Search Results

Search found 35523 results on 1421 pages for 'nullable string'.

Page 312/1421 | < Previous Page | 308 309 310 311 312 313 314 315 316 317 318 319  | Next Page >

  • Perl latin-9? Unicode - need to add support

    - by Phill Pafford
    I have an application that is being expanded to the UK and I will need to add support for Latin-9 Unicode. I have done some Googling but found nothing solid as to what is involved in the process. Any tips? Here is some code (Just the bits for Unicode stuff) use Unicode::String qw(utf8 latin1 utf16); # How to call $encoded_txt = $self->unicode_encode($item->{value}); # Function part sub unicode_encode { shift() if ref($_[0]); my $toencode = shift(); return undef unless defined($toencode); Unicode::String->stringify_as("utf8"); my $unicode_str = Unicode::String->new(); # encode Perl UTF-8 string into latin1 Unicode::String # - currently only Basic Latin and Latin 1 Supplement # are supported here due to issues with Unicode::String . $unicode_str->latin1( $toencode ); ... Any help would be great and thanks.

    Read the article

  • Using Ruby on Rails, can a polymorphic database be created in a few steps (with polymorphic associat

    - by Jian Lin
    I thought it could be created in a few steps but it can't yet: rails poly cd poly ruby script/generate scaffold animal name:string obj_type:string obj_id:integer rake:migrate ruby script/generate scaffold human name:string passportNumber:string rake:migrate ruby script/generate scaffold dog name:string registrationNumber:string rake:migrate and now change app/models/animal.rb to: class Animal < ActiveRecord::Base belongs_to :obj, :polymorphic => true end and run ruby script/server and go to http://localhost:3000 I thought on the server then if I create an Michael, Human, J123456 and then Woofie, Dog, L23456 then the database will have entries in the Dogs table and "Humen" or "Humans" table as well as in the Animals table? But only the Animals table has records, Dogs and "Humen" do not for some reason. Is there some steps missing?

    Read the article

  • LINQ2SQL: how to merge two columns from the same table into a single list

    - by TomL
    this is probably a simple question, but I'm only a beginner so... Suppose I have a table containing home-work locations (cities) certain people use. Something like: ID(int), namePerson(string), homeLocation(string), workLocation(string) where homeLocation and workLocation can both be null. Now I want all the different locations that are used merged into a single list. Something like: var homeLocation = from hm in Places where hm.Home != null select hm.Home; var workLocation = from wk in Places where wk.Work != null select wk.Work; List<string> locationList = new List<string>(); locationList = homeLocation.Distinct().ToList<string>(); locationList.AddRange(workLocation.Distinct().ToList<string>()); (which I guess would still allow duplicates if they have the same value in both columns, which I don't really want...) My question: how this be put into a single LINQ statement? Thanks in advance for your help!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • C++ interface inheritance problem

    - by james t
    Hey, i'm trying to create a c++ stomp client, my client constructor is : Client(std::string &server, short port, std::string &login, std::string &pass, Listener &listener); it gets a listener object which when Listener is the following interface : class Listener { virtual void message(StmpMessage message) =0; }; now i attempt to instantiate a client in a test class : class test : public virtual Listener { public: void message(StmpMessage message) { message.prettyPrint(); } int main(int argc, char* argv[]) { Client client("127.0.0.1", 61613, *this); return 0; } }; i'm sending this to the client because this is a listener object, i get the following error : /Users/mzruya/Documents/STOMPCPP/main.cpp:18: error: no matching function for call to 'Client::Client(const char [10], int, test&)' /Users/mzruya/Documents/STOMPCPP/Client.h:43: note: candidates are: Client::Client(std::string&, short int, std::string&, std::string&, Listener&) /Users/mzruya/Documents/STOMPCPP/Client.h:37: note: Client::Client(const Client&)

    Read the article

  • Vba to Access record Insert Issue

    - by raam
    I want to insert Values to access table by using VBA control is there is any simple way to do this. i try this code but it does not work properly if i run this code it give the error 'variable not set' can anyone help me. thanks in advance Private Sub CommandButton1_Click() Dim cn As ADODB.Connection Dim strSql As String Dim lngKt As Long Dim dbConnectStr As String Dim Catalog As Object Dim cnt As ADODB.Connection Dim dbPath As String Dim myRecordset As New ADODB.Recordset Dim SQL As String, SQL2 As String dbPath = "table.accdb" dbConnectStr = "Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" & dbPath & ";" SQL = "INSERT INTO Jun_pre (ProductName,DESCRIPTION,SKU,MT,(mt),MRP,Remark,no_of_units_in_a_case) VALUES (""aa"",""bb"",""test"",""testUnit"",""1"",""2"",,""3"",,""4"");" With cnt .Open dbConnectStr 'some other string was there .Execute (SQL) .Close End With End Sub

