Search Results

Search found 41379 results on 1656 pages for 'command line'.

Page 321/1656 | < Previous Page | 317 318 319 320 321 322 323 324 325 326 327 328  | Next Page >

  • Detecting EOF in a Binary File using Scheme

    - by yuguang
    (define (read-all-input) (local ((define line (bytes->list (read-bytes 4)))) (if (eof-object? line) empty (cons line (read-all-input))))) (void (read-all-input)) The above code fails because bytes-list expects an argument of type byte string, but is given #

    Read the article

  • Lost connection to MySQL server during query

    - by Otavio
    I have a huge table and I need to process all rows in it. I'm always getting this Lost connection message and I'm not able to reconnect and restore the cursor to the last position it was. This is basically the code I have here: # import MySQLdb class DB: conn = None def connect(self): self.conn = MySQLdb.connect('hostname', 'user', '*****', 'some_table', cursorclass=MySQLdb.cursors.SSCursor) def query(self, sql): try: cursor = self.conn.cursor() cursor.execute(sql) except (AttributeError, MySQLdb.OperationalError): self.connect() cursor = self.conn.cursor() cursor.execute(sql) return cursor # # db = DB() sql = "SELECT bla FROM foo" data = db.query(sql) for row in data: do_something(row) # But I'm always getting this: # Traceback (most recent call last): File "teste.py", line 124, in <module> run() File "teste.py", line 109, in run for row in data: File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 417, in next row = self.fetchone() File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 388, in fetchone r = self._fetch_row(1) File "/usr/lib64/python2.5/site-packages/MySQLdb/cursors.py", line 285, in _fetch_row return self._result.fetch_row(size, self._fetch_type) _mysql_exceptions.OperationalError: (2013, 'Lost connection to MySQL server during query') Exception _mysql_exceptions.OperationalError: (2013, 'Lost connection to MySQL server during query') in <bound method SSCursor.__del__ of <MySQLdb.cursors.SSCursor object at 0x7f7e3c8da410>> ignored # Do you have any idea?

    Read the article

  • Silverlight - Access the Layout Grid's DataContext in a DataGrid CellTemplate's DataTemplate?

    - by Sudeep
    Hi, I am using Silverlight 3 to develop an application. In my app, I have a layout Grid (named "LayoutGrid") in which I have a DataGrid (named "PART_datagrid") with DataGridTemplateColumns. The LayoutGrid is set a DataContext in which there is a Ladders list as a property. This Ladders list is set as the ItemsSource for the PART_datagrid. <Grid x:Name="LayoutRoot"> <DataGrid x:Name="PART_datagrid" ItemsSource="{Binding Ladders}"> ... <DataGridTemplateColumn> <DataGridTemplateColumn.CellTemplate> <DataTemplate> <Button Name="DeleteLadder" Click.Command="{Binding ElementName=LayoutRoot, Path=DataContext.DeleteLadderCommand}" /> Now in one of the DataGridTemplateColumns I have a button which should invoke a Command thats present in the LayoutGrid's DataContext. So I tried Element-To-Element binding on my DataTemplate button as follows <Button Name="DeleteLadder" Click.Command="{Binding ElementName=LayoutRoot, Path=DataContext.DeleteLadderCommand}" /> But this does not seem to work. What I want to achieve is to handle the event of deletion of a DataGrid row at the parent DataContext level using the command. Can someone pls suggest how do I proceed on this? Thanks in advance...

    Read the article

  • high load average, high wait, dmesg raid error messages (debian nfs server)

    - by John Stumbles
    Debian 6 on HP proliant (2 CPU) with raid (2*1.5T RAID1 + 2*2T RAID1 joined RAID0 to make 3.5T) running mainly nfs & imapd (plus samba for windows share & local www for previewing web pages); with local ubuntu desktop client mounting $HOME, laptops accessing imap & odd files (e.g. videos) via nfs/smb; boxes connected 100baseT or wifi via home router/switch uname -a Linux prole 2.6.32-5-686 #1 SMP Wed Jan 11 12:29:30 UTC 2012 i686 GNU/Linux Setup has been working for months but prone to intermittently going very slow (user experience on desktop mounting $HOME from server, or laptop playing videos) and now consistently so bad I've had to delve into it to try to find what's wrong(!) Server seems OK at low load e.g. (laptop) client (with $HOME on local disk) connecting to server's imapd and nfs mounting RAID to access 1 file: top shows load ~ 0.1 or less, 0 wait but when (desktop) client mounts $HOME and starts user KDE session (all accessing server) then top shows e.g. top - 13:41:17 up 3:43, 3 users, load average: 9.29, 9.55, 8.27 Tasks: 158 total, 1 running, 157 sleeping, 0 stopped, 0 zombie Cpu(s): 0.4%us, 0.4%sy, 0.0%ni, 49.0%id, 49.7%wa, 0.0%hi, 0.5%si, 0.0%st Mem: 903856k total, 851784k used, 52072k free, 171152k buffers Swap: 0k total, 0k used, 0k free, 476896k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 3935 root 20 0 2456 1088 784 R 2 0.1 0:00.02 top 1 root 20 0 2028 680 584 S 0 0.1 0:01.14 init 2 root 20 0 0 0 0 S 0 0.0 0:00.00 kthreadd 3 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/0 4 root 20 0 0 0 0 S 0 0.0 0:00.12 ksoftirqd/0 5 root RT 0 0 0 0 S 0 0.0 0:00.00 watchdog/0 6 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/1 7 root 20 0 0 0 0 S 0 0.0 0:00.16 ksoftirqd/1 8 root RT 0 0 0 0 S 0 0.0 0:00.00 watchdog/1 9 root 20 0 0 0 0 S 0 0.0 0:00.42 events/0 10 root 20 0 0 0 0 S 0 0.0 0:02.26 events/1 11 root 20 0 0 0 0 S 0 0.0 0:00.00 cpuset 12 root 20 0 0 0 0 S 0 0.0 0:00.00 khelper 13 root 20 0 0 0 0 S 0 0.0 0:00.00 netns 14 root 20 0 0 0 0 S 0 0.0 0:00.00 async/mgr 15 root 20 0 0 0 0 S 0 0.0 0:00.00 pm 16 root 20 0 0 0 0 S 0 0.0 0:00.02 sync_supers 17 root 20 0 0 0 0 S 0 0.0 0:00.02 bdi-default 18 root 20 0 0 0 0 S 0 0.0 0:00.00 kintegrityd/0 19 root 20 0 0 0 0 S 0 0.0 0:00.00 kintegrityd/1 20 root 20 0 0 0 0 S 0 0.0 0:00.02 kblockd/0 21 root 20 0 0 0 0 S 0 0.0 0:00.08 kblockd/1 22 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpid 23 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpi_notify 24 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpi_hotplug 25 root 20 0 0 0 0 S 0 0.0 0:00.00 kseriod 28 root 20 0 0 0 0 S 0 0.0 0:04.19 kondemand/0 29 root 20 0 0 0 0 S 0 0.0 0:02.93 kondemand/1 30 root 20 0 0 0 0 S 0 0.0 0:00.00 khungtaskd 31 root 20 0 0 0 0 S 0 0.0 0:00.18 kswapd0 32 root 25 5 0 0 0 S 0 0.0 0:00.00 ksmd 33 root 20 0 0 0 0 S 0 0.0 0:00.00 aio/0 34 root 20 0 0 0 0 S 0 0.0 0:00.00 aio/1 35 root 20 0 0 0 0 S 0 0.0 0:00.00 crypto/0 36 root 20 0 0 0 0 S 0 0.0 0:00.00 crypto/1 203 root 20 0 0 0 0 S 0 0.0 0:00.00 ksuspend_usbd 204 root 20 0 0 0 0 S 0 0.0 0:00.00 khubd 205 root 20 0 0 0 0 S 0 0.0 0:00.00 ata/0 206 root 20 0 0 0 0 S 0 0.0 0:00.00 ata/1 207 root 20 0 0 0 0 S 0 0.0 0:00.14 ata_aux 208 root 20 0 0 0 0 S 0 0.0 0:00.01 scsi_eh_0 dmesg suggests there's a disk problem: .............. (previous episode) [13276.966004] raid1:md0: read error corrected (8 sectors at 489900360 on sdc7) [13276.966043] raid1: sdb7: redirecting sector 489898312 to another mirror [13279.569186] ata4.00: exception Emask 0x0 SAct 0x1 SErr 0x0 action 0x0 [13279.569211] ata4.00: irq_stat 0x40000008 [13279.569230] ata4.00: failed command: READ FPDMA QUEUED [13279.569257] ata4.00: cmd 60/08:00:00:6a:05/00:00:23:00:00/40 tag 0 ncq 4096 in [13279.569262] res 41/40:00:05:6a:05/00:00:23:00:00/40 Emask 0x409 (media error) <F> [13279.569306] ata4.00: status: { DRDY ERR } [13279.569321] ata4.00: error: { UNC } [13279.575362] ata4.00: configured for UDMA/133 [13279.575388] ata4: EH complete [13283.169224] ata4.00: exception Emask 0x0 SAct 0x1 SErr 0x0 action 0x0 [13283.169246] ata4.00: irq_stat 0x40000008 [13283.169263] ata4.00: failed command: READ FPDMA QUEUED [13283.169289] ata4.00: cmd 60/08:00:00:6a:05/00:00:23:00:00/40 tag 0 ncq 4096 in [13283.169294] res 41/40:00:07:6a:05/00:00:23:00:00/40 Emask 0x409 (media error) <F> [13283.169331] ata4.00: status: { DRDY ERR } [13283.169345] ata4.00: error: { UNC } [13283.176071] ata4.00: configured for UDMA/133 [13283.176104] ata4: EH complete [13286.224814] ata4.00: exception Emask 0x0 SAct 0x1 SErr 0x0 action 0x0 [13286.224837] ata4.00: irq_stat 0x40000008 [13286.224853] ata4.00: failed command: READ FPDMA QUEUED [13286.224879] ata4.00: cmd 60/08:00:00:6a:05/00:00:23:00:00/40 tag 0 ncq 4096 in [13286.224884] res 41/40:00:06:6a:05/00:00:23:00:00/40 Emask 0x409 (media error) <F> [13286.224922] ata4.00: status: { DRDY ERR } [13286.224935] ata4.00: error: { UNC } [13286.231277] ata4.00: configured for UDMA/133 [13286.231303] ata4: EH complete [13288.802623] ata4.00: exception Emask 0x0 SAct 0x1 SErr 0x0 action 0x0 [13288.802646] ata4.00: irq_stat 0x40000008 [13288.802662] ata4.00: failed command: READ FPDMA QUEUED [13288.802688] ata4.00: cmd 60/08:00:00:6a:05/00:00:23:00:00/40 tag 0 ncq 4096 in [13288.802693] res 41/40:00:05:6a:05/00:00:23:00:00/40 Emask 0x409 (media error) <F> [13288.802731] ata4.00: status: { DRDY ERR } [13288.802745] ata4.00: error: { UNC } [13288.808901] ata4.00: configured for UDMA/133 [13288.808927] ata4: EH complete [13291.380430] ata4.00: exception Emask 0x0 SAct 0x1 SErr 0x0 action 0x0 [13291.380453] ata4.00: irq_stat 0x40000008 [13291.380470] ata4.00: failed command: READ FPDMA QUEUED [13291.380496] ata4.00: cmd 60/08:00:00:6a:05/00:00:23:00:00/40 tag 0 ncq 4096 in [13291.380501] res 41/40:00:05:6a:05/00:00:23:00:00/40 Emask 0x409 (media error) <F> [13291.380577] ata4.00: status: { DRDY ERR } [13291.380594] ata4.00: error: { UNC } [13291.386517] ata4.00: configured for UDMA/133 [13291.386543] ata4: EH complete [13294.347147] ata4.00: exception Emask 0x0 SAct 0x1 SErr 0x0 action 0x0 [13294.347169] ata4.00: irq_stat 0x40000008 [13294.347186] ata4.00: failed command: READ FPDMA QUEUED [13294.347211] ata4.00: cmd 60/08:00:00:6a:05/00:00:23:00:00/40 tag 0 ncq 4096 in [13294.347217] res 41/40:00:06:6a:05/00:00:23:00:00/40 Emask 0x409 (media error) <F> [13294.347254] ata4.00: status: { DRDY ERR } [13294.347268] ata4.00: error: { UNC } [13294.353556] ata4.00: configured for UDMA/133 [13294.353583] sd 3:0:0:0: [sdc] Unhandled sense code [13294.353590] sd 3:0:0:0: [sdc] Result: hostbyte=DID_OK driverbyte=DRIVER_SENSE [13294.353599] sd 3:0:0:0: [sdc] Sense Key : Medium Error [current] [descriptor] [13294.353610] Descriptor sense data with sense descriptors (in hex): [13294.353616] 72 03 11 04 00 00 00 0c 00 0a 80 00 00 00 00 00 [13294.353635] 23 05 6a 06 [13294.353644] sd 3:0:0:0: [sdc] Add. Sense: Unrecovered read error - auto reallocate failed [13294.353657] sd 3:0:0:0: [sdc] CDB: Read(10): 28 00 23 05 6a 00 00 00 08 00 [13294.353675] end_request: I/O error, dev sdc, sector 587557382 [13294.353726] ata4: EH complete [13294.366953] raid1:md0: read error corrected (8 sectors at 489900544 on sdc7) [13294.366992] raid1: sdc7: redirecting sector 489898496 to another mirror and they're happening quite frequently, which I guess is liable to account for the performance problem(?) # dmesg | grep mirror [12433.561822] raid1: sdc7: redirecting sector 489900464 to another mirror [12449.428933] raid1: sdb7: redirecting sector 489900504 to another mirror [12464.807016] raid1: sdb7: redirecting sector 489900512 to another mirror [12480.196222] raid1: sdb7: redirecting sector 489900520 to another mirror [12495.585413] raid1: sdb7: redirecting sector 489900528 to another mirror [12510.974424] raid1: sdb7: redirecting sector 489900536 to another mirror [12526.374933] raid1: sdb7: redirecting sector 489900544 to another mirror [12542.619938] raid1: sdc7: redirecting sector 489900608 to another mirror [12559.431328] raid1: sdc7: redirecting sector 489900616 to another mirror [12576.553866] raid1: sdc7: redirecting sector 489900624 to another mirror [12592.065265] raid1: sdc7: redirecting sector 489900632 to another mirror [12607.621121] raid1: sdc7: redirecting sector 489900640 to another mirror [12623.165856] raid1: sdc7: redirecting sector 489900648 to another mirror [12638.699474] raid1: sdc7: redirecting sector 489900656 to another mirror [12655.610881] raid1: sdc7: redirecting sector 489900664 to another mirror [12672.255617] raid1: sdc7: redirecting sector 489900672 to another mirror [12672.288746] raid1: sdc7: redirecting sector 489900680 to another mirror [12672.332376] raid1: sdc7: redirecting sector 489900688 to another mirror [12672.362935] raid1: sdc7: redirecting sector 489900696 to another mirror [12674.201177] raid1: sdc7: redirecting sector 489900704 to another mirror [12698.045050] raid1: sdc7: redirecting sector 489900712 to another mirror [12698.089309] raid1: sdc7: redirecting sector 489900720 to another mirror [12698.111999] raid1: sdc7: redirecting sector 489900728 to another mirror [12698.134006] raid1: sdc7: redirecting sector 489900736 to another mirror [12719.034376] raid1: sdc7: redirecting sector 489900744 to another mirror [12734.545775] raid1: sdc7: redirecting sector 489900752 to another mirror [12734.590014] raid1: sdc7: redirecting sector 489900760 to another mirror [12734.624050] raid1: sdc7: redirecting sector 489900768 to another mirror [12734.647308] raid1: sdc7: redirecting sector 489900776 to another mirror [12734.664657] raid1: sdc7: redirecting sector 489900784 to another mirror [12734.710642] raid1: sdc7: redirecting sector 489900792 to another mirror [12734.721919] raid1: sdc7: redirecting sector 489900800 to another mirror [12734.744732] raid1: sdc7: redirecting sector 489900808 to another mirror [12734.779330] raid1: sdc7: redirecting sector 489900816 to another mirror [12782.604564] raid1: sdb7: redirecting sector 1242934216 to another mirror [12798.264153] raid1: sdc7: redirecting sector 1242935080 to another mirror [13245.832193] raid1: sdb7: redirecting sector 489898296 to another mirror [13261.376929] raid1: sdb7: redirecting sector 489898304 to another mirror [13276.966043] raid1: sdb7: redirecting sector 489898312 to another mirror [13294.366992] raid1: sdc7: redirecting sector 489898496 to another mirror although the arrays are still running on all disks - they haven't given up on any yet: # cat /proc/mdstat Personalities : [raid1] [raid0] md10 : active raid0 md0[0] md1[1] 3368770048 blocks super 1.2 512k chunks md1 : active raid1 sde2[2] sdd2[1] 1464087824 blocks super 1.2 [2/2] [UU] md0 : active raid1 sdb7[0] sdc7[2] 1904684920 blocks super 1.2 [2/2] [UU] unused devices: <none> So I think I have some idea what the problem is but I am not a linux sysadmin expert by the remotest stretch of the imagination and would really appreciate some clue checking here with my diagnosis and what do I need to do: obviously I need to source another drive for sdc. (I'm guessing I could buy a larger drive if the price is right: I'm thinking that one day I'll need to grow the size of the array and that would be one less drive to replace with a larger one) then use mdadm to fail out the existing sdc, remove it and fit the new drive fdisk the new drive with the same size partition for the array as the old one had use mdadm to add the new drive into the array that sound OK?

    Read the article

  • script to search and replace deprecated functions

    - by user573881
    Hi, I am using the following script to search and replace the deprecated functions in a file with the newer ones. 5 for strFile in `ls deprecated_functions_search_and_replace.txt ` 6 do 7 sed "s/ereg_replace[^\(]*(\([^,]*\),/preg_replace\1('#'.\2.'#',/g" $strFile > temp_file 8 mv $strFile $strFile".bakup" 9 mv temp_file $strFile 10 11 sed "s/eregi[^\(]*(\([^,]*\),/preg_match\1('#'.\2.'#i',/g" $strFile > temp_file 12 mv $strFile $strFile".bakup" 13 mv temp_file $strFile 14 15 sed "s/ereg[^\(]*(\([^,]*\),/preg_match\1('#'.\2.'#',/g" $strFile > temp_file 16 mv $strFile $strFile".bakup" 17 mv temp_file $strFile 18 19 sed "s/split[^\(]*(\([^,]*\),/preg_split\1('#'.\2.'#',/g" $strFile > temp_file 20 mv $strFile $strFile".bakup" 21 mv temp_file $strFile 22 23 sed "s/mysql_escape_string/mysql_real_escape_string/g" $strFile > temp_file 24 mv $strFile $strFile".bakup" 25 mv temp_file $strFile 26 27 sed "s/set_magic_quotes_runtime(0)/\/\/set_magic_quotes_runtime(0)/g" $strFile > temp_file 28 mv $strFile $strFile".bakup" 29 mv temp_file $strFile 30 31 sed "s/ini_get('safe_mode')/false/g" $strFile > temp_file 32 mv $strFile $strFile".bakup" 33 mv temp_file $strFile 34 35 sed "s/session_register('\(.*\)')/$_SESSION['\1']=$\1/g" $strFile > temp_file 36 mv $strFile $strFile".bakup" 37 mv temp_file $strFile 38 39 sed "s/session_unregister('\(.*\)')/$_SESSION['\1']=''/g" $strFile > temp_file 40 mv $strFile $strFile".bakup" 41 mv temp_file $strFile 42 43 done However, when I run this script I am getting an error saying: sed: -e expression #1, char 60: invalid reference \2 on `s' command's RHS sed: -e expression #1, char 52: invalid reference \2 on `s' command's RHS sed: -e expression #1, char 50: invalid reference \2 on `s' command's RHS sed: -e expression #1, char 51: invalid reference \2 on `s' command's RHS I am unable to figure out whats going wrong. Someone please help me. Regards.

    Read the article

  • BASH statements execute alone but return "no such file" in for loop.

    - by reve_etrange
    Another one I can't find an answer for, and it feels like I've gone mad. I have a BASH script using a for loop to run a complex command (many protein sequence alignments) on a lot of files (~5000). The loop produces statements that will execute when given alone (i.e. copy-pasted from the error message to the command prompt), but which return "no such file or directory" inside the loop. Script below; there are actually several more arguments but this includes some representative ones and the file arguments. #!/bin/bash # Pass directory with targets as FASTA sequences as argument. # Arguments to psiblast # Common db=local/db/nr/nr outfile="/mnt/scratch/psi-blast" e=0.001 threads=8 itnum=5 pssm="/mnt/scratch/psi-blast/pssm." pssm_txt="/mnt/scratch/psi-blast/pssm." pseudo=0 pwa_inclusion=0.002 for i in ${1}/* do filename=$(basename $i) "local/ncbi-blast-2.2.23+/bin/psiblast\ -query ${i}\ -db $db\ -out ${outfile}/${filename}.out\ -evalue $e\ -num_threads $threads\ -num_iterations $itnum\ -out_pssm ${pssm}$filename\ -out_ascii_pssm ${pssm_txt}${filename}.txt\ -pseudocount $pseudo\ -inclusion_ethresh $pwa_inclusion" done Running this scripts gives "<scriptname> line <last line before 'done'>: <attempted command> : No such file or directory. If I then paste the attempted command onto the prompt it will run. Each of these commands takes a couple of minutes to run.

    Read the article

  • Jython 2.5.1: "ImportError: No Module named os"

    - by Leonidas
    I looked through the other posts and bug reports and couldn't figure out what's causing this. I'm using Jython 2.5.1, in a Java project in Eclipse (Ubuntu 8.10). It has been added to the project as a standalone .jar file (I just replaced the old Jython 2.1 jar with this one). I'm running a script that uses the threading.py class. At some point the statement "import os" is evaluated from linecache.py and I get this error, which I can't seem to figure out how to fix: 'Execution failed. Traceback (most recent call last): File "<string>", line 1, in <module> File "../lib/python/threading.py", line 6, in <module> import traceback File "../lib/python/traceback.py", line 3, in <module> import linecache File "../lib/python/linecache.py", line 9, in <module> import os ImportError: No module named os'

    Read the article

  • c# asp.net How to return a usercontrol from a handeler ashx?

    - by Justin808
    I want to return the HTML output of the control from a handler. My code looks like this: <%@ WebHandler Language="C#" Class="PopupCalendar" % using System; using System.IO; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; public class PopupCalendar : IHttpHandler { public void ProcessRequest (HttpContext context) { context.Response.ContentType = "text/plain"; System.Web.UI.Page page = new System.Web.UI.Page(); UserControl ctrl = (UserControl)page.LoadControl("~/Controls/CalendarMonthView.ascx"); page.Form.Controls.Add(ctrl); StringWriter stringWriter = new StringWriter(); HtmlTextWriter tw = new HtmlTextWriter(stringWriter); ctrl.RenderControl(tw); context.Response.Write(stringWriter.ToString()); } public bool IsReusable { get { return false; } } } I'm getting the error: Server Error in '/CMS' Application. Object reference not set to an instance of an object. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.NullReferenceException: Object reference not set to an instance of an object. Source Error: Line 14: System.Web.UI.Page page = new System.Web.UI.Page(); Line 15: UserControl ctrl = (UserControl)page.LoadControl("~/Controls/CalendarMonthView.ascx"); Line 16: page.Form.Controls.Add(ctrl); Line 17: Line 18: StringWriter stringWriter = new StringWriter(); How can I return the output of a Usercontrol via a handler?

    Read the article

  • Sharepoint OLE DB - field not updateable

    - by Pandincus
    I need to write a simple C# .NET application to retrieve, update, and insert some data in a Sharepoint list. I am NOT a Sharepoint developer, and I don't have control over our Sharepoint server. I would prefer not to have to develop this in a proper sharepoint development environment simply because I don't want to have to deploy my application on the Sharepoint server -- I'd rather just access data externally. Anyway, I found out that you can access Sharepoint data using OLE DB, and I tried it successfully using some ADO.NET: var db = DatabaseFactory.CreateDatabase(); DataSet ds = new DataSet(); using (var command = db.GetSqlStringCommand("SELECT * FROM List")) { db.LoadDataSet(command, ds, "List"); } The above works. However, when I try to insert: using (var command = db.GetSqlStringCommand("INSERT INTO List ([HeaderName], [Description], [Number]) VALUES ('Blah', 'Blah', 100)")) { db.ExecuteNonQuery(command); } I get this error: Cannot update 'HeaderName'; field not updateable. I did some Googling and apparently you cannot insert data through OLE DB! Does anyone know if there are some possible workarounds? I could try using Sharepoint Web Services, but I tried that initially and was having a heck of a time authenticating. Is that my only option?

    Read the article

  • How can I use a delimiter in wmic output, separating columns?

    - by Abhishek Simon
    I want to fetch Windows Hotfix listing with some format, whose output can be separated with some delimiter. so far I found a wmic command which gives me a desired output but the problem is the \s delimiter is not going to work here. Is there a way I can place some , or anyother character, which I can later use in java program to get individual columns? Command wmic qfe get caption,csname,description,hotfixid,installedby,installedon Output Caption CSName Description HotFixID InstalledBy InstalledOn http://go.microsoft.com/fwlink/?LinkId=161784 Abhishek Update KB971033 NT AUTHORITY\SYSTEM 3/15/2012 http://support.microsoft.com/?kbid=2032276 Abhishek Security Update KB2032276 NT AUTHORITY\SYSTEM 3/15/2012 .. . Update I am trying for /f "tokens=1,2,3,4,5,6,7,8,9,10,11" %g in ('wmic qfe get caption,csname,description,fixcomments,hotfixid,installdate,installedby,installedon,name,servicepackineffect,status') do @echo %g,%h,%i,%j,%k,%l,%m,%n,%o,%p but it gives me invalid GET Expression C:\Users\Abhishek\Desktop>for /f "tokens=1,2,3,4,5,6,7,8,9,10,11" %g in ('wmic qfe get caption,csname,description,fixcomments,hotfixid,installdate,installedby,installedon,name,servicepackineffect,status') do @echo %g,%h,%i,%j,%k,%l,%m,%n,%o,%p Invalid GET Expression. What is the problem here? This might solve the problem for me . More Update I even tried the below command but this too does not solve space problem Command for /f "tokens=1,2,3,4,5,6,7,8,9,10,11" %g in ('wmic qfe list') do @echo %g,%h,%i,%j,%k,%l,%m,%n,%o,%p Output Caption,CSName,Description,FixComments,HotFixID,InstallDate,InstalledBy,InstalledOn,Name,ServicePackInEffect http://go.microsoft.com/fwlink/?LinkId=161784,Abhishek,Update,KB971033,NT,AUTHOR,,Y\SYSTEM,3/15/2012, http://support.microsoft.com/?kbid=2281679,Abhishek,Security,Update,KB2281679,NT,AUTHORITY\SYSTEM,3/15/2012, http://support.microsoft.com/?kbid=2284742,Abhishek,Update,KB2284742,NT,AUTHORIT,,SYSTEM,3/15/2012, http://support.microsoft.com/?kbid=2286198,Abhishek,Security,Update,KB2286198,NT,AUTHORITY\SYSTEM,3/15/2012,

    Read the article

  • Castle Windsor upgrade causes TypeLoadException for generic types

    - by Neil Barnwell
    I have the following mapping in my Castle Windsor xml file which has worked okay (unchanged) for some time: <component id="defaultBasicRepository" service="MyApp.Models.Repositories.IBasicRepository`1, MyApp.Models" type="MyApp.Models.Repositories.Linq.BasicRepository`1, MyApp.Models" lifestyle="perWebRequest"/> I got this from the Windsor documentation at http://www.castleproject.org/container/documentation/v1rc3/usersguide/genericssupport.html. Since I upgraded Windsor, I now get the following exception at runtime: Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.TypeLoadException: GenericArguments[0], 'T', on 'MyApp.Models.Repositories.Linq.BasicRepository`1[TEntity]' violates the constraint of type parameter 'TEntity'. Source Error: Line 44: public static void ConfigureIoC() Line 45: { Line 46: var windsor = new WindsorContainer("Windsor.xml"); Line 47: Line 48: ServiceLocator.SetLocatorProvider(() = new WindsorServiceLocator(windsor)); I'm using ASP.NET MVC 1.0, Visual Studio 2008 and Castle Windsor as downloaded from http://sourceforge.net/projects/castleproject/files/InversionOfControl/2.1/Castle-Windsor-2.1.1.zip/download Can anyone shed any light on this? I'm sure the upgrade of Castle Windsor is what caused it - it's been working well for ages.

    Read the article

  • pyscripter Rpyc error

    - by jf328
    pyscripter 2.5.3.0 x64, python 2.7.7 anaconda 2.0.1, windows 7 I was using pyscripter and EPD python happily in 32 bit, no problem. Just changed to 64 bit anaconda version and re-installed everything but now pyscripter cannot import rpyc -- it runs with internal engine (no anaconda), but no such error in pure python. Thanks very much! btw, there is a similar SO post few years ago, but the answer there does not work. *** Python 2.7.3 (default, Apr 10 2012, 23:24:47) [MSC v.1500 64 bit (AMD64)] on win32. *** Internal Python engine is active *** *** Internal Python engine is active *** >>> import rpyc Traceback (most recent call last): File "<interactive input>", line 1, in <module> File "C:\Anaconda\lib\site-packages\rpyc\__init__.py", line 44, in <module> from rpyc.core import (SocketStream, TunneledSocketStream, PipeStream, Channel, File "C:\Anaconda\lib\site-packages\rpyc\core\__init__.py", line 1, in <module> from rpyc.core.stream import SocketStream, TunneledSocketStream, PipeStream File "C:\Anaconda\lib\site-packages\rpyc\core\stream.py", line 7, in <module> import socket File "C:\Anaconda\Lib\socket.py", line 47, in <module> import _socket ImportError: DLL load failed: The specified procedure could not be found. >>> C:\research>python Python 2.7.7 |Anaconda 2.0.1 (64-bit)| (default, Jun 11 2014, 10:40:02) [MSC v.1500 64bit (AMD64)] on win32 Type "help", "copyright", "credits" or "license" for more information. Anaconda is brought to you by Continuum Analytics. Please check out: http://continuum.io/thanks and https://binstar.org >>> import rpyc >>>

    Read the article

  • Can you return an assignable lvalue in Scala?

    - by Alex R
    (note, lvalue is actually a term from the C grammar, I don't know what it's called in Scala!) Trying to learn Scala... this evening I'm working on an internal DSL for a dynamically scoped language that might resemble PHP syntax. My REPL is: Welcome to Scala version 2.7.6.final (Java HotSpot(TM) Client VM, Java 1.6.0). I have some made-up example code: class $(any: Any) { def update(sym: Symbol, any: Any) { println("line 2 executed");} def -(sym: Symbol) : $ = { println("line 1 executed"); return this } def update(any: Any) { println("line 3 executed");} } The following works as expected: scala var a = new $(0) a: $ = $@19238ad scala a('x) = "blah" line 2 executed On the other hand, why does the following not invoke the 1-parameter update method? scala a = 1 :6: error: type mismatch; found : Int(1) required: $ a = 1 ^ Ultimately, I would like this to work: a-'x = "blah" Thanks

    Read the article

  • AttributeError while adding colorbar in matplotlib

    - by bgbg
    The following code fails to run on Python 2.5.4: from matplotlib import pylab as pl import numpy as np data = np.random.rand(6,6) fig = pl.figure(1) fig.clf() ax = fig.add_subplot(1,1,1) ax.imshow(data, interpolation='nearest', vmin=0.5, vmax=0.99) pl.colorbar() pl.show() The error message is C:\temp>python z.py Traceback (most recent call last): File "z.py", line 10, in <module> pl.colorbar() File "C:\Python25\lib\site-packages\matplotlib\pyplot.py", line 1369, in colorbar ret = gcf().colorbar(mappable, cax = cax, ax=ax, **kw) File "C:\Python25\lib\site-packages\matplotlib\figure.py", line 1046, in colorbar cb = cbar.Colorbar(cax, mappable, **kw) File "C:\Python25\lib\site-packages\matplotlib\colorbar.py", line 622, in __init__ mappable.autoscale_None() # Ensure mappable.norm.vmin, vmax AttributeError: 'NoneType' object has no attribute 'autoscale_None' How can I add colorbar to this code? Following is the interpreter information: Python 2.5.4 (r254:67916, Dec 23 2008, 15:10:54) [MSC v.1310 32 bit (Intel)] on win32 Type "help", "copyright", "credits" or "license" for more information. >>>

    Read the article

  • The nexus of MSDeploy, MSBuild and Hudson

    - by roufamatic
    Hey, I have experience with MSBuild and Hudson, but am new to MSDeploy. I currently have a simple solution with one web application project. I set up a build configuration and am using the "Publish" command (Visual Studio 2010) to simply copy files to a local folder and do config file replacement. What I would like to do is automate this using Hudson. So I figure I'll create an MSBuild script that will Perform the build (by calling out to the project file with my desired build configuration) Call MSDeploy to do all the same things that the "Publish" command is doing, except copy the files to a different folder. Configure Hudson to poll subversion and perform steps 1 & 2 when changes are detected Step 2 is where I'm getting lost. I assumed that the project.xml file that was created by VS2010 corresponded to -verb:sync -source:manifest=project.xml options, but msdeploy is choking on that xml file so clearly that's not what it's intended for. What command is Visual Studio executing under the covers to perform the config file replacement and the file copy? How do I automate the Publish command?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • When does a PHP <5.3.0 daemon script receive signals?

    - by MidnightLightning
    I've got a PHP script in the works that is a job worker; its main task is to check a database table for new jobs, and if there are any, to act on them. But jobs will be coming in in bursts, with long gaps in between, so I devised a sleep cycle like: while(true) { if ($jobs = get_new_jobs()) { // Act upon the jobs } else { // No new jobs now sleep(30); } } Good, but in some cases that means there might be a 30 second lag before a new job is acted upon. Since this is a daemon script, I figured I'd try the pcntl_signal hook to catch a SIGUSR1 signal to nudge the script to wake up, like: $_isAwake = true; function user_sig($signo) { global $_isAwake; daemon_log("Caught SIGUSR1"); $_isAwake = true; } pcntl_signal(SIGUSR1, 'user_sig'); while(true) { if ($jobs = get_new_jobs()) { // Act upon the jobs } else { // No new jobs now daemon_log("No new jobs, sleeping..."); $_isAwake = false; $ts = time(); while(time() < $ts+30) { sleep(1); if ($_isAwake) break; // Did a signal happen while we were sleeping? If so, stop sleeping } $_isAwake = true; } } I broke the sleep(30) up into smaller sleep bits, in case a signal doesn't interrupt a sleep() command, thinking that this would cause at most a one-second delay, but in the log file, I'm seeing that the SIGUSR1 isn't being caught until after the full 30 seconds has passed (and maybe the outer while loop resets). I found the pcntl_signal_dispatch command, but that's only for PHP 5.3 and higher. If I were using that version, I could stick a call to that command before the if ($_isAwake) call, but as it currently stands I'm on 5.2.13. On what sort of situations is the signals queue interpreted in PHP versions without the means to explicitly call the queue parsing? Could I put in some other useless command in that sleep loop that would trigger a signal queue parse within there?

    Read the article

  • Installing psycopg2 (postgresql) in virtualenv on windows

    - by StackUnderflow
    I installed psycopg2 in virtualenv using easy_install psycopg2. I did not see any errors and looks like installation went fine.. there is an egg file created in the site-packages dir for psycopg2.. but when I run import psycopg2 in the interpreter, I am getting following error.. any clue? How can I fix it.. any other way to install psycopg2 in virtualenv.. Traceback (most recent call last): File "<stdin>", line 1, in <module> File "build\bdist.win32\egg\psycopg2\__init__.py", line 69, in <module> File "build\bdist.win32\egg\psycopg2\_psycopg.py", line 7, in <module> File "build\bdist.win32\egg\psycopg2\_psycopg.py", line 6, in __bootstrap__ Thanks.

    Read the article

  • xcopy failing within TFSbuild

    - by mattgcon
    I am using TFS2008 and within my TFSBuild.proj file I have a target that call xcopy to copy the build to the production website location for automation. However I am receiving the following error when running the build: Task "Exec" Command: xcopy "\\test\TFSBuilds\Online System V2 Build to NETPUB_20100430.2\Debug\_PublishedWebsites\IPAMIntranet" " C:\\Inetpub\wwwroot\IPAMOnlineSystem\IPAMIntranet\IPAMIntranet " /E Parse Error 'C:\\Inetpub\wwwroot\IPAMOnlineSystem\IPAMIntranet\IPAMIntranet' is not recognized as an internal or external command, operable program or batch file. '" /E ' is not recognized as an internal or external command, operable program or batch file. The following is my code line for the xcopy: <Target Name="AfterDropBuild"> <Exec Command="xcopy &quot;$(DropLocation)\$(BuildNumber)\Debug\_PublishedWebsites\IPAMIntranet&quot; &quot;$(RemoteDeploySitePath)&quot; /E " /> </Target> I have even tried single quotes around the file locations and actual double quotes insteand of the " symbols. Why is this happening, can anyone decipher this for me and help me correct this.

    Read the article

  • How to insert a word into a string in Perl

    - by Nano HE
    #!C:\Perl\bin\perl.exe use strict; use warnings; use Data::Dumper; my $fh = \*DATA; while(my $line = <$fh>) { $line =~ s/ ^/male /x ; print $line ; } __DATA__ 1 0104 Mike Lee 2:01:48 output male 1 0104 Mike Lee 2:01:48 Then I tried to insert male after the racenumber(0104), I replaced the code with style. $line =~ s/ ^\d+\s+\d+\s+ /male /x ; # but failed Acturally I want the output. thank you. 1 0104 male Mike Lee 2:01:48

    Read the article

  • mercurial .hgrc notify hook

    - by Eeyore
    Could someone tell me what is incorrect in my .hgrc configuration? I am trying to use gmail to send a e-mail after each push and/or commit. .hgrc [paths] default = ssh://www.domain.com/repo/hg [ui] username = intern <[email protected]> ssh="C:\Program Files (x86)\Mercurial\plink.exe" -ssh -i "C:\Program Files (x86)\Mercurial\key.pub" [extensions] hgext.notify = [hooks] changegroup.notify = python:hgext.notify.hook incoming.notify = python:hgext.notify.hook [email] from = [email protected] [smtp] host = smtp.gmail.com username = [email protected] password = sure port = 587 tls = true [web] baseurl = http://dev/... [notify] sources = serve push pull bundle test = False config = /path/to/subscription/file template = \ndetails: {baseurl}{webroot}/rev/{node|short}\nchangeset: {rev}:{node|short}\nuser: {author}\ndate: {date|date}\ndescription:\n{desc}\n maxdiff = 300 Error Incoming comand failed for P/project. running ""C:\Program Files (x86)\Mercurial\plink.exe" -ssh -i "C:\Program Files (x86)\Mercurial\key.pub" [email protected] "hg -R repo/hg serve --stdio"" sending hello command sending between command remote: FATAL ERROR: Server unexpectedly closed network connection abort: no suitable response from remote hg! , error code: -1 running ""C:\Program Files (x86)\Mercurial\plink.exe" -ssh -i "C:\Program Files (x86)\Mercurial\key.pub" [email protected] "hg -R repo/hg serve --stdio"" sending hello command sending between command remote: FATAL ERROR: Server unexpectedly closed network connection abort: no suitable response from remote hg!

    Read the article

  • importing pywiiuse to test out

    - by Patrick Burton
    This is probably a simple problem. But I downloaded the pywiiuse library from here and I also downloaded the examples. However when I try to run one of the examples I end up with import issues. I'm not certain I have everything configured properly to run. One error I receive when trying to run example.py: Press 1&2 Traceback (most recent call last): File "example.py", line 73, in <module> wiimotes = wiiuse.init(nmotes) File "/home/thed0ctor/Descargas/wiiuse-0.12/wiiuse/__init__.py", line 309, in init dll = ctypes.cdll.LoadLibrary('libwiiuse.so') File "/usr/lib/python2.7/ctypes/__init__.py", line 431, in LoadLibrary return self._dlltype(name) File "/usr/lib/python2.7/ctypes/__init__.py", line 353, in __init__ self._handle = _dlopen(self._name, mode) OSError: libwiiuse.so: cannot open shared object file: No such file or directory I'm really just starting out with this library and don't really see any documentation on how to configure pywiiuse so any help is much appreciated.

    Read the article

  • Moving data files failing

    - by Miles Hayler
    Trying to migrate data from C: to D: via the SBS console is failing. The wizard starts running but drops out in the first few seconds. I'll post the full logs, but the important lines appear to be as follows: An exception of type 'Type: System.IO.FileNotFoundException, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' has occurred. Message: The system cannot find the file specified. (Exception from HRESULT: 0x80070002) Stack: at TaskScheduler.TaskSchedulerClass.GetFolder(String Path) at Microsoft.WindowsServerSolutions.Common.WindowsTaskScheduler..ctor(String taskPath, String taskName) BaseException: Microsoft.WindowsServerSolutions.Storage.Common.StorageException: GetServerBackupTaskStatus: fail to find the task --- ErrorCode:0 I've been googling for days with no luck. I have found that mscorlib is a component of .net, and I've discovered multiple instances of the file in %windir%, %windir%\winsxs, %windir%\Microsoft.net Anyone come across and fixed this one before? --------------------------------------------------------- [1516] 110315.190856.1105: Storage: Initializing...C:\Program Files\Windows Small Business Server\Bin\MoveData.exe [1516] 110315.190856.2875: Storage: Data Store to be moved: Exchange [1516] 110315.190856.5305: TaskScheduler: Exception System.IO.FileNotFoundException: [1516] 110315.190856.5605: Exception: --------------------------------------- An exception of type 'Type: System.IO.FileNotFoundException, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' has occurred. Timestamp: 03/15/2011 19:08:56 Message: The system cannot find the file specified. (Exception from HRESULT: 0x80070002) Stack: at TaskScheduler.TaskSchedulerClass.GetFolder(String Path) at Microsoft.WindowsServerSolutions.Common.WindowsTaskScheduler..ctor(String taskPath, String taskName) [1516] 110315.190856.5625: Storage: Exception Microsoft.WindowsServerSolutions.Common.WindowsTaskSchedulerException: [1516] 110315.190856.5635: Exception: --------------------------------------- [b]An exception of type 'Type: Microsoft.WindowsServerSolutions.Common.WindowsTaskSchedulerException, Common, Version=6.0.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35' has occurred.[/b] Timestamp: 03/15/2011 19:08:56 Message: Failed to find the task path Stack: at Microsoft.WindowsServerSolutions.Common.WindowsTaskScheduler..ctor(String taskPath, String taskName) at Microsoft.WindowsServerSolutions.Storage.Common.ServerBackupUtility.GetServerBackupTaskStatus() --------------------------------------- An exception of type 'Type: System.IO.FileNotFoundException, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' has occurred. Timestamp: 03/15/2011 19:08:56 Message: The system cannot find the file specified. (Exception from HRESULT: 0x80070002) Stack: at TaskScheduler.TaskSchedulerClass.GetFolder(String Path) at Microsoft.WindowsServerSolutions.Common.WindowsTaskScheduler..ctor(String taskPath, String taskName) [1516] 110315.190856.5665: Storage: Error Retrieving Server Backup Task Status: ErrorCode:0 BaseException: Microsoft.WindowsServerSolutions.Storage.Common.StorageException: GetServerBackupTaskStatus: fail to find the task ---> ErrorCode:0 BaseException: Microsoft.WindowsServerSolutions.Common.WindowsTaskSchedulerException: Failed to find the task path ---> System.IO.FileNotFoundException: The system cannot find the file specified. (Exception from HRESULT: 0x80070002) at TaskScheduler.TaskSchedulerClass.GetFolder(String Path) at Microsoft.WindowsServerSolutions.Common.WindowsTaskScheduler..ctor(String taskPath, String taskName) --- End of inner exception stack trace --- at Microsoft.WindowsServerSolutions.Common.WindowsTaskScheduler..ctor(String taskPath, String taskName) at Microsoft.WindowsServerSolutions.Storage.Common.ServerBackupUtility.GetServerBackupTaskStatus() --- End of inner exception stack trace --- at Microsoft.WindowsServerSolutions.Storage.Common.ServerBackupUtility.GetServerBackupTaskStatus() at Microsoft.WindowsServerSolutions.Storage.MoveData.Helper.get_ServerBackupTaskState() [1516] 110315.190857.6216: Storage: Backup Task State: Unknown [1516] 110315.190857.9347: Storage: Launching the Move Data Wizard! [1516] 110315.190857.9397: Wizard: Admin:QueryNextPage(null) = