Search Results

Search found 29111 results on 1165 pages for 'program structure'.

Page 316/1165 | < Previous Page | 312 313 314 315 316 317 318 319 320 321 322 323  | Next Page >

  • Matlab Error: Too many output arguments

    - by lebland_Matlab
    I use the following function in a Matlab program: ... ... ... [A, B, C, D, E] = function (F, G, H, I, J, K, L, M, N, O, P) ... ... ... and I get the following error message: ??? Error using == function Too many output arguments. A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P are the vectors of inputs and outputs of the function. but the same program works very well when I replaced the line of the function by its full script! Can you tell me where I should look to find the error..

    Read the article

  • How do I convert decimal numbers to binary in Perl?

    - by David
    I am trying to make a program that converts decimal numbers or text into binary numbers in perl. The program asks for user input of a character or string , and then prints out the result to the console. How do I do this? My code I have been working on is below, but i cannot seem to fix it. print "Enter a number to convert: "; chomp($decimal = <STDIN>); print "\nConverting $number to binary...\n"; $remainder = $decimal%2; while($decimal > 0) { $decimal/2; print $remainder; }

    Read the article

  • Where is PostSharp.Public 1.5 DLL ?

    - by jfneis
    Fellows, I'm going crazy with looks like a really stupid problem. I'm trying to build a simple example using PostSharp as a log AOP utility. I've not installed PostSharp, and I don't want to, I want to reference the necessaries DLLs, change my .csproj and see everything working. Change the project and add references was kind of easy, byt just after adding the LogAttribute to a method I got two errors: Error 1 'Log4PostSharp.LogAttribute' is not an attribute class C:\Dev\LogWithPostsharp\LogWithPostsharpCmd\Program.cs 17 10 LogWithPostsharpCmd Error 2 The type 'PostSharp.Extensibility.MulticastAttribute' is defined in an assembly that is not referenced. You must add a reference to assembly 'PostSharp.Public, Version=1.5.0.0, Culture=neutral, PublicKeyToken=b13fd38b8f9c99d7'. C:\Dev\LogWithPostsharp\LogWithPostsharpCmd\Program.cs 18 22 LogWithPostsharpCmd The first error really looks like consequence of the second, but here is the deal: the PostSharp.Public.* simply doesn't exist in the downloaded .zip. Is there something that I'm not getting? Thank you in advance. Filipe

