Search Results

Search found 19495 results on 780 pages for 'xml parse'.

Page 315/780 | < Previous Page | 311 312 313 314 315 316 317 318 319 320 321 322  | Next Page >

  • Why is this variable declared as private and also readonly?

    - by Sergio Tapia
    In the following code: public class MovieRepository : IMovieRepository { private readonly IHtmlDownloader _downloader; public MovieRepository(IHtmlDownloader downloader) { _downloader = downloader; } public Movie FindMovieById(string id) { var idUri = ...build URI...; var html = _downloader.DownloadHtml(idUri); return ...parse ID HTML...; } public Movie FindMovieByTitle(string title) { var titleUri = ...build URI...; var html = _downloader.DownloadHtml(titleUri); return ...parse title HTML...; } } I asked for something to review my code, and someone suggested this approach. My question is why is the IHtmlDownloader variable readonly?

    Read the article

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • Read binary data from a MDB-file running under LAMP

    - by BusterX
    I need to be able to connect to an MDB-file in a LAMP-environment (running on Linux) and ultimately insert converted data into a Mysql db. The data I need to access is stored as a BLOB (Long Binary Data according to Access) in the MDB file. I have not yet been able to actually have a look at the data but I have been told that the BLOB consists of byte strings. Something along the lines of: 0x1c 0x10 0x27 0x00 0x00 I need to parse the byte strings and convert these to a format that is human readable. I do have access to the documentation that explains the various byte strings. So this is really two questions: How do a get access to the MDB file via PHP* (running under LAMP) and read the BLOB (I do not have access to a Windows-platform)? What would be the best way to parse the binary data (in PHP*) once I am able to connect to the MDB-file? *Or are there other methods/languages that are more appropriate?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • GQL, Aggregation and Order By

    - by Koran
    Hi, How can GQL support ORDER BY when it does not support aggregation? The question is - if say the result of the query is more than 1000, does ORDER BY return fully ordered list or only the first 1000 items which is then ordered? To explain the question more: is conceptually MIN() same as query.orderby('asc').fetch(1)? If it is properly ordering the list, then how can it not provide COUNT(), since to properly order the list, GQL possibly has to parse through the whole list - in which case, COUNT() is not an issue at all? Or is item indexed and kept in some type of tree so that it does not need to parse it all the time?

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • RegEx (or other) parsing of script

    - by jpmyob
    RegEx is powerful - it is tru but I have a little - query for you I want to parse out the FUNCTIONS from some old code in JS...however - I am RegEx handicapped (mentally deficient in grasping the subtleties).. the issue that makes me NOT EVEN TRY - is two fold - 1) myVar = function(x){ yadda yadda } AND function myVar(x) { yadda yadda } are found throuout - COLD I write a parser for each? sure - but that seems inefficient... 2) MANY things may reside INSIDE the {} including OTHER sets of {} or other Functions(){} block of text... HELP - does anyone have, or know of some code parsing snippets or examples that will parse out the info I want to collect? Thanks

    Read the article

  • Java simple data format british time

    - by DD
    Hi, I am using simple date format to allow users to specify which time zone they are sending data in: DateFormat df = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss,z"); This works fine: e.g. df.parse("2009-05-16 11:07:41,GMT"); However, if someone is always sending time in London time (i.e. taking into account daylight savings), what would be the approriate time zone String to add? e.g. this doesnt work: df.parse("2009-05-16 11:07:41,Europe/London"); Thanks.

    Read the article

  • In BASH how can i find my system on active internet interface, what is the upload speed?