    Read the article

  • How to dispose off custom object from within custom membership provider

    - by IrfanRaza
    I have created my custom MembershipProvider. I have used an instance of the class DBConnect within this provider to handle database functions. Please look at the code below: public class SGIMembershipProvider : MembershipProvider { #region "[ Property Variables ]" private int newPasswordLength = 8; private string connectionString; private string applicationName; private bool enablePasswordReset; private bool enablePasswordRetrieval; private bool requiresQuestionAndAnswer; private bool requiresUniqueEmail; private int maxInvalidPasswordAttempts; private int passwordAttemptWindow; private MembershipPasswordFormat passwordFormat; private int minRequiredNonAlphanumericCharacters; private int minRequiredPasswordLength; private string passwordStrengthRegularExpression; private MachineKeySection machineKey; **private DBConnect dbConn;** #endregion ....... public override bool ChangePassword(string username, string oldPassword, string newPassword) { if (!ValidateUser(username, oldPassword)) return false; ValidatePasswordEventArgs args = new ValidatePasswordEventArgs(username, newPassword, true); OnValidatingPassword(args); if (args.Cancel) { if (args.FailureInformation != null) { throw args.FailureInformation; } else { throw new Exception("Change password canceled due to new password validation failure."); } } SqlParameter[] p = new SqlParameter[3]; p[0] = new SqlParameter("@applicationName", applicationName); p[1] = new SqlParameter("@username", username); p[2] = new SqlParameter("@password", EncodePassword(newPassword)); bool retval = **dbConn.ExecuteSP("User_ChangePassword", p);** return retval; } //ChangePassword public override void Initialize(string name, NameValueCollection config) { if (config == null) { throw new ArgumentNullException("config"); } ...... ConnectionStringSettings ConnectionStringSettings = ConfigurationManager.ConnectionStrings[config["connectionStringName"]]; if ((ConnectionStringSettings == null) || (ConnectionStringSettings.ConnectionString.Trim() == String.Empty)) { throw new ProviderException("Connection string cannot be blank."); } connectionString = ConnectionStringSettings.ConnectionString; **dbConn = new DBConnect(connectionString); dbConn.ConnectToDB();** ...... } //Initialize ...... } // SGIMembershipProvider I have instantiated dbConn object within Initialize() event. My problem is that how could i dispose off this object when object of SGIMembershipProvider is disposed off. I know the GC will do this all for me, but I need to explicitly dispose off that object. Even I tried to override Finalize() but there is no such overridable method. I have also tried to create destructor for SGIMembershipProvider. Can anyone provide me solution.

    Read the article

  • Excel - referenced values via OleDB from .Net client

    - by ho
    I'm trying to read an Excel file (.xls, I think Excel 2003 compatible) via OleDB, but it fails to get the values for referenced fields. This is my current test code (please note, this is just part of the class): Private m_conn As OleDbConnection Public Sub New(ByVal fileName As String) Dim connString As String = String.Format("Provider=Microsoft.Jet.OLEDB.4.0;Data Source={0};Extended Properties=Excel 8.0;", fileName) m_conn = New OleDbConnection(connString) m_conn.Open() End Sub Public Sub GetSheet(ByVal sheet As String) Dim query As String = String.Format("SELECT * FROM [{0}]", sheet) Using cmd As OleDbCommand = m_conn.CreateCommand() cmd.CommandText = query Dim ds As New DataSet() Dim a As New OleDbDataAdapter(cmd) Using rdr As OleDbDataReader = cmd.ExecuteReader() While rdr.Read() Debug.WriteLine(rdr.Item(0).ToString()) End While End Using End Using End Sub But if the value is a reference (something like =+'MySheetName'!K37), I just get a DBNull from the call to rdr.Item(0). I can get around this by automating Excel instead, but would prefer not to have to use Excel automation so wondering if anyone knows how to do it.

    Read the article

  • Resharper code format linebreaks

    - by mizipzor
    Im trying to setup the code formatting in ReSharper. Limiting each line to a maximum count of characters, it seems to want to place casts on a separate line. Like so: string mystring = (string) MyStringConverter.convert(toconvert, typeof(string), null, null); I cant seem to be able to find the correct combination of settings to not have this on three lines. Im looking for something like this: string mystring = (string) MyStringConverter.convert( toconvert, typeof(string), null, null); Where the linebreak occurs is not that important, I guess I cant be to picky when I want to limit the line length. But three lines is a bit much. Does anyone know the/any correct combination of settings to make it only cut the line once?

    Read the article

  • Returning the index number of an Arraylist in Java

    - by Daniel
    I would like my method public void showClassRoomDetails(String teacherName) to return the Arraylist index number using the teacherName. Thanks import java.util.ArrayList; public class School { private ArrayList<Classroom> classrooms; private String classRoomName; private String teacherName; public School() { classrooms = new ArrayList<Classroom>(); } public void addClassRoom(Classroom newClassRoom, String theClassRoomName) { classrooms.add(newClassRoom); classRoomName = theClassRoomName; } public void addTeacherToClassRoom(int classroomId, String TeacherName) { if (classroomId < classrooms.size() ) { classrooms.get(classroomId).setTeacherName(TeacherName); } } public void showClassRoomDetails(String teacherName) { for (Classroom classroom : this.classrooms) { if (classroom.returnTeacherName().equals(teacherName)) { System.out.println(classroom.returnClassRoomName()); System.out.println(classroom.returnTeacherName()); break; } } } }

    Read the article

  • JAXB Marshalling supply name space for root element dynamically

    - by Venkat
    I have to pass the namespace for root element dynamically while marshalling using jaxb (JAXB 2.1.10 - JDK 6). i will be using the genrated xml to call different webservices which is qualified with different namespaces but same input xml. here is my sample jaxb annotated class .....guide me with your valuable inputs. @XmlAccessorType(XmlAccessType.FIELD) @XmlType(name = "", propOrder = { "taskName", "taskType" }) @XmlRootElement(name = "TaskRequest") public class TaskRequest { @XmlElement(name = "TaskName", required = true) protected String taskName; @XmlElement(name = "TaskType", required = true) protected String taskType; public String getTaskName() { return taskName; } public void setTaskName(String value) { this.taskName = value; } public String getTaskType() { return taskType; } public void setTaskType(String value) { this.taskType = value; } }

    Read the article

  • my jComboBox does not react to my keyListener and actionPerform perfroms weired stuff

    - by aladdin
    hi I am trying to search for UserName and return values onto jComboBox, here is the code public void actionPerformed(java.awt.event.ActionEvent e) { sr = new Search(((String) jComboBoxReceiver.getSelectedItem())); usrList = sr.searchUser(); String[] userList = new String[usrList.size()] ; for(int i=0;i<usrList.size();i++){ userList[i]= usrList.get(i).getUserName(); } model = new DefaultComboBoxModel(userList); jComboBoxReceiver.setModel(model); } However, if i do that, it does perform correctly, however, it will go search for the first item again, which is very confusing... then i tried using key Pressed if(e.getKeyCode()==13){ sr = new Search(((String) jComboBoxReceiver.getSelectedItem())); usrList = sr.searchUser(); String[] userList = new String[usrList.size()] ; for(int i=0;i<usrList.size();i++){ userList[i]= usrList.get(i).getUserName(); } model = new DefaultComboBoxModel(userList); jComboBoxReceiver.setModel(model); } And this one does not react at all ...

    Read the article

  • .NET XmlSerializer fails with List<T>

    - by Redshirt
    I'm using a singleton class to save all my settings info. It's first utilized by calling Settings.ValidateSettings(@"C:\MyApp"). The problem I'm having is that 'List Contacts' is causing the xmlserializer to fail to write the settings file, or to load said settings. If I comment out the List<T> then I have no problems saving/loading the xml file. What am I doing wrong? // The actual settings to save public class MyAppSettings { public bool FirstLoad { get; set; } public string VehicleFolderName { get; set; } public string ContactFolderName { get; set; } public List<ContactInfo> Contacts { get { if (contacts == null) contacts = new List<ContactInfo>(); return contacts; } set { contacts = value; } } private List<ContactInfo> contacts; } // The class in which the settings are manipulated public static class Settings { public static string SettingPath; private static MyAppSettings instance; public static MyAppSettings Instance { get { if (instance == null) instance = new MyAppSettings(); return instance; } set { instance = value; } } public static void InitializeSettings(string path) { SettingPath = Path.GetFullPath(path + "\\MyApp.xml"); if (File.Exists(SettingPath)) { LoadSettings(); } else { Instance.FirstLoad = true; Instance.VehicleFolderName = "Cars"; Instance.ContactFolderName = "Contacts"; SaveSettingsFile(); } } // load the settings from the xml file private static void LoadSettings() { XmlSerializer ser = new XmlSerializer(typeof(MyAppSettings)); TextReader reader = new StreamReader(SettingPath); Instance = (MyAppSettings)ser.Deserialize(reader); reader.Close(); } // Save the settings to the xml file public static void SaveSettingsFile() { XmlSerializer ser = new XmlSerializer(typeof(MyAppSettings)); TextWriter writer = new StreamWriter(SettingPath); ser.Serialize(writer, Settings.Instance); writer.Close(); } public static bool ValidateSettings(string initialFolder) { try { Settings.InitializeSettings(initialFolder); } catch (Exception e) { return false; } // Do some validation logic here return true; } } // A utility class to contain each contact detail public class ContactInfo { public string ContactID; public string Name; public string PhoneNumber; public string Details; public bool Active; public int SortOrder; }

