Search Results

Search found 104525 results on 4181 pages for 'code search engine'.

Page 311/4181 | < Previous Page | 307 308 309 310 311 312 313 314 315 316 317 318  | Next Page >

  • Problem detaching entire object graph in GAE-J with JDO

    - by tempy
    I am trying to load the full object graph for User, which contains a collection of decks, which then contains a collection of cards, as such: User: @PersistenceCapable(detachable = "true") @Inheritance(strategy = InheritanceStrategy.SUBCLASS_TABLE) @FetchGroup(name = "decks", members = { @Persistent(name = "_Decks") }) public abstract class User { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) protected Key _ID; @Persistent protected String _UniqueIdentifier; @Persistent(mappedBy = "_Owner") @Element(dependent = "true") protected Set<Deck> _Decks; protected User() { } } Each Deck has a collection of Cards, as such: @PersistenceCapable(detachable = "true") @FetchGroup(name = "cards", members = { @Persistent(name = "_Cards") }) public class Deck { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) private Key _ID; @Persistent String _Name; @Persistent(mappedBy = "_Parent") @Element(dependent = "true") private Set<Card> _Cards = new HashSet<Card>(); @Persistent private Set<String> _Tags = new HashSet<String>(); @Persistent private User _Owner; } And finally, each card: @PersistenceCapable public class Card { @PrimaryKey @Persistent(valueStrategy = IdGeneratorStrategy.IDENTITY) private Key _ID; @Persistent private Text _Question; @Persistent private Text _Answer; @Persistent private Deck _Parent; } I am trying to retrieve and then detach the entire object graph. I can see in the debugger that it loads fine, but then when I get to detaching, I can't make anything beyond the User object load. (No Decks, no Cards). At first I tried without a transaction to simply "touch" all the fields on the attached object before detaching, but that didn't help. Then I tried adding everything to the default fetch group, but that just generated warnings about GAE not supporting joins. I tried setting the fetch plan's max fetch depth to -1, but that didn't do it. Finally, I tried using FetchGroups as you can see above, and then retrieving with the following code: PersistenceManager pm = _pmf.getPersistenceManager(); pm.setDetachAllOnCommit(true); pm.getFetchPlan().setGroup("decks"); pm.getFetchPlan().setGroup("cards"); Transaction tx = pm.currentTransaction(); Query query = null; try { tx.begin(); query = pm.newQuery(GoogleAccountsUser.class); //Subclass of User query.setFilter("_UniqueIdentifier == TheUser"); query.declareParameters("String TheUser"); List<User> results = (List<User>)query.execute(ID); //ID = Supplied parameter //TODO: Test for more than one result and throw if(results.size() == 0) { tx.commit(); return null; } else { User usr = (User)results.get(0); //usr = pm.detachCopy(usr); tx.commit(); return usr; } } finally { query.closeAll(); if (tx.isActive()) { tx.rollback(); } pm.close(); } This also doesn't work, and I'm running out of ideas...

    Read the article

  • CodeCritics.com: A no nonsense place for coders to critique code and raise awareness of standards and "good coding standards" [closed]

    - by Visionary Software Solutions
    StackOverflow has been a boon for increasing programming knowledge by allowing developers to ask for help and knowledge related to programming. Oftentimes these questions boil down to: This code is broken, fix it I don't know how to do this Is this the best approach (hard question to answer on StackExchange, but democratic) Oftentimes, however, these questions are discussed at a very high level. "I use web services with a proxy client to ..." But, as Grady Booch is fond of saying "the Truth is raw, naked, running code". Those high level descriptions can be accomplished in any ways. Programming is an Art, and there are an infinite number of different ways to do things. But some are better than others. A site devoted to Q&A can help increase knowledge...a site devoted to critique of code can help elevate standards and result in higher quality knowledge. By upvoting the most elegant ways to solve a short, concise problem statement, or just looking at a piece of code and saying "this is ugly, how can we fix it?" we can increase community participation in discussions about the substantive details of an approach: "is my commenting clear? "Is this 3 nested for-loops with a continue that breaks in a special case a good way of building an object?" "Does this extremely generic and polymorphic inheritance hierarchy have issues?") Code is an art/craft and science/engineering artifact. Doesn't it deserve the same type of review treatment as a painting and an experiment? For praising those that provide that moment of zen when looking at exceptionally good code that makes you believe in a better tomorrow, and panning those whose offal is so offensive that were you to meet them on the job you'd say "YOU! GET OUT!!!" Hence, CodeCritics. A collaborative critiquing platform in the style of StackOverflow focused solely on critiquing code that can act as a collaborative code review and assist in the discovery of Design Patterns.