    - by YumYumYum
    I am trying to write an TUI bandwidth trace application which on query can instantly tell me, that my download and upload speed is XXXX. I have figured out that download i can use with wget and parse it using BASH, but how do i get the upload speed? Example of download parse method: 1) Remote download : wget http://x.x.com:7007/files/software/vnc.zip Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 573K/s in 2.7s 2012-03-24 11:35:22 (573 KB/s) - `vnc.zip' saved [1594344/1594344] 2) Local download tells Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 --.-K/s in 0.1s 2012-03-24 06:43:04 (11.4 MB/s) - `vnc.zip' saved [1594344/1594344]

    Read the article

  • Backbone.js - Getting JSON back from url

    - by Brian
    While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

    Read the article

  • insert a date in mysql database

    - by kawtousse
    I use a jquery datepicker then i read it in my servlet like that: String dateimput=request.getParameter("datepicker");//1 then parse it like that: System.out.println("datepicker:" +dateimput); DateFormat df = new SimpleDateFormat("MM/dd/yyyy"); java.util.Date dt = null; try { dt = df.parse(dateimput); System.out.println("date imput parssé1 est:" +dt); System.out.println("date imput parsée2 est:" +df.format(dt)); } catch (ParseException e) { e.printStackTrace(); } and insert query like that: String query = "Insert into dailytimesheet(trackingDate,activity,projectCode) values ("+df.format(dt)+", \""+activity+"\" ,\""+projet+"\")"; it pass successfully untill now but if i check the record inserted i found the date: 01/01/0001 00:00:00 l've tried to fix it but it still a mess for me.

    Read the article

  • What is the right method for parsing a blog post?

    - by Zedwal
    Hi guys, Need a guide line .... I am trying to write a personal blog. What is the standard structure for for input for the post. I am trying the format like: This is the simple text And I am [b] bold text[/b]. This is the code part: [code lang=java] public static void main (String args[]) { System.out.println("Hello World!"); } [/code] Is this the right way to store post in the database? And What is the right method to parse this kind of post? Shall I use regular expression to parse this or there is another standard for this. If the above mentioned format is not the right way for storage, then what it could be? Thanks

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • How do you convert date taken from a bash script to milliseconds in java program?

    - by Matt Pascoe
    I am writing a piece of code in java that needs to take a time sent from a bash script and parse the time to milliseconds. When I check the millisecond conversion on the date everything is correct except for the month I have sent which is January instead of March. Here is the variable I create in the bash script, which later in the script I pass to the java program: TIME=`date +%m%d%Y_%H:%M:%S` Here is the java code which parses the time to milliseconds: String dt = "${scriptstart}"; java.text.SimpleDateFormat scriptStart = new java.text.SimpleDateFormat("MMDDyyyy_HH:mm:ss"); long start = scriptStart.parse(dt).getTime(); The goal of this statement is to find the elapsed time between the start of the script and the current system time. To troubleshoot this I printed out the two: System Time = 1269898069496 (converted = Mon Mar 29 2010 16:27:49 GMT-0500 (Central Daylight Time)) Script Start = 03292010_16:27:45 Script Start in Milli = 1264804065000 (Converted = Fri Jan 29 2010 16:27:45 GMT-0600 (Central Standard Time))

    Read the article

  • Repeating a object that only occurs couple of times and has different values with htmlagilitypack c#.

    - by dtd
    I have a problem I cant seem to solve here. Lets say I have some html like beneth here that I want to parse. All this html is within one list on the page. And the names repeat themself like in the example I wrote. <li class = "seperator"> a date </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> <li class = "seperator"> a new date </li> <li class = "lol"> some text </li> <li class = "seperator"> a nother new date </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> I did manage to use htmlagility pack to parse every li object seperate, and almost formating it how I want. My print atm looks something like this: "a date" "some text" "some text" "some text" "some text" "a new date" "some text" "a nother new date " "some text" "some text" "some text" What I want to achive: "a date" "some text" "a date" "some text" "a date" "some text" "a date" "some text" "a new date" "some text" "a nother new date " "some text" "a nother new date " "some text" "a nother new date " "some text" But the problem is that beneath every seperator, the count of every lol object may vary. So one day, the webpage may have one lol object beneth date 1, and the next day it may have 10 lol objects. So I am woundering if there is an smart/easy way to somehow count the number of lol objects in between the seperators. Or if there is another way to figure this out? Within for example htmlagilitypack. And yes, I need the correct date in front of every lol object, not just infront the first one. This would have been a pice of cake if the seperator class would have ended beneath the last lol object, but sadly that is not the case... I dont think that I need to paste my code here, but basicly what I do is to parse the page, extract the seperators and lol objects and add them to a list, where I split them up to seperator and lol objects. Then I print it out to a file and since the seperator only occure 3 times(in the example) I will only get out 3 seperate dates.