    Read the article

  • Hello Operator, My Switch Is Bored

    - by Paul White
    This is a post for T-SQL Tuesday #43 hosted by my good friend Rob Farley. The topic this month is Plan Operators. I haven’t taken part in T-SQL Tuesday before, but I do like to write about execution plans, so this seemed like a good time to start. This post is in two parts. The first part is primarily an excuse to use a pretty bad play on words in the title of this blog post (if you’re too young to know what a telephone operator or a switchboard is, I hate you). The second part of the post looks at an invisible query plan operator (so to speak). 1. My Switch Is Bored Allow me to present the rare and interesting execution plan operator, Switch: Books Online has this to say about Switch: Following that description, I had a go at producing a Fast Forward Cursor plan that used the TOP operator, but had no luck. That may be due to my lack of skill with cursors, I’m not too sure. The only application of Switch in SQL Server 2012 that I am familiar with requires a local partitioned view: CREATE TABLE dbo.T1 (c1 int NOT NULL CHECK (c1 BETWEEN 00 AND 24)); CREATE TABLE dbo.T2 (c1 int NOT NULL CHECK (c1 BETWEEN 25 AND 49)); CREATE TABLE dbo.T3 (c1 int NOT NULL CHECK (c1 BETWEEN 50 AND 74)); CREATE TABLE dbo.T4 (c1 int NOT NULL CHECK (c1 BETWEEN 75 AND 99)); GO CREATE VIEW V1 AS SELECT c1 FROM dbo.T1 UNION ALL SELECT c1 FROM dbo.T2 UNION ALL SELECT c1 FROM dbo.T3 UNION ALL SELECT c1 FROM dbo.T4; Not only that, but it needs an updatable local partitioned view. We’ll need some primary keys to meet that requirement: ALTER TABLE dbo.T1 ADD CONSTRAINT PK_T1 PRIMARY KEY (c1);   ALTER TABLE dbo.T2 ADD CONSTRAINT PK_T2 PRIMARY KEY (c1);   ALTER TABLE dbo.T3 ADD CONSTRAINT PK_T3 PRIMARY KEY (c1);   ALTER TABLE dbo.T4 ADD CONSTRAINT PK_T4 PRIMARY KEY (c1); We also need an INSERT statement that references the view. Even more specifically, to see a Switch operator, we need to perform a single-row insert (multi-row inserts use a different plan shape): INSERT dbo.V1 (c1) VALUES (1); And now…the execution plan: The Constant Scan manufactures a single row with no columns. The Compute Scalar works out which partition of the view the new value should go in. The Assert checks that the computed partition number is not null (if it is, an error is returned). The Nested Loops Join executes exactly once, with the partition id as an outer reference (correlated parameter). The Switch operator checks the value of the parameter and executes the corresponding input only. If the partition id is 0, the uppermost Clustered Index Insert is executed, adding a row to table T1. If the partition id is 1, the next lower Clustered Index Insert is executed, adding a row to table T2…and so on. In case you were wondering, here’s a query and execution plan for a multi-row insert to the view: INSERT dbo.V1 (c1) VALUES (1), (2); Yuck! An Eager Table Spool and four Filters! I prefer the Switch plan. My guess is that almost all the old strategies that used a Switch operator have been replaced over time, using things like a regular Concatenation Union All combined with Start-Up Filters on its inputs. Other new (relative to the Switch operator) features like table partitioning have specific execution plan support that doesn’t need the Switch operator either. This feels like a bit of a shame, but perhaps it is just nostalgia on my part, it’s hard to know. Please do let me know if you encounter a query that can still use the Switch operator in 2012 – it must be very bored if this is the only possible modern usage! 2. Invisible Plan Operators The second part of this post uses an example based on a question Dave Ballantyne asked using the SQL Sentry Plan Explorer plan upload facility. If you haven’t tried that yet, make sure you’re on the latest version of the (free) Plan Explorer software, and then click the Post to SQLPerformance.com button. That will create a site question with the query plan attached (which can be anonymized if the plan contains sensitive information). Aaron Bertrand and I keep a close eye on questions there, so if you have ever wanted to ask a query plan question of either of us, that’s a good way to do it. The problem The issue I want to talk about revolves around a query issued against a calendar table. The script below creates a simplified version and adds 100 years of per-day information to it: USE tempdb; GO CREATE TABLE dbo.Calendar ( dt date NOT NULL, isWeekday bit NOT NULL, theYear smallint NOT NULL,   CONSTRAINT PK__dbo_Calendar_dt PRIMARY KEY CLUSTERED (dt) ); GO -- Monday is the first day of the week for me SET DATEFIRST 1;   -- Add 100 years of data INSERT dbo.Calendar WITH (TABLOCKX) (dt, isWeekday, theYear) SELECT CA.dt, isWeekday = CASE WHEN DATEPART(WEEKDAY, CA.dt) IN (6, 7) THEN 0 ELSE 1 END, theYear = YEAR(CA.dt) FROM Sandpit.dbo.Numbers AS N CROSS APPLY ( VALUES (DATEADD(DAY, N.n - 1, CONVERT(date, '01 Jan 2000', 113))) ) AS CA (dt) WHERE N.n BETWEEN 1 AND 36525; The following query counts the number of weekend days in 2013: SELECT Days = COUNT_BIG(*) FROM dbo.Calendar AS C WHERE theYear = 2013 AND isWeekday = 0; It returns the correct result (104) using the following execution plan: The query optimizer has managed to estimate the number of rows returned from the table exactly, based purely on the default statistics created separately on the two columns referenced in the query’s WHERE clause. (Well, almost exactly, the unrounded estimate is 104.289 rows.) There is already an invisible operator in this query plan – a Filter operator used to apply the WHERE clause predicates. We can see it by re-running the query with the enormously useful (but undocumented) trace flag 9130 enabled: Now we can see the full picture. The whole table is scanned, returning all 36,525 rows, before the Filter narrows that down to just the 104 we want. Without the trace flag, the Filter is incorporated in the Clustered Index Scan as a residual predicate. It is a little bit more efficient than using a separate operator, but residual predicates are still something you will want to avoid where