    Read the article

  • SharePoint 2010 Hosting :: Error Message - Your search cannot be completed because this site is not assigned to an indexer

    - by mbridge
    Error when we are trying to access search in sharepoint site: "Your search cannot be completed because this site is not assigned to an indexer. Contact your administrator for more information." Solving Problem: 1. Go to SharePoint Central Administration > Application Management > Content Databases (Underneath SharePoint Web Application Management). 2. Select the correct SharePoint web application – click on the name of the Content databases  - this will open the  “Manage Content Database Settings” page. 3. Make sure that the Search Server is set on the “Manage Content Database Settings” page. Hope it helps!!

    Read the article

  • how to get IP adress of google search/crawler bot to add to our white list of ip address

    - by Jayapal Chandran
    Hi, Google webmaster tools says network unreachable. When i contacted my hosting provider they said that they have installed firewall which could block frequent incoming ip addresses and they dont know the google's ip adress to unblock. so they requested me to find google search/crawler bot's ip adress so that they can add it to their whitelist. How to find the ip address of google search bot or crawler bot? My site stopped appearing in google search. My hits had gone too low. What should i do? any kind of reply would he helpful.

    Read the article

  • Does a longer registration length/period for a domain name improve its SEO and search ranking?

    - by Cupcake
    While I was renewing a domain of mine with a well-known domain registrar, the support person who was on call with me said that I'd improve the SEO ranking of my domain if I increased the registration length from 1 year to 5 years instead. The explanation that he gave me was something along the lines that a search engine like Google doesn't like to send users to domains and businesses that may no longer exist, and that by registering my domain for 5 years instead of just 1, Google would have higher confidence that I'm serious about keeping my business around for the long-term. Needless to say, I was quite skeptical. Does the registration/renewal length of a domain name affect its SEO and search result ranking for search engines such as Google?

    Read the article

  • How to allow Google Images search to by pass hotlink protection?

    - by Marco Demaio
    I saw Google Images seems to index my images only if hotlink protection is off. * I use anyway hotlink protection because I don't like the idea of people sucking my bandwidth, i simply this code to protcet my sites from being hotlinked: RewriteEngine on RewriteCond %{HTTP_REFERER} !^$ RewriteCond %{HTTP_REFERER} !^http(s)?://(www\.)?mydomain\.com/.*$ [NC] RewriteCond %{HTTP_REFERER} !^http(s)?://(www\.)?mydomain\.com$ [NC] RewriteRule .*\.(jpg|jpeg|png|gif)$ - [F,NC,L] But in order to allow Google Image search to bypass my hotlink protection (I want Google Images search to show my images) would it suffice to add a line like this one: RewriteCond %{HTTP_REFERER} !^http(s)?://(www\.)?google\.com/.*$ [NC] RewriteCond %{HTTP_REFERER} !^http(s)?://(www\.)?google\.com$ [NC] Because I'm wondring: is the crawler crawling just from google.com? and what about google.it / google.co.uk, etc.? FYI: on Google official guidelines I did not find info about this. I suppose hotlink protection prevents Google Images to show images in its results because I did some tests and it seems hotlink protection does prevent my images to be shown in Google Images search.

    Read the article

  • Should I prevent search engines indexing tag/category pages?

    - by Macha
    On my site, I currently have no special rules for search engines. It is a blog, statically generated using a Python program. When I search for some of my articles on Google, there is usually a tag or category page included in the results. Sometimes it even ranks ahead of the article itself. Obviously, as these links aren't always going to have the article on them, this aren't the results I want people to click on. So, I'm thinking of setting noindex on these pages. Is there any possible downside to doing so? Is this possible to do via robots.txt, or do I have to add it to all the relevant templates? All I can find for robots.txt are ways to stop the search engine crawling those pages, which isn't what I want - while I don't want them indexed, it's still the only surefire way to find all my blog posts.

    Read the article

  • We have a 200% increase of "organic" search traffic - how to figure out which keyword is causing this?

    - by Robert Grezan
    So our Google Analytics are showing us that 200% increase of "organic" search traffic. Analytics are saying that search keyword is "(not provided)". We are wondering how to find out which keyword is causing this? We are monitoring all important keywords for our website. None of keyword is in first 5, so our "organic" serach traffic is modest. However, today we received 200% increase of "organic" search traffic but none of keywords we can think of moved a bit. We also did not change anything related to SEO. And what is interesting Google Webmaster shows no changes - ~2500 impressions and ~200 clicks. How to find out which "keyword" might be causing this spike?

    Read the article

  • Google lance sa septième Search Appliance, ce moteur de recherche embarqué intègre des fonctionnalités SharePoint et l'API Translate

    Google lance sa septième « Search Appliance » Le moteur de recherche embarqué pour entreprises intègre des fonctionnalités SharePoint et l'API Translate Google vient de mettre à jour le firmeware de « Search Appliance », le dispositif incluant un moteur de recherche destiné aux entreprises. Une mise à jour qui allie performances, rapidité et précision dans le but d'offrir aux entreprises en interne les performances avancées de Google en matière de recherche, de gestion des langues et de pertinence. [IMG]http://idelways.developpez.com/news/images/photo-GSA.png[/IMG] Google Search Appliance (GSA) est maintenant disponible sous sa version 7.0. Celle-ci...

    Read the article

  • Will search engines ever change to allow longer title and description tags? [closed]

    - by guisasso
    I was just wondering: The standard title length is 64 characters, while meta description tags are 150-160. I was thinking, that it was probably done like that originally because of screen resolutions back in the day, that could not really fit a lot of content. Google still displays search results in a incredible small resolution fixed to the left side of the browser, and it's simplicity is probably what makes it so popular. With websites such as bing, displaying a richer more vivid search experience, in your opinion, will search engines ever change to accept better and longer meta description tags and titles? (I'm asking because we work to accommodate their standards, but what if they change?)

    Read the article

  • New! EBS : Search Helper for RVTII-060 Errors in Receiving (Doc ID 1391970.1)

    - by Oracle_EBS
    Next time you experience the RVTII-060 error when doing a receipt in Procurement, try our new Search Helper in DOC ID 1391970.1.  As shown in the screenshot below, simply pick the error you are experiencing and the symptom or symptoms that pertain and notes with possible solutions or help will be returned.  Drill down and review the notes to see if your issue can be resolved.  Choose the 'View Demonstration Video' link to watch a quick video for more information on how to use the Search Helper. To see all Procurement Search helpers go to the Procurement Product Information Centers in DOC ID 1391332.2.

    Read the article

  • How does process of updating code with Continous Integration work?

    - by BleakCabalist
    I want to draw a model of process of updating the source code with the use of Continous Integration. The main issue is I don't really understand how it works when there are several programmers working on various aspects of the code at the same time. I can't visualize it in my mind. Here's what I know but I might be wrong: New code is sent to repository. Continous Integration server asks Version Control System if there is a new code in repository. If there is than CIS executes tests on the code. If tests show there are problems than CIS orders VCS to revert back to working wersion of the code and communicates it to programmer. If tests are passed positively it compiles the repository code and makes new build of a game? New build is made not after ever single change, but at the end of the day I believe? Are my assumptions above correct? If yes, does it also work when there are several programmers updating repository at once? Is this enough to draw a model of the process in your opinions or did I miss something? Also, what software would I need for above process? Can you guys give examples for CIS software and VCS software and whatever else I need? Does CIS software perform code tests or do I need another tool for that and integrate it with CIS? Is there a repository software?

    Read the article

  • How to prevent a search engines from indexing a section of a page?

    - by BrunoLM
    I have many pages with lots of text in it. But I will always have two sections of text and I want to prevent one section from appearing in search results, the other section must be indexed. <p class="please-index-me">text</p> <p class="get-out">never index me please</p> I thought that maybe if I load the "please don't index me text" with Javascript maybe search engines wouldn't look for it. But I am not sure it would work and this is not really nice. I was wondering if there is a way to tell search engines "hey, this text you can't grab, move on". So, is there a way to do it?