    Read the article

  • Unix Sockets in Go

    - by marketer
    I'm trying to make a simple echo client and server that uses Unix sockets. In this example, the server can receive data from the client, but it can't send the data back. If I use tcp connections instead, it works great: Server package main import "net" import "fmt" func echoServer(c net.Conn) { for { buf := make([]byte, 512) nr, err := c.Read(buf) if err != nil { return } data := buf[0:nr] fmt.Printf("Received: %v", string(data)) _, err = c.Write(data) if err != nil { panic("Write: " + err.String()) } } } func main() { l, err := net.Listen("unix", "/tmp/echo.sock") if err != nil { println("listen error", err.String()) return } for { fd, err := l.Accept() if err != nil { println("accept error", err.String()) return } go echoServer(fd) } } Client package main import "net" import "time" func main() { c,err := net.Dial("unix","", "/tmp/echo.sock") if err != nil { panic(err.String()) } for { _,err := c.Write([]byte("hi\n")) if err != nil { println(err.String()) } time.Sleep(1e9) } }

    Read the article

  • why when I delete a parent on a one to many relationship on grails the beforeInsert event is called

    - by nico
    hello, I have a one to many relationship and when I try to delete a parent that haves more than one child the berforeInsert event gets called on the frst child. I have some code in this event that I mean to call before inserting a child, not when i'm deleting the parent! any ideas on what might be wrong? the entities: class MenuItem { static constraints = { name(blank:false,maxSize:200) category() subCategory(nullable:true, validator:{ val, obj -> if(val == null){ return true }else{ return obj.category.subCategories.contains(val)? true : ['invalid.category.no.subcategory'] } }) price(nullable:true) servedAtSantaMonica() servedAtWestHollywood() highLight() servedAllDay() dateCreated(display:false) lastUpdated(display:false) } static mapping = { extras lazy:false } static belongsTo = [category:MenuCategory,subCategory:MenuSubCategory] static hasMany = [extras:MenuItemExtra] static searchable = { extras component: true } String name BigDecimal price Boolean highLight = false Boolean servedAtSantaMonica = false Boolean servedAtWestHollywood = false Boolean servedAllDay = false Date dateCreated Date lastUpdated int displayPosition void moveUpDisplayPos(){ def oldDisplayPos = MenuItem.get(id).displayPosition if(oldDisplayPos == 0){ return }else{ def previousItem = MenuItem.findByCategoryAndDisplayPosition(category,oldDisplayPos - 1) previousItem.displayPosition += 1 this.displayPosition = oldDisplayPos - 1 this.save(flush:true) previousItem.save(flush:true) } } void moveDownDisplayPos(){ def oldDisplayPos = MenuItem.get(id).displayPosition if(oldDisplayPos == MenuItem.countByCategory(category) - 1){ return }else{ def nextItem = MenuItem.findByCategoryAndDisplayPosition(category,oldDisplayPos + 1) nextItem.displayPosition -= 1 this.displayPosition = oldDisplayPos + 1 this.save(flush:true) nextItem.save(flush:true) } } String toString(){ name } def beforeInsert = { displayPosition = MenuItem.countByCategory(category) } def afterDelete = { def otherItems = MenuItem.findAllByCategoryAndDisplayPositionGreaterThan(category,displayPosition) otherItems.each{ it.displayPosition -= 1 it.save() } } } class MenuItemExtra { static constraints = { extraOption(blank:false, maxSize:200) extraOptionPrice(nullable:true) } static searchable = true static belongsTo = [menuItem:MenuItem] BigDecimal extraOptionPrice String extraOption int displayPosition void moveUpDisplayPos(){ def oldDisplayPos = MenuItemExtra.get(id).displayPosition if(oldDisplayPos == 0){ return }else{ def previousExtra = MenuItemExtra.findByMenuItemAndDisplayPosition(menuItem,oldDisplayPos - 1) previousExtra.displayPosition += 1 this.displayPosition = oldDisplayPos - 1 this.save(flush:true) previousExtra.save(flush:true) } } void moveDownDisplayPos(){ def oldDisplayPos = MenuItemExtra.get(id).displayPosition if(oldDisplayPos == MenuItemExtra.countByMenuItem(menuItem) - 1){ return }else{ def nextExtra = MenuItemExtra.findByMenuItemAndDisplayPosition(menuItem,oldDisplayPos + 1) nextExtra.displayPosition -= 1 this.displayPosition = oldDisplayPos + 1 this.save(flush:true) nextExtra.save(flush:true) } } String toString(){ extraOption } def beforeInsert = { if(menuItem){ displayPosition = MenuItemExtra.countByMenuItem(menuItem) } } def afterDelete = { def otherExtras = MenuItemExtra.findAllByMenuItemAndDisplayPositionGreaterThan(menuItem,displayPosition) otherExtras.each{ it.displayPosition -= 1 it.save() } } }