    Read the article

  • Translate parse_git_branch function to zsh from bash (for prompt)

    - by yar
    I am using this function in Bash function parse_git_branch { git_status="$(git status 2> /dev/null)" pattern="^# On branch ([^${IFS}]*)" if [[ ! ${git_status}} =~ "working directory clean" ]]; then state="*" fi # add an else if or two here if you want to get more specific if [[ ${git_status} =~ ${pattern} ]]; then branch=${BASH_REMATCH[1]} echo "(${branch}${state})" fi } but I'm determined to use zsh. While I can use this perfectly as a shell script (even without a shebang) in my .zshrc the error is a parse error on this line if [[ ! ${git_status}}... What do I need to do to get it ready for zshell? Edit: The "actual error" I'm getting is " parse error near } and it refers to the line with the strange double }}, which works on Bash. Edit: Here's the final code, just for fun: parse_git_branch() { git_status="$(git status 2> /dev/null)" pattern="^# On branch ([^[:space:]]*)" if [[ ! ${git_status} =~ "working directory clean" ]]; then state="*" fi if [[ ${git_status} =~ ${pattern} ]]; then branch=${match[1]} echo "(${branch}${state})" fi } setopt PROMPT_SUBST PROMPT='$PR_GREEN%n@$PR_GREEN%m%u$PR_NO_COLOR:$PR_BLUE%2c$PR_NO_COLOR%(!.#.$)' RPROMPT='$PR_GREEN$(parse_git_branch)$PR_NO_COLOR' Thanks to everybody for your patience and help. Edit: The best answer has schooled us all: git status is porcelain (UI). Good scripting goes against GIT plumbing. Here's the final function: parse_git_branch() { in_wd="$(git rev-parse --is-inside-work-tree 2>/dev/null)" || return test "$in_wd" = true || return state='' git diff-index HEAD --quiet 2>/dev/null || state='*' branch="$(git symbolic-ref HEAD 2>/dev/null)" test -z "$branch" && branch='<detached-HEAD>' echo "(${branch#refs/heads/}${state})" } PROMPT='$PR_GREEN%n@$PR_GREEN%m%u$PR_NO_COLOR:$PR_BLUE%2c$PR_NO_COLOR%(!.#.$)' RPROMPT='$PR_GREEN$(parse_git_branch)$PR_NO_COLOR' Note that only the prompt is zsh-specific. In Bash it would be your prompt plus "\$(parse_git_branch)". This might be slower (more calls to GIT, but that's an empirical question) but it won't be broken by changes in GIT (they don't change the plumbing). And that is very important for a good script moving forward. Days Later: Ugh, it turns out that diff-index HEAD is NOT the same as checking status against working directory clean. So will this mean another plumbing call? I surely don't have time/expertise to write my own porcelain....

    Read the article

  • Convert UTC date to actual date and time

    - by evann
    I have a chart of bitcoin prices. I have the correct prices on the Y-axis, but I cannot get the correct time on the X-axis. The time shows up in a UTC format in my console. I am adding price and date to the series each iteration. I need to get the date of that particular result and find the YEAR, MONTH and DAY of that so I can put it in the right format. Any help is appreciated thanks. $.ajax({ url: "/chart/ajax_get_chart", // the URL of the controller action method dataType: "json", type: "GET", success: function (result) { var result = JSON.parse(result); series = []; for (var i = 0; i < result.length; i++) { tempArray = [parseFloat(result[i]['price'])]; tempDate = Date.parse(result[i]['date']); series.push(tempDate); series.push(tempArray); }

    Read the article

  • Selectively parsing log files using Java

    - by GPX
    I have to parse a big bunch of log files, which are in the following format. SOME SQL STATEMENT/QUERY DB20000I The SQL command completed successfully. SOME OTHER SQL STATEMENT/QUERY DB21034E The command was processed as an SQL statement because it was not a valid Command Line Processor command. EDIT 1: The first 3 lines (including a blank line) indicate an SQL statement executed successfully, while the next three show the statement and the exception it caused. darioo's reply below, suggesting the use of grep instead of Java, works beautifully for a single line SQL statement. EDIT 2: However, the SQL statement/query might not be a single line, necessarily. Sometimes it is a big CREATE PROCEDURE...END PROCEDURE block. Can this problem be overcome using only Unix commands too? Now I need to parse through the entire log file and pick all occurrences of the pair of (SQL statement + error) and write them in a separate file. Please show me how to do this!

    Read the article

  • Ruby function similar to parse_str in php?

    - by jolierouge
    Hi, I need to parse a string like this: a[metadata][][name]=dont|do|this&a[name]=Hello World&a[metadata][][value]=i|really|mean it CGI::parse gives me this: {"a[name]"=["Hello World"], "a[metadata][][name]"=["dont|do|this"], "a[metadata][][value]"=["i|really|mean it"]} I would like something like what PHP does with parse_str, which when given the same string does this: Array ( [a] => Array ( [metadata] => Array ( [0] => Array ( [name] => dont|do|this ) [1] => Array ( [value] => i|really|mean it ) ) [name] => Hello World )) Any help would be awesome. Thanks!

    Read the article

  • How can chunks be allocated in a node.js stream in object mode all at once?

    - by Quentin Engles
    I can see how buffers, and strings can be sent as chunks, but I'm having a problem thinking about how streams can be dealt when working in object mode. Say I have a byte stream from an http request message. I want to take that message, parse, and then transform it into one big object. I already know how to parse the message. What I'm wondering is if the message is big so it has many chunks, but I want to make one object for the output how can I make sure the data event waits for the whole thing? Is this just a matter of not using the push method until the chunked data has finished being sent? That would then restrict the stream data output to a smaller object which I think I'm fine with for now. As an added condition the larger data will be reduced in size after the the transform.

    Read the article

  • Socket receive buffer size

    - by Kanishka
    Is there a way to determine the receive buffer size of a TCPIP socket in c#. I am sending a message to a server and expecting a response where I am not sure of the receive buffer size. IPEndPoint ipep = new IPEndPoint(IPAddress.Parse("192.125.125.226"),20060); Socket server = new Socket(AddressFamily.InterNetwork, SocketType.Stream, ProtocolType.Tcp); server.Connect(ipep); String OutStr= "49|50|48|48|224|48|129|1|0|0|128|0|0|0|0|0|4|0|0|32|49|50"; byte[] temp = OutStr.Split('|').Select(s => byte.Parse(s)).ToArray(); int byteCount = server.Send(temp); byte[] bytes = new byte[255]; int res=0; res = server.Receive(bytes); return Encoding.UTF8.GetString(bytes);

    Read the article

  • Creating objects makes the VM faster?

    - by Sudhir Jonathan
    Look at this piece of code: MessageParser parser = new MessageParser(); for (int i = 0; i < 10000; i++) { parser.parse(plainMessage, user); } For some reason, it runs SLOWER (by about 100ms) than for (int i = 0; i < 10000; i++) { MessageParser parser = new MessageParser(); parser.parse(plainMessage, user); } Any ideas why? The tests were repeated a lot of times, so it wasn't just random. How could creating an object 10000 times be faster than creating it once?

    Read the article

< Previous Page | 311 312 313 314 315 316 317 318 319 320 321 322  | Next Page >