    Read the article

  • parallelizing code using openmp

    - by anubhav
    Hi, The function below contains nested for loops. There are 3 of them. I have given the whole function below for easy understanding. I want to parallelize the code in the innermost for loop as it takes maximum CPU time. Then i can think about outer 2 for loops. I can see dependencies and internal inline functions in the innermost for loop . Can the innermost for loop be rewritten to enable parallelization using openmp pragmas. Please tell how. I am writing just the loop which i am interested in first and then the full function where this loop exists for referance. Interested in parallelizing the loop mentioned below. //* LOOP WHICH I WANT TO PARALLELIZE *// for (y = 0; y < 4; y++) { refptr = PelYline_11 (ref_pic, abs_y++, abs_x, img_height, img_width); LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; } The full function where this loop exists is below for referance. /*! *********************************************************************** * \brief * Setup the fast search for an macroblock *********************************************************************** */ void SetupFastFullPelSearch (short ref, int list) // <-- reference frame parameter, list0 or 1 { short pmv[2]; pel_t orig_blocks[256], *orgptr=orig_blocks, *refptr, *tem; // created pointer tem int offset_x, offset_y, x, y, range_partly_outside, ref_x, ref_y, pos, abs_x, abs_y, bindex, blky; int LineSadBlk0, LineSadBlk1, LineSadBlk2, LineSadBlk3; int max_width, max_height; int img_width, img_height; StorablePicture *ref_picture; pel_t *ref_pic; int** block_sad = BlockSAD[list][ref][7]; int search_range = max_search_range[list][ref]; int max_pos = (2*search_range+1) * (2*search_range+1); int list_offset = ((img->MbaffFrameFlag)&&(img->mb_data[img->current_mb_nr].mb_field))? img->current_mb_nr%2 ? 4 : 2 : 0; int apply_weights = ( (active_pps->weighted_pred_flag && (img->type == P_SLICE || img->type == SP_SLICE)) || (active_pps->weighted_bipred_idc && (img->type == B_SLICE))); ref_picture = listX[list+list_offset][ref]; //===== Use weighted Reference for ME ==== if (apply_weights && input->UseWeightedReferenceME) ref_pic = ref_picture->imgY_11_w; else ref_pic = ref_picture->imgY_11; max_width = ref_picture->size_x - 17; max_height = ref_picture->size_y - 17; img_width = ref_picture->size_x; img_height = ref_picture->size_y; //===== get search center: predictor of 16x16 block ===== SetMotionVectorPredictor (pmv, enc_picture->ref_idx, enc_picture->mv, ref, list, 0, 0, 16, 16); search_center_x[list][ref] = pmv[0] / 4; search_center_y[list][ref] = pmv[1] / 4; if (!input->rdopt) { //--- correct center so that (0,0) vector is inside --- search_center_x[list][ref] = max(-search_range, min(search_range, search_center_x[list][ref])); search_center_y[list][ref] = max(-search_range, min(search_range, search_center_y[list][ref])); } search_center_x[list][ref] += img->opix_x; search_center_y[list][ref] += img->opix_y; offset_x = search_center_x[list][ref]; offset_y = search_center_y[list][ref]; //===== copy original block for fast access ===== for (y = img->opix_y; y < img->opix_y+16; y++) for (x = img->opix_x; x < img->opix_x+16; x++) *orgptr++ = imgY_org [y][x]; //===== check if whole search range is inside image ===== if (offset_x >= search_range && offset_x <= max_width - search_range && offset_y >= search_range && offset_y <= max_height - search_range ) { range_partly_outside = 0; PelYline_11 = FastLine16Y_11; } else { range_partly_outside = 1; } //===== determine position of (0,0)-vector ===== if (!input->rdopt) { ref_x = img->opix_x - offset_x; ref_y = img->opix_y - offset_y; for (pos = 0; pos < max_pos; pos++) { if (ref_x == spiral_search_x[pos] && ref_y == spiral_search_y[pos]) { pos_00[list][ref] = pos; break; } } } //===== loop over search range (spiral search): get blockwise SAD ===== **// =====THIS IS THE PART WHERE NESTED FOR STARTS=====** for (pos = 0; pos < max_pos; pos++) // OUTERMOST FOR LOOP { abs_y = offset_y + spiral_search_y[pos]; abs_x = offset_x + spiral_search_x[pos]; if (range_partly_outside) { if (abs_y >= 0 && abs_y <= max_height && abs_x >= 0 && abs_x <= max_width ) { PelYline_11 = FastLine16Y_11; } else { PelYline_11 = UMVLine16Y_11; } } orgptr = orig_blocks; bindex = 0; for (blky = 0; blky < 4; blky++) // SECOND FOR LOOP { LineSadBlk0 = LineSadBlk1 = LineSadBlk2 = LineSadBlk3 = 0; for (y = 0; y < 4; y++) //INNERMOST FOR LOOP WHICH I WANT TO PARALLELIZE { refptr = PelYline_11 (ref_pic, abs_y++, abs_x, img_height, img_width); LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk0 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk1 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk2 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; LineSadBlk3 += byte_abs [*refptr++ - *orgptr++]; } block_sad[bindex++][pos] = LineSadBlk0; block_sad[bindex++][pos] = LineSadBlk1; block_sad[bindex++][pos] = LineSadBlk2; block_sad[bindex++][pos] = LineSadBlk3; } } //===== combine SAD's for larger block types ===== SetupLargerBlocks (list, ref, max_pos); //===== set flag marking that search setup have been done ===== search_setup_done[list][ref] = 1; } #endif // _FAST_FULL_ME_

    Read the article

  • code for searching from file using GUI

    - by maya
    hi everyone, I'm looking for a code that allows me to search from file , for example, in my program which is shoes shop's program . I should design and implement interfaces which have to search data from file TXT. the idea is that when I choose one item like type of shoes the program should display all other times such as color, size and price . Thanks in advance.

    Read the article

  • redirection code for cfm script

    - by tibin mathew
    Hi friends, I need a CFM script to place on my website homepage. If a visitor arrives from a search engine using a a certain search phrase, I want to redirect them to various pages. For example: The following searches would redirect to the following pages: become a business coach - http://www.businesscoach.com/BusinessCoaching.html find a business coach - http://www.businesscoach.com/go/bc/find-a-business-coach/index.cfm please help me to do this... Thanks

    Read the article

  • NDepend tool – Why every developer working with Visual Studio.NET must try it!

    - by hajan
    In the past two months, I have had a chance to test the capabilities and features of the amazing NDepend tool designed to help you make your .NET code better, more beautiful and achieve high code quality. In other words, this tool will definitely help you harmonize your code. I mean, you’ve probably heard about Chaos Theory. Experienced developers and architects are already advocates of the programming chaos that happens when working with complex project architecture, the matrix of relationships between objects which simply even if you are the one who have written all that code, you know how hard is to visualize everything what does the code do. When the application get more and more complex, you will start missing a lot of details in your code… NDepend will help you visualize all the details on a clever way that will help you make smart moves to make your code better. The NDepend tool supports many features, such as: Code Query Language – which will help you write custom rules and query your own code! Imagine, you want to find all your methods which have more than 100 lines of code :)! That’s something simple! However, I will dig much deeper in one of my next blogs which I’m going to dedicate to the NDepend’s CQL (Code Query Language) Architecture Visualization – You are an architect and want to visualize your application’s architecture? I’m thinking how many architects will be really surprised from their architectures since NDepend shows your whole architecture showing each piece of it. NDepend will show you how your code is structured. It shows the architecture in graphs, but if you have very complex architecture, you can see it in Dependency Matrix which is more suited to display large architecture Code Metrics – Using NDepend’s panel, you can see the code base according to Code Metrics. You can do some additional filtering, like selecting the top code elements ordered by their current code metric value. You can use the CQL language for this purpose too. Smart Search – NDepend has great searching ability, which is again based on the CQL (Code Query Language). However, you have some options to search using dropdown lists and text boxes and it will generate the appropriate CQL code on fly. Moreover, you can modify the CQL code if you want it to fit some more advanced searching tasks. Compare Builds and Code Difference – NDepend will also help you compare previous versions of your code with the current one at one of the most clever ways I’ve seen till now. Create Custom Rules – using CQL you can create custom rules and let NDepend warn you on each build if you break a rule Reporting – NDepend can automatically generate reports with detailed stats, graph representation, dependency matrixes and some additional advanced reporting features that will simply explain you everything related to your application’s code, architecture and what you’ve done. And that’s not all. As I’ve seen, there are many other features that NDepend supports. I will dig more in the upcoming days and will blog more about it. The team who built the NDepend have also created good documentation, which you can find on the NDepend website. On their website, you can also find some good videos that will help you get started quite fast. It’s easy to install and what is very important it is fully integrated with Visual Studio. To get you started, you can watch the following Getting Started Online Demo and Tutorial with explanations and screenshots. If you are interested to know more about how to use the features of this tool, either visit their website or wait for my next blogs where I will show some real examples of using the tool and how it helps make your code better. And the last thing for this blog, I would like to copy one sentence from the NDepend’s home page which says: ‘Hence the software design becomes concrete, code reviews are effective, large refactoring are easy and evolution is mastered.’ Website: www.ndepend.com Getting Started: http://www.ndepend.com/GettingStarted.aspx Features: http://www.ndepend.com/Features.aspx Download: http://www.ndepend.com/NDependDownload.aspx Hope you like it! Please do let me know your feedback by providing comments to my blog post. Kind Regards, Hajan

    Read the article

  • From AutoComplete textbox to database search and display?

    - by svebee
    Hello everyone, I have a small problem so I would be grateful if anyone could help me in any way. Thank you ;) I have this little "application", and I want when someone type in a AutoComplete textbox for example "New" it automatically displays "New York" as a option and that (AutoComplete function) works fine. But I want when user type in full location (or AutoComplete do it for him) - that text (location) input is forwarded to a database search which then searches through database and "collects" all rows with user-typed location. For example if user typed in "New York", database search would find all rows with "New York" in it. When it finds one/more row(s) it would display them below. In images... I have this when user is typing... http://www.imagesforme.com/show.php/1093305_SNAG0000.jpg I have this when user choose a AutoComplete location (h)ttp://www.imagesforme.com/show.php/1093306_SNAG0001.jpg (remove () on the beggining) But I wanna this when user choose a AutoComplete location (h)ttp://www.imagesforme.com/show.php/1093307_CopyofSNAG0001.jpg (remove () on the beggining) Complete Code package com.svebee.prijevoz; import android.app.Activity; import android.database.Cursor; import android.database.sqlite.SQLiteDatabase; import android.os.Bundle; import android.util.Log; import android.widget.ArrayAdapter; import android.widget.AutoCompleteTextView; import android.widget.TextView; public class ZelimDoci extends Activity { TextView lista; static final String[] STANICE = new String[] { "New York", "Chicago", "Dallas", "Los Angeles" }; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.zelimdoci); AutoCompleteTextView textView = (AutoCompleteTextView) findViewById(R.id.autocomplete_country); ArrayAdapter<String> adapter = new ArrayAdapter<String>(this, R.layout.list_item, STANICE); textView.setAdapter(adapter); lista = (TextView)findViewById(R.id.lista); SQLiteDatabase myDB= null; String TableName = "Database"; String Data=""; /* Create a Database. */ try { myDB = this.openOrCreateDatabase("Database", MODE_PRIVATE, null); /* Create a Table in the Database. */ myDB.execSQL("CREATE TABLE IF NOT EXISTS " + TableName + " (Field1 INT(3) UNIQUE, Field2 INT(3) UNIQUE, Field3 VARCHAR UNIQUE, Field4 VARCHAR UNIQUE);"); Cursor a = myDB.rawQuery("SELECT * FROM Database where Field1 == 1", null); a.moveToFirst(); if (a == null) { /* Insert data to a Table*/ myDB.execSQL("INSERT INTO " + TableName + " (Field1, Field2, Field3, Field4)" + " VALUES (1, 119, 'New York', 'Dallas');"); myDB.execSQL("INSERT INTO " + TableName + " (Field1, Field2, Field3, Field4)" + " VALUES (9, 587, 'California', 'New York');"); } myDB.execSQL("INSERT INTO " + TableName + " (Field1, Field2, Field3, Field4)" + " VALUES (87, 57, 'Canada', 'London');"); } /*retrieve data from database */ Cursor c = myDB.rawQuery("SELECT * FROM " + TableName , null); int Column1 = c.getColumnIndex("Field1"); int Column2 = c.getColumnIndex("Field2"); int Column3 = c.getColumnIndex("Field3"); int Column4 = c.getColumnIndex("Field4"); // Check if our result was valid. c.moveToFirst(); if (c != null) { // Loop through all Results do { String LocationA = c.getString(Column3); String LocationB = c.getString(Column4); int Id = c.getInt(Column1); int Linija = c.getInt(Column2); Data =Data +Id+" | "+Linija+" | "+LocationA+"-"+LocationB+"\n"; }while(c.moveToNext()); } lista.setText(String.valueOf(Data)); } catch(Exception e) { Log.e("Error", "Error", e); } finally { if (myDB != null) myDB.close(); } } } .xml file <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" > <TextView android:layout_width="fill_parent" android:layout_height="wrap_content" android:textSize="20sp" android:gravity="center_horizontal" android:padding="10sp" android:text="Test AutoComplete"/> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="horizontal" android:layout_width="fill_parent" android:layout_height="wrap_content" android:padding="5dp"> <TextView android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="AutoComplete" /> <AutoCompleteTextView android:id="@+id/autocomplete_country" android:layout_width="fill_parent" android:layout_height="wrap_content" android:layout_marginLeft="5dp"/> </LinearLayout> </LinearLayout>