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • How to write a jUnit test for this class?

    - by flash
    Hi, I would like to know what's the best approach to test the method "pushEvent()" in the following class with a jUnit test. My problem is, that the private method "callWebsite()" always requires a connection to the network. How can I avoid this requirement or refactor my class that I can test it without a connection to the network? class MyClass { public String pushEvent (Event event) { //do something here String url = constructURL (event); //construct the website url String response = callWebsite (url); return response; } private String callWebsite (String url) { try { URL requestURL = new URL (url); HttpURLConnection connection = null; connection = (HttpURLConnection) requestURL.openConnection (); String responseMessage = responseParser.getResponseMessage (connection); return responseMessage; } catch (MalformedURLException e) { e.printStackTrace (); return e.getMessage (); } catch (IOException e) { e.printStackTrace (); return e.getMessage (); } } }

    Read the article

  • Does CLOS have an eql specialization dispatch on strings?

    - by mhb
    Examples of what you can do. (defmethod some-fn ((num real)) (print "an integer")) (defmethod some-fn ((num real)) (print "a real")) (defmethod some-fn ((num (eql 0))) (print "zero")) (some-fn 19323923198319) "an integer" (some-fn 19323923198319.3) "a real" (some-fn 0) "zero" It also works with a general 'string type. (defmethod some-fn ((num string)) (print "a string")) (some-fn "asrt") "a string" Not with a specific string, however (defmethod some-fn ((num (eql "A")) (print "a specifict string"))) => doesn't compile I imagine it doesn't work because eql does not work on strings in the way that would be necessary for it to work. (eql "a" "a") => nil Is there a way to do it?

    Read the article

  • Sessions not persisting between requests

    - by klonq
    My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

    Read the article

  • ServeletException, Property <variable name> not found

    - by k9yosh
    What i'm trying to do is add a new variable to this previously created Managed Bean Hello.java and use it in my xhtml file binding to a text field. But it seems that it is not being found when i run it on the server. So it throws a "ServeletException" and says that the "property 'lname'(my variable) is not found". How do i solve this and why is this happening? This is my managed bean, package stack.tute.malinda.model; import javax.faces.bean.ManagedBean; import javax.faces.bean.RequestScoped; @ManagedBean @RequestScoped public class Hello { private String fname; private String message; private String lname; //trying to add this new variable and use it in my xhtml file in a text field. public String getLname() { return lname; } public void setLname(String lname) { this.lname = lname; } public String getName() { return fname; } public String createMessage() { message="Hello " + fname + ""+ lname +"!"; return null; } public void setName(String fname) { this.fname=fname; } public String getMessage() { return message; } } This is my xhtml code, <h:body> <fieldset style="padding: 1em; float:left; margin-right:0.5em; padding-top:0.2em; text-align:left; border:1px solid green; font-weight:bold;"> <legend>Personal Details</legend> <h:form> <h:outputLabel for="name" value="First Name :" required="true"/> <h:inputText id="name" value="#{hello.name}"/> <br/> //Trying to access that variable here. <h:outputLabel for="name1" value="Last Name :" required="true"/> <h:inputText id="name1" value="#{hello.lname}"/> <h:message for="name"/> <br/> <h:commandButton value="Say hello" action="#{hello.createMessage}"> <f:ajax execute="@form" render="@form"/> </h:commandButton> <br/> <h:outputText value="#{hello.message}"/> </h:form> </fieldset>