possible. The estimates are still spot on though: Anyway, looking to improve the performance of this query, Dave added the following filtered index to the Calendar table: CREATE NONCLUSTERED INDEX Weekends ON dbo.Calendar(theYear) WHERE isWeekday = 0; The original query now produces a much more efficient plan: Unfortunately, the estimated number of rows produced by the seek is now wrong (365 instead of 104): What’s going on? The estimate was spot on before we added the index! Explanation You might want to grab a coffee for this bit. Using another trace flag or two (8606 and 8612) we can see that the cardinality estimates were exactly right initially: The highlighted information shows the initial cardinality estimates for the base table (36,525 rows), the result of applying the two relational selects in our WHERE clause (104 rows), and after performing the COUNT_BIG(*) group by aggregate (1 row). All of these are correct, but that was before cost-based optimization got involved :) Cost-based optimization When cost-based optimization starts up, the logical tree above is copied into a structure (the ‘memo’) that has one group per logical operation (roughly speaking). The logical read of the base table (LogOp_Get) ends up in group 7; the two predicates (LogOp_Select) end up in group 8 (with the details of the selections in subgroups 0-6). These two groups still have the correct cardinalities as trace flag 8608 output (initial memo contents) shows: During cost-based optimization, a rule called SelToIdxStrategy runs on group 8. It’s job is to match logical selections to indexable expressions (SARGs). It successfully matches the selections (theYear = 2013, is Weekday = 0) to the filtered index, and writes a new alternative into the memo structure. The new alternative is entered into group 8 as option 1 (option 0 was the original LogOp_Select): The new alternative is to do nothing (PhyOp_NOP = no operation), but to instead follow the new logical instructions listed below the NOP. The LogOp_GetIdx (full read of an index) goes into group 21, and the LogOp_SelectIdx (selection on an index) is placed in group 22, operating on the result of group 21. The definition of the comparison ‘the Year = 2013’ (ScaOp_Comp downwards) was already present in the memo starting at group 2, so no new memo groups are created for that. New Cardinality Estimates The new memo groups require two new cardinality estimates to be derived. First, LogOp_Idx (full read of the index) gets a predicted cardinality of 10,436. This number comes from the filtered index statistics: DBCC SHOW_STATISTICS (Calendar, Weekends) WITH STAT_HEADER; The second new cardinality derivation is for the LogOp_SelectIdx applying the predicate (theYear = 2013). To get a number for this, the cardinality estimator uses statistics for the column ‘theYear’, producing an estimate of 365 rows (there are 365 days in 2013!): DBCC SHOW_STATISTICS (Calendar, theYear) WITH HISTOGRAM; This is where the mistake happens. Cardinality estimation should have used the filtered index statistics here, to get an estimate of 104 rows: DBCC SHOW_STATISTICS (Calendar, Weekends) WITH HISTOGRAM; Unfortunately, the logic has lost sight of the link between the read of the filtered index (LogOp_GetIdx) in group 22, and the selection on that index (LogOp_SelectIdx) that it is deriving a cardinality estimate for, in group 21. The correct cardinality estimate (104 rows) is still present in the memo, attached to group 8, but that group now has a PhyOp_NOP implementation. Skipping over the rest of cost-based optimization (in a belated attempt at brevity) we can see the optimizer’s final output using trace flag 8607: This output shows the (incorrect, but understandable) 365 row estimate for the index range operation, and the correct 104 estimate still attached to its PhyOp_NOP. This tree still has to go through a few post-optimizer rewrites and ‘copy out’ from the memo structure into a tree suitable for the execution engine. One step in this process removes PhyOp_NOP, discarding its 104-row cardinality estimate as it does so. To finish this section on a more positive note, consider what happens if we add an OVER clause to the query aggregate. This isn’t intended to be a ‘fix’ of any sort, I just want to show you that the 104 estimate can survive and be used if later cardinality estimation needs it: SELECT Days = COUNT_BIG(*) OVER () FROM dbo.Calendar AS C WHERE theYear = 2013 AND isWeekday = 0; The estimated execution plan is: Note the 365 estimate at the Index Seek, but the 104 lives again at the Segment! We can imagine the lost predicate ‘isWeekday = 0’ as sitting between the seek and the segment in an invisible Filter operator that drops the estimate from 365 to 104. Even though the NOP group is removed after optimization (so we don’t see it in the execution plan) bear in mind that all cost-based choices were made with the 104-row memo group present, so although things look a bit odd, it shouldn’t affect the optimizer’s plan selection. I should also mention that we can work around the estimation issue by including the index’s filtering columns in the index key: CREATE NONCLUSTERED INDEX Weekends ON dbo.Calendar(theYear, isWeekday) WHERE isWeekday = 0 WITH (DROP_EXISTING = ON); There are some downsides to doing this, including that changes to the isWeekday column may now require Halloween Protection, but that is unlikely to be a big problem for a static calendar table ;)  With the updated index in place, the original query produces an execution plan with the correct cardinality estimation showing at the Index Seek: That’s all for today, remember to let me know about any Switch plans you come across on a modern instance of SQL Server! Finally, here are some other posts of mine that cover other plan operators: Segment and Sequence Project Common Subexpression Spools Why Plan Operators Run Backwards Row Goals and the Top Operator Hash Match Flow Distinct Top N Sort Index Spools and Page Splits Singleton and Range Seeks Bitmaps Hash Join Performance Compute Scalar © 2013 Paul White – All Rights Reserved Twitter: @SQL_Kiwi

