phtml')) ) Now it's rendering the file element twice, once within my view script, and extra elements with the file element outside my view script: <input type="hidden" name="MAX_FILE_SIZE" value="8388608" id="MAX_FILE_SIZE" /> <input type="hidden" name="UPLOAD_IDENTIFIER" value="4b5f7335a55ee" id="progress_key" /> <input type="file" name="upload_file" id="upload_file" /> <div class="field" id="field_upload_file"> <label for="upload_file">Upload File</label> <span class="value"><input type="file" name="upload_file" id="upload_file" /></span> </div> Any ideas on how to handle this properly with a ViewScript?

    Read the article

  • What's the regex to solve this problem?

    - by Yeti
    I have an array in PHP with URLs like below: http://example.com/apps/1235554/ http://example.com/apps/apple/ http://example.com/apps/126734 http://example.com/images/a.jpg http://example.com/images/b.jpg http://example.com/apps/2331234/ http://example.com/apps/orange/ How can I separate out these urls and push them to another array using Regex: http://example.com/apps/1235554/ http://example.com/apps/126734 http://example.com/apps/2331234/ Only url with apps/{number}/ and apps/{number} should be selected.

    Read the article

  • Using FlashVars to pass variables to a SWF

    - by SoeTheingiLin
    I would like to pass over 50 items of variables from php to flash. Actually I want to pass array with foreach statement, looping through the array and assigning loop index to the variables and flash again accept the php values through looping. Is this possible? If passing values through foreach or loop statement is impossible, I would like to break a new line in tag. how can I break a new line in FlashVars tag?

    Read the article

  • In Javascript, how to avoid NaN when adding arrays

    - by Jonas
    I'm trying to add the values of two arrays in javascript eg. [1,2,1] + [3,2,3,4] The answer should be 4,4,4,4 but I'm either getting 4,4,4 or 4,4,4,NaN if I change the 1st array length to 4. I know a 4th number needs to be in the 1st array, but i can't figure out how to tell javascript to make it 0 rather then undefined if there is no number.

    Read the article

  • How to create an object from 2 arrays?

    - by Ole Jak
    So I hava array Links and array Params with same langth N So what I need is to create an object where for each link from Links I will be able to see param from Params And than for example to be abble to call something like for each( item in object) if (item.param == "some value") { // some code } else... How to do such thing (Code exaMple, please)

    Read the article

  • Magento user created attribute for products is not saved...

    - by Elzo Valugi
    I am fighting an apparently simple thing for about two days now. I hope somebody can help. I created the myUpdate EAV attribute class Company_Module_Model_Resource_Eav_Mysql4_Setup extends Mage_Eav_Model_Entity_Setup { public function getDefaultEntities() { return array( 'catalog_product' => array( 'entity_model' => 'catalog/product', 'attribute_model' => 'catalog/resource_eav_attribute', 'table' => 'catalog/product', 'additional_attribute_table' => 'catalog/eav_attribute', 'entity_attribute_collection' => 'catalog/product_attribute_collection', 'attributes' => array( 'my_update' => array( 'label' => 'My timestamp', 'type' => 'datetime', 'input' => 'date', 'default' => '', 'class' => 'validate-date', 'backend' => 'eav/entity_attribute_backend_datetime', 'frontend' => '', 'table' => '', 'source' => '', 'global' => Mage_Catalog_Model_Resource_Eav_Attribute::SCOPE_GLOBAL, 'visible' => true, 'required' => false, 'user_defined' => true, 'searchable' => false, 'filterable' => false, 'comparable' => false, 'visible_on_front' => false, 'visible_in_advanced_search' => false, 'unique' => false, 'apply_to' => 'simple', ) ) ) ); } } The attribute is created OK and on install appears correctly in the list of attributes. Later I do // for product 1 $product->setMyUpdate($stringDate); // string this format: yyyy-MM-dd HH:mm:ss $product->save(); // and saves without issues * in admin module But later when I do: $product = Mage::getModel('catalog/product')->load(1); var_dump($product->getMyUpdate()); // returns null Somehow the data is not really saved.. or I am not retrieving it correctly. Please advice on how to get the data and where the data is saved in the DB so I can check at if the insert is done correctly. Thanks.