    Read the article

  • Java programming accessing object variables

    - by Haxed
    Helo, there are 3 files, CustomerClient.java, CustomerServer.java and Customer.java PROBLEM: In the CustomerServer.java file, i get an error when I compile the CustomerServer.java at line : System.out.println(a[k].getName()); ERROR: init: deps-jar: Compiling 1 source file to C:\Documents and Settings\TLNA\My Documents\NetBeansProjects\Server\build\classes C:\Documents and Settings\TLNA\My Documents\NetBeansProjects\Server\src\CustomerServer.java:44: cannot find symbol symbol : method getName() location: class Customer System.out.println(a[k].getName()); 1 error BUILD FAILED (total time: 0 seconds) CustomerClient.java import java.io.*; import java.net.*; import java.awt.*; import java.awt.event.*; import javax.swing.*; import javax.swing.border.*; public class CustomerClient extends JApplet { private JTextField jtfName = new JTextField(32); private JTextField jtfSeatNo = new JTextField(32); // Button for sending a student to the server private JButton jbtRegister = new JButton("Register to the Server"); // Indicate if it runs as application private boolean isStandAlone = false; // Host name or ip String host = "localhost"; public void init() { JPanel p1 = new JPanel(); p1.setLayout(new GridLayout(2, 1)); p1.add(new JLabel("Name")); p1.add(jtfName); p1.add(new JLabel("Seat No.")); p1.add(jtfSeatNo); add(p1, BorderLayout.CENTER); add(jbtRegister, BorderLayout.SOUTH); // Register listener jbtRegister.addActionListener(new ButtonListener()); // Find the IP address of the Web server if (!isStandAlone) { host = getCodeBase().getHost(); } } /** Handle button action */ private class ButtonListener implements ActionListener { public void actionPerformed(ActionEvent e) { try { // Establish connection with the server Socket socket = new Socket(host, 8000); // Create an output stream to the server ObjectOutputStream toServer = new ObjectOutputStream(socket.getOutputStream()); // Get text field String name = jtfName.getText().trim(); String seatNo = jtfSeatNo.getText().trim(); // Create a Student object and send to the server Customer s = new Customer(name, seatNo); toServer.writeObject(s); } catch (IOException ex) { System.err.println(ex); } } } /** Run the applet as an application */ public static void main(String[] args) { // Create a frame JFrame frame = new JFrame("Register Student Client"); // Create an instance of the applet CustomerClient applet = new CustomerClient(); applet.isStandAlone = true; // Get host if (args.length == 1) { applet.host = args[0]; // Add the applet instance to the frame } frame.add(applet, BorderLayout.CENTER); // Invoke init() and start() applet.init(); applet.start(); // Display the frame frame.pack(); frame.setVisible(true); } } CustomerServer.java import java.io.*; import java.net.*; public class CustomerServer { private String name; private int i; private ObjectOutputStream outputToFile; private ObjectInputStream inputFromClient; public static void main(String[] args) { new CustomerServer(); } public CustomerServer() { Customer[] a = new Customer[30]; try { // Create a server socket ServerSocket serverSocket = new ServerSocket(8000); System.out.println("Server started "); // Create an object ouput stream outputToFile = new ObjectOutputStream( new FileOutputStream("student.dat", true)); while (true) { // Listen for a new connection request Socket socket = serverSocket.accept(); // Create an input stream from the socket inputFromClient = new ObjectInputStream(socket.getInputStream()); // Read from input //Object object = inputFromClient.readObject(); for (int k = 0; k <= 2; k++) { if (a[k] == null) { a[k] = (Customer) inputFromClient.readObject(); // Write to the file outputToFile.writeObject(a[k]); //System.out.println("A new student object is stored"); System.out.println(a[k].getName()); break; } if (k == 2) { //fully booked outputToFile.writeObject("All seats are booked"); break; } } } } catch (ClassNotFoundException ex) { ex.printStackTrace(); } catch (IOException ex) { ex.printStackTrace(); } finally { try { inputFromClient.close(); outputToFile.close(); } catch (Exception ex) { ex.printStackTrace(); } } } } Customer.java public class Customer implements java.io.Serializable { private String name; private String seatno; public Customer(String name, String seatno) { this.name = name; this.seatno = seatno; } public String getName() { return name; } public String getSeatNo() { return seatno; } }