    Read the article

  • Port scientific software to GPU and publish it

    - by Werner
    Hi, let's say that I am a physicist and that I am the master of the universe when it comes to port salready existing oftware to GPU's with 100x or more speedups. Let's say that I find that some other scientist, which does not know how to program GPU, publishes the Open Source code in his/her website of a physical simulation program, in the field I am expert on. Let's say that I realize "I can port that code to GPU", and I suggest him, but he shows no interest. My interest here is, 1) to port it to GPU, 2) to publish this result in a scientific journal related with physics and/or computer science My question for you is 1- would you proceed here to port the code to GPU (or other new arch) and publish it? 2- how would you do it and which journal do you suggest? Thanks

    Read the article

  • MVC Automatic Menu

    - by Nuri Halperin
    An ex-colleague of mine used to call his SQL script generator "Super-Scriptmatic 2000". It impressed our then boss little, but was fun to say and use. We called every batch job and script "something 2000" from that day on. I'm tempted to call this one Menu-Matic 2000, except it's waaaay past 2000. Oh well. The problem: I'm developing a bunch of stuff in MVC. There's no PM to generate mounds of requirements and there's no Ux Architect to create wireframe. During development, things change. Specifically, actions get renamed, moved from controller x to y etc. Well, as the site grows, it becomes a major pain to keep a static menu up to date, because the links change. The HtmlHelper doesn't live up to it's name and provides little help. How do I keep this growing list of pesky little forgotten actions reigned in? The general plan is: Decorate every action you want as a menu item with a custom attribute Reflect out all menu items into a structure at load time Render the menu using as CSS  friendly <ul><li> HTML. The MvcMenuItemAttribute decorates an action, designating it to be included as a menu item: [AttributeUsage(AttributeTargets.Method, AllowMultiple = true)] public class MvcMenuItemAttribute : Attribute {   public string MenuText { get; set; }   public int Order { get; set; }   public string ParentLink { get; set; }   internal string Controller { get; set; }   internal string Action { get; set; }     #region ctor   public MvcMenuItemAttribute(string menuText) : this(menuText, 0) { } public MvcMenuItemAttribute(string menuText, int order) { MenuText = menuText; Order = order; }       internal string Link { get { return string.Format("/{0}/{1}", Controller, this.Action); } }   internal MvcMenuItemAttribute ParentItem { get; set; } #endregion } The MenuText allows overriding the text displayed on the menu. The Order allows the items to be ordered. The ParentLink allows you to make this item a child of another menu item. An example action could then be decorated thusly: [MvcMenuItem("Tracks", Order = 20, ParentLink = "/Session/Index")] . All pretty straightforward methinks. The challenge with menu hierarchy becomes fairly apparent when you try to render a menu and highlight the "current" item or render a breadcrumb control. Both encounter an  ambiguity if you allow a data source to have more than one menu item with the same URL link. The issue is that there is no great way to tell which link a person click. Using referring URL will fail if a user bookmarked the page. Using some extra query string to disambiguate duplicate URLs essentially changes the links, and also ads a chance of collision with other query parameters. Besides, that smells. The stock ASP.Net sitemap provider simply disallows duplicate URLS. I decided not to, and simply pick the first one encountered as the "current". Although it doesn't solve the issue completely – one might say they wanted the second of the 2 links to be "current"- it allows one to include a link twice (home->deals and products->deals etc), and the logic of deciding "current" is easy enough to explain to the customer. Now that we got that out of the way, let's build the menu data structure: public static List<MvcMenuItemAttribute> ListMenuItems(Assembly assembly) { var result = new List<MvcMenuItemAttribute>(); foreach (var type in assembly.GetTypes()) { if (!type.IsSubclassOf(typeof(Controller))) { continue; } foreach (var method in type.GetMethods()) { var items = method.GetCustomAttributes(typeof(MvcMenuItemAttribute), false) as MvcMenuItemAttribute[]; if (items == null) { continue; } foreach (var item in items) { if (String.IsNullOrEmpty(item.Controller)) { item.Controller = type.Name.Substring(0, type.Name.Length - "Controller".Length); } if (String.IsNullOrEmpty(item.Action)) { item.Action = method.Name; } result.Add(item); } } } return result.OrderBy(i => i.Order).ToList(); } Using reflection, the ListMenuItems method takes an assembly (you will hand it your MVC web assembly) and generates a list of menu items. It digs up all the types, and for each one that is an MVC Controller, digs up the methods. Methods decorated with the MvcMenuItemAttribute get plucked and added to the output list. Again, pretty simple. To make the structure hierarchical, a LINQ expression matches up all the items to their parent: public static void