Search Results

Search found 91480 results on 3660 pages for 'large data in sharepoint list'.

Page 294/3660 | < Previous Page | 290 291 292 293 294 295 296 297 298 299 300 301  | Next Page >

  • Best way to get distinct values from large table

    - by derivation
    I have a db table with about 10 or so columns, two of which are month and year. The table has about 250k rows now, and we expect it to grow by about 100-150k records a month. A lot of queries involve the month and year column (ex, all records from march 2010), and so we frequently need to get the available month and year combinations (ie do we have records for april 2010?). A coworker thinks that we should have a separate table from our main one that only contains the months and years we have data for. We only add records to our main table once a month, so it would just be a small update on the end of our scripts to add the new entry to this second table. This second table would be queried whenever we need to find the available month/year entries on the first table. This solution feels kludgy to me and a violation of DRY. What do you think is the correct way of solving this problem? Is there a better way than having two tables?

    Read the article

  • Dealing with large directories in a checkout

    - by Eric
    I am trying to come up with a version control process for a web app that I work on. Currently, my major stumbling blocks are two directories that are huge (both over 4GB). Only a few people need to work on things within the huge directories; most people don't even need to see what's in them. Our directory structure looks something like: / --file.aspx --anotherFile.aspx --/coolThings ----coolThing.aspx --/bigFolder ----someHugeMovie.mov ----someHugeSound.mp3 --/anotherBigFolder ----... I'm sure you get the picture. It's hard to justify a checkout that has to pull down 8GB of data that's likely useless to a developer. I know, it's only once, but even once could be really frustrating for someone (and will make it harder for me to convince everyone to use source control). (Plus, clean checkouts will be painfully slow.) These folders do have to be available in the web application. What can I do? I've thought about separate repositories for the big folders. That way, you only download if you need it; but then how do I manage checking these out onto our development server? I've also thought about not trying to version control those folders: just update them directly on the web server... but I am not enamored of this idea. Is there some magic way to simply exclude directories from a checkout that I haven't found? (Pretty sure there is not.) Of course, there's always the option to just give up, bite the bullet, and accept downloading 8 useless GB. What say you? Have you encountered this problem before? How did you solve it?

    Read the article

  • How Can I Bypass the X-Frame-Options: SAMEORIGIN HTTP Header?

    - by Daniel Coffman
    I am developing a web page that needs to display, in an iframe, a report served by another company's SharePoint server. They are fine with this. The page we're trying to render in the iframe is giving us X-Frame-Options: SAMEORIGIN which causes the browser (at least IE8) to refuse to render the content in a frame. First, is this something they can control or is it something SharePoint just does by default? If I ask them to turn this off, could they even do it? Second, can I do something to tell the browser to ignore this http header and just render the frame?

    Read the article

  • WCF, Timer Jobs, Web Service which is better ???

    - by kannan.ambadi
    I am working with a Web application, based on Asp.Net 3.5 and WSS 3.0 platform. Recenlty i've got a task as follows. Import bank statement using FTX - Desktop application and parse those statements into database in every 24 hours ie. i need to download bank statement with the help of a desktop application(which i can call by batch file). Then i have to go through each statement(text file) and convert those data into our database for future reference. As far as i know, .Net provides the following options to implement such a functionality. SharePoint Timer Jobs Web Services WCF Windows Services I would like to go for SharePoint Timer Jobs, but there are some plans to move whole application to Asp.net platform. I am interested with WCF since i haven't much experience with WCF applications, but not in a position to take final decision :) Which is the most suitable way for this kind of task? Please suggest.