    Read the article

  • Importing a txt file

    - by Tinkerbell
    How do I get this code to work? When I run the whole program I think it just exits because it never returns true. EDIT So, after moving the file and adding the printStacktrace(), I'm not getting any errors, although my program still won't run. So, I get these errors, what do they mean? java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) java.io.FileNotFoundException: BoggleWords.txt (The system cannot find the file specified) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(Unknown Source) at Boggle.isExceptedWord(Boggle.java:62) at Boggle.wordsThatCount(Boggle.java:49) at Boggle.getWordsFound(Boggle.java:40) at Boggle.getScore(Boggle.java:131) at DiceTrayTest.testGetWordsFoundAfterPrepareResultsCalledWithSetDiceTray(DiceTrayTest.java:101) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.BlockJUnit4ClassRunner.runNotIgnored(BlockJUnit4ClassRunner.java:79) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:71) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:49) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:193) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:52) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:191) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:42) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:184) at org.junit.runners.ParentRunner.run(ParentRunner.java:236) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:50) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197)

    Read the article

  • regex search a mysql text column

    - by Ian
    Okay, I thought my head hurt with regular regex, but I can't seem to find what I'm looking for with regexp in mysql. I'm trying to look for situations in news articles where a Textile-formatted url has not ended with a slash so: "Catherine Zeta-Jones":/cr/catherinezeta-jones/ visited stack overflow is ok but "Catherine Zeta-Jones":/cr/catherinezeta-jones visited stack overflow is not. [just used Catherine as an example because I'm assuming an alpha search wouldn't catch the hyphen] One of these days I'll have to do that goat sacrifice so I can gain the proper knowledge of regex. Thanks everyone!

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • jQuery :contains selector to search for multiple strings

    - by Stefan
    Assuming i have: <li id="1">Mary</li> <li id="2">John, Mary, Dave</li> <li id="3">John, Dave, Mary</li> <li id="4">John</li> If i need to find all <li> Elements which contain "John" and "Mary", how would i construct the jQuery? A search for a single string seems easy: $('li:contains("John")').text() I am looking for something like the following pseudo code: $('li:contains("John")' && 'li:contains("Mary")').text() Thanks!

    Read the article

  • NSDictionary: convert NSString keys to lowercase to search a string on them

    - by VansFannel
    Hello. I'm developing an iPhone application. I use a NSDictionary to store city's names as key, and population as value. I want to search the keys using lowercase. I've using this: NSDictionary *dict; [dict objectForKey:[[city stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceAndNewlineCharacterSet]] lowercaseString]]; But, it doesn't work. I know, I can do a for, convert keys to lowercase and compare with city. Is there any other way to do that? Maybe, with a NSDictionary method. UPDATE The NSDictionary is loaded from a property list. Thank you.

    Read the article

  • Android 2.2 AVD: no Quick Search Box?

    - by Felix
    I have recently updated my Android SDK to include support for Android 2.2 (API level 8). The app that I'm building integrates with the Quick Search Box (QSB) home screen widget, which I can't seem to find in this version (using both vanilla 2.2 and the Google APIs version). I was kind of excited when they announced that they have improved its functionality, but it seems there's no way for me to observe it. Is this normal? Are others experiencing the same issue? Or is this somehow related to my setup (running Archlinux and installed the Android SDK from the repositories).

    Read the article

< Previous Page | 307 308 309 310 311 312 313 314 315 316 317 318  | Next Page >