RegisterMenuItems(List<MvcMenuItemAttribute> items) { _MenuItems = items; _MenuItems.ForEach(i => i.ParentItem = items.FirstOrDefault(p => String.Equals(p.Link, i.ParentLink, StringComparison.InvariantCultureIgnoreCase))); } The _MenuItems is simply an internal list to keep things around for later rendering. Finally, to package the menu building for easy consumption: public static void RegisterMenuItems(Type mvcApplicationType) { RegisterMenuItems(ListMenuItems(Assembly.GetAssembly(mvcApplicationType))); } To bring this puppy home, a call in Global.asax.cs Application_Start() registers the menu. Notice the ugliness of reflection is tucked away from the innocent developer. All they have to do is call the RegisterMenuItems() and pass in the type of the application. When you use the new project template, global.asax declares a class public class MvcApplication : HttpApplication and that is why the Register call passes in that type. protected void Application_Start() { AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes);   MvcMenu.RegisterMenuItems(typeof(MvcApplication)); }   What else is left to do? Oh, right, render! public static void ShowMenu(this TextWriter output) { var writer = new HtmlTextWriter(output);   renderHierarchy(writer, _MenuItems, null); }   public static void ShowBreadCrumb(this TextWriter output, Uri currentUri) { var writer = new HtmlTextWriter(output); string currentLink = "/" + currentUri.GetComponents(UriComponents.Path, UriFormat.Unescaped);   var menuItem = _MenuItems.FirstOrDefault(m => m.Link.Equals(currentLink, StringComparison.CurrentCultureIgnoreCase)); if (menuItem != null) { renderBreadCrumb(writer, _MenuItems, menuItem); } }   private static void renderBreadCrumb(HtmlTextWriter writer, List<MvcMenuItemAttribute> menuItems, MvcMenuItemAttribute current) { if (current == null) { return; } var parent = current.ParentItem; renderBreadCrumb(writer, menuItems, parent); writer.Write(current.MenuText); writer.Write(" / ");   }     static void renderHierarchy(HtmlTextWriter writer, List<MvcMenuItemAttribute> hierarchy, MvcMenuItemAttribute root) { if (!hierarchy.Any(i => i.ParentItem == root)) return;   writer.RenderBeginTag(HtmlTextWriterTag.Ul); foreach (var current in hierarchy.Where(element => element.ParentItem == root).OrderBy(i => i.Order)) { if (ItemFilter == null || ItemFilter(current)) {   writer.RenderBeginTag(HtmlTextWriterTag.Li); writer.AddAttribute(HtmlTextWriterAttribute.Href, current.Link); writer.AddAttribute(HtmlTextWriterAttribute.Alt, current.MenuText); writer.RenderBeginTag(HtmlTextWriterTag.A); writer.WriteEncodedText(current.MenuText); writer.RenderEndTag(); // link renderHierarchy(writer, hierarchy, current); writer.RenderEndTag(); // li } } writer.RenderEndTag(); // ul } The ShowMenu method renders the menu out to the provided TextWriter. In previous posts I've discussed my partiality to using well debugged, time test HtmlTextWriter to render HTML rather than writing out angled brackets by hand. In addition, writing out using the actual writer on the actual stream rather than generating string and byte intermediaries (yes, StringBuilder being no exception) disturbs me. To carry out the rendering of an hierarchical menu, the recursive renderHierarchy() is used. You may notice that an ItemFilter is called before rendering each item. I figured that at some point one might want to exclude certain items from the menu based on security role or context or something. That delegate is the hook for such future feature. To carry out rendering of a breadcrumb recursion is used again, this time simply to unwind the parent hierarchy from the leaf node, then rendering on the return from the recursion rather than as we go along deeper. I guess I was stuck in LISP that day.. recursion is fun though.   Now all that is left is some usage! Open your Site.Master or wherever you'd like to place a menu or breadcrumb, and plant one of these calls: <% MvcMenu.ShowBreadCrumb(this.Writer, Request.Url); %> to show a breadcrumb trail (notice lack of "=" after <% and the semicolon). <% MvcMenu.ShowMenu(Writer); %> to show the menu.   As mentioned before, the HTML output is nested <UL> <LI> tags, which should make it easy to style using abundant CSS to produce anything from static horizontal or vertical to dynamic drop-downs.   This has been quite a fun little implementation and I was pleased that the code size remained low. The main crux was figuring out how to pass parent information from the attribute to the hierarchy builder because attributes have restricted parameter types. Once I settled on that implementation, the rest falls into place quite easily.

    Read the article

  • Couchdb conflict resolution

    - by Sundar
    How does CouchDB handles conflicts while doing bi-directional replication? For example: Lets say there are two address book databases (in server A and B). There is a document for Jack which contains contact details of Jack. Server A and B are replicated and both have the same version of Jack document. In server A, Jack's mobile no is updated. In server B, Jack's address is updated. Now when we do bi-directional replication there is a conflict. How does couchDB handles it? If we initiate replication in a Java program, is there a way to know whether there were any conflicts from the java program?

    Read the article

  • Linking with Boost error

    - by drhorrible
    I just downloaded and ran the boost installer for version 1.42 (from boostpro.com), and set up my project according to the getting started guide. However, when I build the program, I get this linker error: LINK : fatal error LNK1104: cannot open file 'libboost_program_options-vc90-mt-gd-1_42.lib' The build log adds this (I've replaced project-specific paths with *'s): Creating temporary file "******\Debug\RSP00001252363252.rsp" with contents [ /OUT:"*********.exe" /INCREMENTAL /LIBPATH:"C:\Program Files\boost\boost_1_42_0\lib" /MANIFEST /MANIFESTFILE:"Debug\hw6.exe.intermediate.manifest" /MANIFESTUAC:"level='asInvoker' uiAccess='false'" /DEBUG /PDB:"********\Debug\***.pdb" /SUBSYSTEM:CONSOLE /DYNAMICBASE /NXCOMPAT /MACHINE:X86 kernel32.lib user32.lib gdi32.lib winspool.lib comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib uuid.lib odbc32.lib odbccp32.lib ".\Debug\****.obj" ".\Debug\****.exe.embed.manifest.res" ] Creating command line "link.exe @********\Debug\RSP00001252363252.rsp /NOLOGO /ERRORREPORT:PROMPT" I've also emailed [email protected] (with a message very similar to this), but I thought maybe so would be faster.

    Read the article

  • OnExit is not entering via PostSharp in asp.net project.

    - by mark smith
    Hi there, I have setup PostSharp and it appears to be working but i don't get it entering OnExit (i have logged setup to ensure it is working) ... Its a bit tricky to configure with asp.net - or is it just me ... I am using the 1.5 new version I basically have the following in my web.config and i had to add the SearchPath otherwise it can't find my assemblies <postsharp directory="C:\Program Files\PostSharp 1.5" trace="true"> <parameters> <!--<add name="parameter-name" value="parameter-value"/>--> </parameters> <searchPath> <!-- Always add the binary folder to the search path. --> <add name="bin" value="~\bin"/> </searchPath> </postsharp> I have set tracing on but what is strange to me is that it appears to build to the temp directory, maybe this is my issue, i am unsure .. hence i do F5 ... Is it possible to name the Output directory and output file?? As you can see it is editing a DLL in the temp dir so IIS is no longer in control so it doesn't execute it ??? Confused! :-) C:\Program Files\PostSharp 1.5\postsharp.exe "/P:Output=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" "/P:IntermediateDirectory=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp " /P:CleanIntermediate=False /P:ReferenceDirectory=. /P:SignAssembly=False /P:PrivateKeyLocation= /P:ResolvedReferences= "/P:SearchPath=C:\Source Code\Visual Studio 2008\Projects\mysitemvc\mysitemvc\bin," /V /SkipAutoUpdate "C:\Program Files\PostSharp 1.5\Default.psproj" "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\before-postsharp\App_Web_04ae3ewy.dll" PostSharp 1.5 [1.5.6.627] - Copyright (c) Gael Fraiteur, 2005-2009. info PS0035: C:\Windows\Microsoft.NET\Framework\v2.0.50727\ilasm.exe "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.il" /QUIET /DLL /PDB "/RESOURCE=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.res" "/OUTPUT=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" /SUBSYSTEM=3 /FLAGS=1 /BASE=18481152 /STACK=1048576 /ALIGNMENT=512 /MDV=v2.0.50727

    Read the article

  • How can I flush the output of disp in Octave?

    - by Nathan Fellman
    I have a program in Octave that has a loop - running a function with various parameters, not something that I can turn into matrices. At the beginning of each iteration I print the current parameters using disp. The first times I ran it I had a brazillion warnings, and then I also got these prints. Now that I cleaned them up, I no longer see them. My guess is that they're stuck in a buffer, and I'll see them when the program ends or the buffer fills. Is there any way to force a flush of the print buffer so that I can see my prints?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • SQL SERVER – Import CSV into Database – Transferring File Content into a Database Table using CSVexpress