    Read the article

  • PHP: Count-IF for Arrays

    - by st4ck0v3rfl0w
    Hi All, What would be the most efficient way of counting the number of times a value appears inside an array? Example Array ('apple','apple','banana','banana','kiwi') Ultimately I want a function to spit out the percentages for charting purposes (e.g. apple = 40%, banana = 40%, kiwi = 20%)

    Read the article

  • jQuery selector not working in IE

    - by CurlyFro
    this method should return a unique array of text from rows with a specific td class. works in ffs and chrome but not in ie8 or safari. can you spot the problem? function getUniqueIds() { var tblLnks = new Array(); $('td.tblLnk').each(function() { tblLnks.push($(this).text().trim()); }); return tblLnks.unique(); }

    Read the article

  • SEO Help with Pages Indexed by Google

    - by Joe Majewski
    I'm working on optimizing my site for Google's search engine, and lately I've noticed that when doing a "site:www.joemajewski.com" query, I get results for pages that shouldn't be indexed at all. Let's take a look at this page, for example: http://www.joemajewski.com/wow/profile.php?id=3 I created my own CMS, and this is simply a breakdown of user id #3's statistics, which I noticed is indexed by Google, although it shouldn't be. I understand that it takes some time before Google's results reflect accurately on my site's content, but this has been improperly indexed for nearly six months now. Here are the precautions that I have taken: My robots.txt file has a line like this: Disallow: /wow/profile.php* When running the url through Google Webmaster Tools, it indicates that I did, indeed, correctly create the disallow command. It did state, however, that a page that doesn't get crawled may still get displayed in the search results if it's being linked to. Thus, I took one more precaution. In the source code I included the following meta data: <meta name="robots" content="noindex,follow" /> I am assuming that follow means to use the page when calculating PageRank, etc, and the noindex tells Google to not display the page in the search results. This page, profile.php, is used to take the $_GET['id'] and find the corresponding registered user. It displays a bit of information about that user, but is in no way relevant enough to warrant a display in the search results, so that is why I am trying to stop Google from indexing it. This is not the only page Google is indexing that I would like removed. I also have a WordPress blog, and there are many category pages, tag pages, and archive pages that I would like removed, and am doing the same procedures to attempt to remove them. Can someone explain how to get pages removed from Google's search results, and possibly some criteria that should help determine what types of pages that I don't want indexed. In terms of my WordPress blog, the only pages that I truly want indexed are my articles. Everything else I have tried to block, with little luck from Google. Can someone also explain why it's bad to have pages indexed that don't provide any new or relevant content, such as pages for WordPress tags or categories, which are clearly never going to receive traffic from Google. Thanks!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How do you pipe output from a Ruby script to 'head' without getting a broken pipe error

    - by dan
    I have a simple Ruby script that looks like this require 'csv' while line = STDIN.gets array = CSV.parse_line(line) puts array[2] end But when I try using this script in a Unix pipeline like this, I get 10 lines of output, followed by an error: ruby lib/myscript.rb < data.csv | head 12080450 12080451 12080517 12081046 12081048 12081050 12081051 12081052 12081054 lib/myscript.rb:4:in `write': Broken pipe - <STDOUT> (Errno::EPIPE) Is there a way to write the Ruby script in a way that prevents the broken pipe exception from being raised?

    Read the article

  • How to ANSI-C cast from unisigned int * to char *?

    - by user314290
    I want these two print functions to do the same thing: unsigned int Arraye[] = {0xffff,0xefef,65,66,67,68,69,0}; char Arrage[] = {0xffff,0xefef,65,66,67,68,69,0}; printf("%s", (char*)(2+ Arraye)); printf("%s", (char*)(2+ Arrage)); where Array is an unsigned int. Normally, I would change the type but, the problem is that most of the array is numbers, although the particular section should be printed as ASCII.

    Read the article

  • Python: Split, strip, and join in one line

    - by PandemoniumSyndicate
    I'm curious if their is some python magic I may not know to accomplish a bit of frivolity given the line: csvData.append(','.join([line.split(":").strip() for x in L])) I'm attempting to split a line on :, trim whitespace around it, and join on , problem is, since the array is returned from line.split(":"), the for x in L #<== L doesn't exist! causes issues since I have no name for the array returned by line.split(":") So I'm curious if there is a sexy piece of syntax I could use to accomplish this in one shot? Cheers!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 278 279 280 281 282 283 284 285 286 287 288 289  | Next Page >