    Read the article

  • Can't Deploy or Upload Large SSRS 2008 Report from VS or IE

    - by Bratch
    So far in this project I have two reports in VS2008/BIDS. The first one contains 1 tablix and is about 100k. The second one contains 3 tablixes (tablices?) and is about 257k. I can successfully deploy the smaller report from VS and I can upload it from the Report Manager in IE. I can view/run it from Report Manager and I can get to the Report Server (web service) URL from my browser just fine. Everything is done over HTTPS and there is nothing wrong with the certificates. With the larger report, the error I get in VS is "The operation has timed out" after about 100 seconds. The error when I upload from IE is "The underlying connection was closed: An unexpected error occurred on a send" after about 130 seconds. In the RSReportServer.config file I tried changing Authentication/EnableAuthPersistence from true to false and restarting the service, but still get the error. I have the key "SecureConnectionLevel" set to 2. Changing this to 0 and turning off SSL is not going to be an option. I added a registry key named "MaxRequestBytes" to HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\HTTP\Parameters and set it to 5242880 (5MB) and restarted the HTTP and SRS services as suggested in a forum post by Jin Chen of MSFT. I still cannot upload the larger report. This is on MS SQL 2008 and WS 2003. Below is part of a log file entry from ...\Reporting Services\LogFiles when I attempted to upload from IE. library!WindowsService_0!89c!02/10/2010-07:57:57:: i INFO: Call to CleanBatch() ends ui!ReportManager_0-1!438!02/10/2010-07:59:33:: e ERROR: The underlying connection was closed: An unexpected error occurred on a send. ui!ReportManager_0-1!438!02/10/2010-07:59:34:: e ERROR: HTTP status code -- 500 -------Details-------- System.Net.WebException: The underlying connection was closed: An unexpected error occurred on a send. --- System.IO.IOException: Unable to write data to the transport connection: An established connection was aborted by the software in your host machine. --- System.Net.Sockets.SocketException: An established connection was aborted by the software in your host machine at System.Net.Sockets.Socket.MultipleSend(BufferOffsetSize[] buffers, SocketFlags socketFlags) at System.Net.Sockets.NetworkStream.MultipleWrite(BufferOffsetSize[] buffers) --- End of inner exception stack trace --- ...

    Read the article

  • using Silverlight in SCORM content

    - by Jason
    I'm building a LMS system using Sharepoint (WSS 3.0) with the Sharepoint Learning Kit (SLK). One of the requirements is to be able to host Silverlight content within the SCORM package. Has anyone done this before? I haven't been able to find much (anything) online that talks about how to do this. Most of the content tools that exist for SCORM are able to handle Flash, but I haven't come across anything that will do Silverlight. If all else fails, I'll try to manually build a SCORM package, but I'd really like to find some examples or howtos of doing this with Silverlight first. Has anyone done this before?

    Read the article

  • Building webparts with Visual Studio 2010 Express

    - by MalphasWats
    Hi, I'm trying to get started with building my own webparts, planning to follow this MSDN article. I've downloaded Visual C# 2010 Express - I'm not quite at the point where I feel comfortable dropping 1000 big ones yet, and I installed Visual Web Developer 2010 Express via the WPInstaller. Following through the tutorial, aside from the fact that I don't get the option to create a "Web Control Library", a gap I filled with this article, I can't seem to find the sn.exe tool (or the "Visual Studio 2005 Command Prompt"!). I know it's not quite a direct programming related question, but I can't even get the thing going yet! Any help is appreciated. Thanks EDIT:- I think I may be jumping the gun quite considerably, I wrote a simple hello world example and tried to build it but it doesn't have any references to the Microsoft.SharePoint packages and they don't appear in my lists. Am I understanding some more research I've done (namely this) correctly, in that I have to actually have a full installation of actual SharePoint on the machine I'm developing on?

    Read the article

  • ASP.NET: Large number of Session_Start with same session id

    - by Jaap
    I'm running a ASP.NET website on my development box (.NET 2.0 on Vista/IIS7). The Session_Start method in global.asax.cs logs every call to a file (log4net). The Session_End method also logs every call. I'm using InProc session state, and set the session timeout to 5 mins (to avoid waiting for 20 mins). I hit the website, wait for 5 minutes unit I see the Session_End logging. Then I F5 the website. The browsers still has the session cookie and sends it to the server. Session_Start is called and a new session is created using the same session id (btw: I need this to be the same session id, because it is used to store data in database). Result: Every time I hit F5 on a previously ended session, the Session_Start method is called. When I open a different browser, the Session_Start method is called just once. Then after 5 minutes the Session_End each F5 causes the Session_Start method to execute. Can anyone explain why this is happening? Update: After the Session timeout, all subsequent requests have a session start & session end. So in the end my question is: why are the sessions on these subsequent request closed immediatly? 2010-02-09 14:49:08,754 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,754 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET http://localhost:80/js/settings.js 2010-02-09 14:49:08,756 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,760 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,760 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /css/package.aspx?name=core 2010-02-09 14:49:08,761 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,762 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,762 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /js/package.aspx?name=all 2010-02-09 14:49:08,763 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,763 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,763 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /css/package.aspx?name=rest 2010-02-09 14:49:08,764 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq 2010-02-09 14:49:08,764 INFO Global.asax[7486] [(null)] - Session started. SID=nzponumvf1hbaniverffp4mq host=127.0.0.1 2010-02-09 14:49:08,765 INFO Global.asax[7486] [nzponumvf1hbaniverffp4mq] - Request start: GET /css/package.aspx?name=vacation 2010-02-09 14:49:08,765 INFO Global.asax[7486] [(null)] - Session ended. SID=nzponumvf1hbaniverffp4mq web.config relevant section: <system.web> <compilation debug="true" /> <sessionState timeout="2" regenerateExpiredSessionId="false" /> </system.web>

    Read the article

  • Which is the better approach in custom pages ?

    - by Mina Samy
    Hi all I want to create a custom new item page for sharepoint but there are two approached that I can use and I want to share your experience in determining which is better. The first: is to create a page in a library then create a C# library project to handle the events of the controls on the page. The second: is to define a feature of the content type of my list and specify the new item form to be my custom form, then create a website containing the custom form and put this site at the layouts folder. for me the first approach is fine but the problem is that a user may access the default sharepoint new item form which I don't want to happen. but I don't like the idea of placing the form in a library on the site. so which is better in your opinion ? thanks

    Read the article

  • Importing wikipedia database dumb - kills navicat - anyone got any ideas?

    - by Ali
    Ok guys I've downloaded the wikipedia xml dump and its a whopping 12 GB of data :\ for one table and I wanted to import it into mysql databse on my localhost - however its a humongous file 12GB and obviously navicats taking its sweet time in importing it or its more likely its hanged :(. Is there a way to include this dump or atleast partially at most you know bit by bit. Let me correct that its 21 GB of data - not that it helps :\ - does any one have any idea of importing humongous files like this into MySQL database.

    Read the article

  • Is there a fast way to jump to element using XMLReader?

    - by Derk
    I am using XMLReader to read a large XML file with about 1 million elements on the level I am reading from. However, I've calculated it will take over 10 seconds when I jump to -for instance- element 500.000 using XMLReader::next ([ string $localname ] ) or XMLReader::read ( void ) This is not very usable. Is there a faster way to do this?

    Read the article

  • How do quickly search through a .csv file in Python

    - by Baldur
    I'm reading a 6 million entry .csv file with Python, and I want to be able to search through this file for a particular entry. Are there any tricks to search the entire file? Should you read the whole thing into a dictionary or should you perform a search every time? I tried loading it into a dictionary but that took ages so I'm currently searching through the whole file every time which seems wasteful. Could I possibly utilize that the list is alphabetically ordered? (e.g. if the search word starts with "b" I only search from the line that includes the first word beginning with "b" to the line that includes the last word beginning with "b") I'm using import csv. (a side question: it is possible to make csv go to a specific line in the file? I want to make the program start at a random line) Edit: I already have a copy of the list as an .sql file as well, how could I implement that into Python?

    Read the article

  • What method should be used for searching this mysql dataset?

    - by GeoffreyF67
    I've got a mysql dataset that contains 86 million rows. I need to have a relatively fast search through this data. The data I'll be searching through is all strings. I also need to do partial matches. Now, if I have 'foobar' and search for '%oob%' I know it'll be really slow - it has to look at every row to see if there is a match. What methods can be used to speed queries like this up? G-Man

    Read the article

  • MOSS 2007 team site page title

    - by nav
    Hi, I'm trying to display the page title (html title) on the default.aspx page of a custom site template. The template is based on a MOSS team site template. All that displays is the URL of the page as the page title. Can I change the code in the default.aspx and/or the sites master page to define the title myself? Details of the deafult.aspx and default.master page as below: Thanks. Default.aspx: <asp:Content ContentPlaceHolderId="PlaceHolderPageTitle" runat="server"> <SharePoint:EncodedLiteral runat="server" text="<%$Resources:wss,multipages_homelink_text%>" EncodeMethod="HtmlEncode"/> - <SharePoint:ProjectProperty Property="Title" runat="server"/> </asp:Content> default.master <Title ID=onetidTitle><asp:ContentPlaceHolder id=PlaceHolderPageTitle runat="server"/></Title>

    Read the article

  • Referencing a control inside a XSL Template from code behind ?

    - by Mina Samy
    Hi all I have a custom NewItem.aspx that I made by creating a new aspx from the exisiting one I wanted to put a control in a row inside the XSL Template like this <asp:DropDownList ID="ddlSectors" AutoPostBack="true" runat="server" __designer:bind="{ddwrt:DataBind('i',ddlSectors,'SelectedValue','TextChanged','ID',ddwrt:EscapeDelims(string(@ID)),'@Sector')}"> </asp:DropDownList> <!--<SharePoint:FormField runat="server" id="ff7{$Pos}" ControlMode="New" FieldName="Sector" __designer:bind="{ddwrt:DataBind('i',concat('ff7',$Pos),'Value','ValueChanged','ID',ddwrt:EscapeDelims(string(@ID)),'@Sector')}"/>--> <SharePoint:FieldDescription runat="server" id="ff7description{$Pos}" FieldName="Sector" ControlMode="New"/> Now I want to reference ddlSectors from my code library but it always throws an object reference not set to an instatnce of an object. I believe that this is becuase the control is inside the XSL template. so is there any workaround for this ? thanks

    Read the article

  • When to use CreateChildControls() vs. embedding in the ASPX

    - by Kelly French
    I'm developing a webpart for SharePoint 2007 and have seen several posts that advise to do all the creation of controls in the code-behind. I'm transitioning from Java J2EE development so I don't have the platform history of .Net/ASP/etc. In other places it shows how you can do the same thing by embedding the control definition into the asp page with tags My question is this: What is the rule governing where to implement controls? Has this rule changed recently, ASP vs ASP.Net or ASP.Net MVC maybe? Is this advice limited to SharePoint development?

    Read the article

  • Connect Infopath form To Outlook - shows as xml

    - by gab
    In Sharepoint, i have a Forms Library. I would like to connect it to oulook. The problem is that once I do that, Outlook will display the forms in a .XML rendering...a bunch of text, not very user friendly. (I am using Sharepoint 2010, InfoPath 2010, Outlook 2010) Am I missing some kind of settings? How can I display the forms in Outlook in a rendered type of view. (I have tried this with Forms that open in Browser, as well as with Forms that open in Client application, with the same results for both.)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to recover deleted files on ext3 fs

    - by Mike
    I have a drive which was using the ext3 filesystem. I am told that about 10Gb of data was deleted off the drive (probably via rm). The drive is currently mounted as read-only to preserve all data. Does anyone know of a method to restore some or all of the data? Also if it helps, the OS was Fedora. I've also been told that the data is mostly ASCII fortan source code and Matlab files. Conclusion I have finally managed to get the data back, and with the simplest means ever! After weeks of trying and failing to bring back much of any data, I brought someone in today to take a look at it and offer suggestions, he simply cd'd to the directory and everything was there! It was never lost in the first place!!! Needless to say I feel really dumb right now, but I learned quite a lot with this whole fiasco. At any rate, while I was looking through data forensics solutions, I found that the Autopsy, or more specifically the SleuthKit was the most helpful. So I will accept that as the final answer. I would also like to note for anyone that comes across this later on that the most up-voted (currently) answer by sekenre was also helpful and I learned a lot, but ultimately it did not help with the type (very many, and some being very large) of files I was dealing with. So thank to all you that provided suggestions and wish you all the best!

    Read the article

  • Create a WebPart which displays people who have rights on lists

    - by cocoggu
    I want to develop a WebPart in C# to display peoples who have a certain right on the list of the SharePoint page. So I began by creating a "Visual Web Part" in VS2010, and in the View Designer I add a DataList because I think it is the most relevant. But now, I don't know how to link my data with this DataList. It ask me for an XML file but which one choose ? And where can I take it ? After all, how to make this WebPart generic with all my SharePoint pages which implements one list ?

    Read the article

  • ZFS Data Loss Scenarios

    - by Obtuse
    I'm looking toward building a largish ZFS Pool (150TB+), and I'd like to hear people experiences about data loss scenarios due to failed hardware, in particular, distinguishing between instances where just some data is lost vs. the whole filesystem (of if there even is such a distinction in ZFS). For example: let's say a vdev is lost due to a failure like an external drive enclosure losing power, or a controller card failing. From what I've read the pool should go into a faulted mode, but if the vdev is returned the pool should recover? or not? or if the vdev is partially damaged, does one lose the whole pool, some files, etc.? What happens if a ZIL device fails? Or just one of several ZILs? Truly any and all anecdotes or hypothetical scenarios backed by deep technical knowledge are appreciated! Thanks! Update: We're doing this on the cheap since we are a small business (9 people or so) but we generate a fair amount of imaging data. The data is mostly smallish files, by my count about 500k files per TB. The data is important but not uber-critical. We are planning to use the ZFS pool to mirror 48TB "live" data array (in use for 3 years or so), and use the the rest of the storage for 'archived' data. The pool will be shared using NFS. The rack is supposedly on a building backup generator line, and we have two APC UPSes capable of powering the rack at full load for 5 mins or so.

    Read the article

  • Parsing Huge XML Files in PHP

    - by Ian
    I'm trying to parse the dmoz content/structures xml files into mysql, but all existing scripts to do this are very old and don't work well. How can I go about opening a large (+1GB) xml file in php for parsing?

    Read the article

< Previous Page | 290 291 292 293 294 295 296 297 298 299 300 301  | Next Page >