    - by pinaldave
    One of the most common data integration tasks I run into is a desire to move data from a file into a database table.  Generally the user is familiar with his data, the structure of the file, and the database table, but is unfamiliar with data integration tools and therefore views this task as something that is difficult.  What these users really need is a point and click approach that minimizes the learning curve for the data integration tool.  This is what CSVexpress (www.CSVexpress.com) is all about!  It is based on expressor Studio, a data integration tool I’ve been reviewing over the last several months. With CSVexpress, moving data between data sources can be as simple as providing the database connection details, describing the structure of the incoming and outgoing data and then connecting two pre-programmed operators.   There’s no need to learn the intricacies of the data integration tool or to write code.  Let’s look at an example. Suppose I have a comma separated value data file with data similar to the following, which is a listing of terminated employees that includes their hiring and termination date, department, job description, and final salary. EMP_ID,STRT_DATE,END_DATE,JOB_ID,DEPT_ID,SALARY 102,13-JAN-93,24-JUL-98 17:00,Programmer,60,"$85,000" 101,21-SEP-89,27-OCT-93 17:00,Account Representative,110,"$65,000" 103,28-OCT-93,15-MAR-97 17:00,Account Manager,110,"$75,000" 304,17-FEB-96,19-DEC-99 17:00,Marketing,20,"$45,000" 333,24-MAR-98,31-DEC-99 17:00,Data Entry Clerk,50,"$35,000" 100,17-SEP-87,17-JUN-93 17:00,Administrative Assistant,90,"$40,000" 334,24-MAR-98,31-DEC-98 17:00,Sales Representative,80,"$40,000" 400,01-JAN-99,31-DEC-99 17:00,Sales Manager,80,"$55,000" Notice the concise format used for the date values, the fact that the termination date includes both date and time information, and that the salary is clearly identified as money by the dollar sign and digit grouping.  In moving this data to a database table I want to express the dates using a format that includes the century since it’s obvious that this listing could include employees who left the company in both the 20th and 21st centuries, and I want the salary to be stored as a decimal value without the currency symbol and grouping character.  Most data integration tools would require coding within a transformation operation to effect these changes, but not expressor Studio.  Directives for these modifications are included in the description of the incoming data. Besides starting the expressor Studio tool and opening a project, the first step is to create connection artifacts, which describe to expressor where data is stored.  For this example, two connection artifacts are required: a file connection, which encapsulates the file system location of my file; and a database connection, which encapsulates the database connection information.  With expressor Studio, I use wizards to create these artifacts. First click New Connection > File Connection in the Home tab of expressor Studio’s ribbon bar, which starts the File Connection wizard.  In the first window, I enter the path to the directory that contains the input file.  Note that the file connection artifact only specifies the file system location, not the name of the file. Then I click Next and enter a meaningful name for this connection artifact; clicking Finish closes the wizard and saves the artifact. To create the Database Connection artifact, I must know the location of, or instance name, of the target database and have the credentials of an account with sufficient privileges to write to the target table.  To use expressor Studio’s features to the fullest, this account should also have the authority to create a table. I click the New Connection > Database Connection in the Home tab of expressor Studio’s ribbon bar, which starts the Database Connection wizard.  expressor Studio includes high-performance drivers for many relational database management systems, so I can simply make a selection from the “Supplied database drivers” drop down control.  If my desired RDBMS isn’t listed, I can optionally use an existing ODBC DSN by selecting the “Existing DSN” radio button. In the following window, I enter the connection details.  With Microsoft SQL Server, I may choose to use Windows Authentication rather than rather than account credentials.  After clicking Next, I enter a meaningful name for this connection artifact and clicking Finish closes the wizard and saves the artifact. Now I create a schema artifact, which describes the structure of the file data.  When expressor reads a file, all data fields are typed as strings.  In some use cases this may be exactly what is needed and there is no need to edit the schema artifact.  But in this example, editing the schema artifact will be used to specify how the data should be transformed; that is, reformat the dates to include century designations, change the employee and job ID’s to integers, and convert the salary to a decimal value. Again a wizard is used to create the schema artifact.  I click New Schema > Delimited Schema in the Home tab of expressor Studio’s ribbon bar, which starts the Database Connection wizard.  In the first window, I click Get Data from File, which then displays a listing of the file connections in the project.  When I click on the file connection I previously created, a browse window opens to this file system location; I then select the file and click Open, which imports 10 lines from the file into the wizard. I now view the file’s content and confirm that the appropriate delimiter characters are selected in the “Field Delimiter” and “Record Delimiter” drop down controls; then I click Next. Since the input file includes a header row, I can easily indicate that fields in the file should be identified through the corresponding header value by clicking “Set All Names from Selected Row. “ Alternatively, I could enter a different identifier into the Field Details > Name text box.  I click Next and enter a meaningful name for this schema artifact; clicking Finish closes the wizard and saves the artifact. Now I open the schema artifact in the schema editor.  When I first view the schema’s content, I note that the types of all attributes in the Semantic Type (the right-hand panel) are strings and that the attribute names are the same as the field names in the data file.  To change an attribute’s name and type, I highlight the attribute and click Edit in the Attributes grouping on the Schema > Edit tab of the editor’s ribbon bar.  This opens the Edit Attribute window; I can change the attribute name and select the desired type from the “Data type” drop down control.  In this example, I change the name of each attribute to the name of the corresponding database table column (EmployeeID, StartingDate, TerminationDate, JobDescription, DepartmentID, and FinalSalary).  Then for the EmployeeID and DepartmentID attributes, I select Integer as the data type, for the StartingDate and TerminationDate attributes, I select Datetime as the data type, and for the FinalSalary attribute, I select the Decimal type. But I can do much more in the schema editor.  For the datetime attributes, I can set a constraint that ensures that the data adheres to some predetermined specifications; a starting date must be later than January 1, 1980 (the date on which the company began operations) and a termination date must be earlier than 11:59 PM on December 31, 1999.  I simply select the appropriate constraint and enter the value (1980-01-01 00:00 as the starting date and 1999-12-31 11:59 as the termination date). As a last step in setting up these datetime conversions, I edit the mapping, describing the format of each datetime type in the source file. I highlight the mapping line for the StartingDate attribute and click Edit Mapping in the Mappings grouping on the Schema > Edit tab of the editor’s ribbon bar.  This opens the Edit Mapping window in which I either enter, or select, a format that describes how the datetime values are represented in the file.  Note the use of Y01 as the syntax for the year.  This syntax is the indicator to expressor Studio to derive the century by setting any year later than 01 to the 20th century and any year before 01 to the 21st century.  As each datetime value is read from the file, the year values are transformed into century and year values. For the TerminationDate attribute, my format also indicates that the datetime value includes hours and minutes. And now to the Salary attribute. I open its mapping and in the Edit Mapping window select the Currency tab and the “Use currency” check box.  This indicates that the file data will include the dollar sign (or in Europe the Pound or Euro sign), which should be removed. And on the Grouping tab, I select the “Use grouping” checkbox and enter 3 into the “Group size” text box, a comma into the “Grouping character” text box, and a decimal point into the “Decimal separator” character text box. These entries allow the string to be properly converted into a decimal value. By making these entries into the schema that describes my input file, I’ve specified how I want the data transformed prior to writing to the database table and completely removed the requirement for coding within the data integration application itself. Assembling the data integration application is simple.  Onto the canvas I drag the Read File and Write Table operators, connecting the output of the Read File operator to the input of the Write Table operator. Next, I select the Read File operator and its Properties panel opens on the right-hand side of expressor Studio.  For each property, I can select an appropriate entry from the corresponding drop down control.  Clicking on the button to the right of the “File name” text box opens the file system location specified in the file connection artifact, allowing me to select the appropriate input file.  I indicate also that the first row in the file, the header row, should be skipped, and that any record that fails one of the datetime constraints should be skipped. I then select the Write Table operator and in its Properties panel specify the database connection, normal for the “Mode,” and the “Truncate” and “Create Missing Table” options.  If my target table does not yet exist, expressor will create the table using the information encapsulated in the schema artifact assigned to the operator. The last task needed to complete the application is to create the schema artifact used by the Write Table operator.  This is extremely easy as another wizard is capable of using the schema artifact assigned to the Read Table operator to create a schema artifact for the Write Table operator.  In the Write Table Properties panel, I click the drop down control to the right of the “Schema” property and select “New Table Schema from Upstream Output…” from the drop down menu. The wizard first displays the table description and in its second screen asks me to select the database connection artifact that specifies the RDBMS in which the target table will exist.  The wizard then connects to the RDBMS and retrieves a list of database schemas from which I make a selection.  The fourth screen gives me the opportunity to fine tune the table’s description.  In this example, I set the width of the JobDescription column to a maximum of 40 characters and select money as the type of the LastSalary column.  I also provide the name for the table. This completes development of the application.  The entire application was created through the use of wizards and the required data transformations specified through simple constraints and specifications rather than through coding.  To develop this application, I only needed a basic understanding of expressor Studio, a level of expertise that can be gained by working through a few introductory tutorials.  expressor Studio is as close to a point and click data integration tool as one could want and I urge you to try this product if you have a need to move data between files or from files to database tables. Check out CSVexpress in more detail.  It offers a few basic video tutorials and a preview of expressor Studio 3.5, which will support the reading and writing of data into Salesforce.com. Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: Pinal Dave, PostADay, SQL, SQL Authority, SQL Documentation, SQL Download, SQL Query, SQL Server, SQL Tips and Tricks, SQLServer, T SQL, Technology

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

< Previous Page | 312 313 314 315 316 317 318 319 320 321 322 323  | Next Page >