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • How do I tie a cmbBox that selects all drives (local and network) into a treeNode VB

    - by jpavlov
    How do i tie in a selected item from a cmbBox with a treeView? I am looking to just obtain the value of the one selected drive Thanks. Imports System Imports System.IO Imports System.IO.File Imports System.Windows.Forms Public Class F_Treeview_Demo Private Sub F_Treeview_Demo_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load ' Initialize the local directory treeview Dim nodeText As String = "" Dim sb As New C_StringBuilder With My.Computer.FileSystem 'Read in the number of drives For i As Integer = 0 To .Drives.Count - 1 '** Build the drive's node text sb.ClearText() sb.AppendText(.Drives(i).Name) cmbDrives.Items.Add(sb.FullText) Next End With ListRootNodes() End Sub Private Sub btnExit_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnExit.Click Application.Exit() End Sub Private Sub tvwLocalFolders_AfterSelect(ByVal sender As Object, ByVal e As System.Windows.Forms.TreeViewEventArgs) _ Handles tvwLocalFolders.AfterSelect ' Display the path for the selected node Dim folder As String = tvwLocalFolders.SelectedNode.Tag lblLocalPath.Text = folder ListView1.Items.Clear() Dim childNode As TreeNode = e.Node.FirstNode Dim parentPath As String = AddChar(e.Node.Tag) End Sub Private Sub AddToList(ByVal nodes As TreeNodeCollection) For Each node As TreeNode In nodes If node.Checked Then ListView1.Items.Add(node.Text) ListView1.Items.Add(Chr(13)) AddToList(node.Nodes) End If Next End Sub Private Sub tvwLocalFolders_BeforeExpand(ByVal sender As Object, ByVal e As System.Windows.Forms.TreeViewCancelEventArgs) _ Handles tvwLocalFolders.BeforeExpand ' Display the path for the selected node lblLocalPath.Text = e.Node.Tag ' Populate all child nodes below the selected node Dim parentPath As String = AddChar(e.Node.Tag) tvwLocalFolders.BeginUpdate() Dim childNode As TreeNode = e.Node.FirstNode 'this i added Dim smallNode As TreeNode = e.Node.FirstNode Do While childNode IsNot Nothing ListLocalSubFolders(childNode, parentPath & childNode.Text) childNode = childNode.NextNode ''this i added ListLocalFiles(smallNode, parentPath & smallNode.Text) Loop tvwLocalFolders.EndUpdate() tvwLocalFolders.Refresh() ' Select the node being expanded tvwLocalFolders.SelectedNode = e.Node ListView1.Items.Clear() AddToList(tvwLocalFolders.Nodes) ListView1.Items.Add(Environment.NewLine) End Sub Private Sub ListRootNodes() ' Add all local drives to the Local treeview Dim nodeText As String = "" Dim sb As New C_StringBuilder With My.Computer.FileSystem For i As Integer = 0 To .Drives.Count - 1 '** Build the drive's node text sb.ClearText() sb.AppendText(.Drives(i).Name) nodeText = sb.FullText nodeText = Me.cmbDrives.SelectedItem '** Add the drive to the treeview Dim driveNode As TreeNode driveNode = tvwLocalFolders.Nodes.Add(nodeText) 'driveNode.Tag = .Drives(i).Name '** Add the next level of subfolders 'ListLocalSubFolders(driveNode, .Drives(i).Name) ListLocalSubFolders(driveNode, nodeText) 'driveNode = Nothing Next End With End Sub Private Sub ListLocalFiles(ByVal ParentNode As TreeNode, ByVal PParentPath As String) Dim FileNode As String = "" Try For Each FileNode In Directory.GetFiles(PParentPath) Dim smallNode As TreeNode smallNode = ParentNode.Nodes.Add(FilenameFromPath(FileNode)) With smallNode .ImageIndex = 0 .SelectedImageIndex = 1 .Tag = FileNode End With smallNode = Nothing Next Catch ex As Exception End Try End Sub Private Sub ListLocalSubFolders(ByVal ParentNode As TreeNode, _ ByVal ParentPath As String) ' Add all local subfolders below the passed Local treeview node Dim FolderNode As String = "" Try For Each FolderNode In Directory.GetDirectories(ParentPath) Dim childNode As TreeNode childNode = ParentNode.Nodes.Add(FilenameFromPath(FolderNode)) With childNode .ImageIndex = 0 .SelectedImageIndex = 1 .Tag = FolderNode End With childNode = Nothing Next Catch ex As Exception End Try End Sub Private Sub ComboBox1_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles cmbDrives.SelectedIndexChanged End Sub Private Sub lblLocalPath_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles lblLocalPath.Click End Sub Private Sub grpLocalFileSystem_Enter(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles grpLocalFileSystem.Enter End Sub Private Sub btn1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btn1.Click ' lbl1.Text = End Sub Private Sub ListView1_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles ListView1.SelectedIndexChanged End Sub End Class

    Read the article

  • how to copy database files from the network access server to Client PC in c#.net?

    - by zoya
    im using a code to copy the files from the database of server PC. so im accessing that server PC through IP address but it is giving me error and not copying the files in the folder of my PC (client PC) this is my code that im using...can u tell me where im wrong?? the file path is given on my listview in winform.. public string RecordingFileCopy(string recordpath,string ipadd) { string strFinalPath; strFinalPath = String.Format("\\{0}'{1}'",ipadd,recordpath); return strFinalPath; } on button click event.... { try { foreach (ListViewItem item in listView1.Items) { string sourceFile = item.SubItems[5].Text; RecordingFileCopy(sourceFile,"10.0.4.123"); File.Copy(sourceFile, Path.Combine(@"E:\name\MyDir", Path.GetFileName(sourceFile))); } } catch { MessageBox.Show("Files are not copied to folder", _strMsg, MessageBoxButtons.OK, MessageBoxIcon.Error); } }

    Read the article

  • Drag N Drop utilizing simple cursor

    - by Cameron
    I'm using CommonsGuy's drag n drop example and I am basically trying to integrate it with the Android notepad example. Drag N Drop Out of the 2 different drag n drop examples i've seen they have all used a static string array where as i'm getting a list from a database and using simple cursor adapter. So my question is how to get the results from simple cursor adapter into a string array, but still have it return the row id when the list item is clicked so I can pass it to the new activity that edits the note. Here is my code: Cursor notesCursor = mDbHelper.fetchAllNotes(); startManagingCursor(notesCursor); // Create an array to specify the fields we want to display in the list (only NAME) String[] from = new String[]{WeightsDatabase.KEY_NAME}; // and an array of the fields we want to bind those fields to (in this case just text1) int[] to = new int[]{R.id.weightrows}; // Now create a simple cursor adapter and set it to display SimpleCursorAdapter notes = new SimpleCursorAdapter(this, R.layout.weights_row, notesCursor, from, to); setListAdapter(notes); And here is the code i'm trying to work that into. public class TouchListViewDemo extends ListActivity { private static String[] items={"lorem", "ipsum", "dolor", "sit", "amet", "consectetuer", "adipiscing", "elit", "morbi", "vel", "ligula", "vitae", "arcu", "aliquet", "mollis", "etiam", "vel", "erat", "placerat", "ante", "porttitor", "sodales", "pellentesque", "augue", "purus"}; private IconicAdapter adapter=null; private ArrayList<String> array=new ArrayList<String>(Arrays.asList(items)); @Override public void onCreate(Bundle icicle) { super.onCreate(icicle); setContentView(R.layout.main); adapter=new IconicAdapter(); setListAdapter(adapter); TouchListView tlv=(TouchListView)getListView(); tlv.setDropListener(onDrop); tlv.setRemoveListener(onRemove); } private TouchListView.DropListener onDrop=new TouchListView.DropListener() { @Override public void drop(int from, int to) { String item=adapter.getItem(from); adapter.remove(item); adapter.insert(item, to); } }; private TouchListView.RemoveListener onRemove=new TouchListView.RemoveListener() { @Override public void remove(int which) { adapter.remove(adapter.getItem(which)); } }; class IconicAdapter extends ArrayAdapter<String> { IconicAdapter() { super(TouchListViewDemo.this, R.layout.row2, array); } public View getView(int position, View convertView, ViewGroup parent) { View row=convertView; if (row==null) { LayoutInflater inflater=getLayoutInflater(); row=inflater.inflate(R.layout.row2, parent, false); } TextView label=(TextView)row.findViewById(R.id.label); label.setText(array.get(position)); return(row); } } } I know i'm asking for a lot, but a point in the right direction would help quite a bit! Thanks

    Read the article

< Previous Page | 308 309 310 311 312 313 314 315 316 317 318 319  | Next Page >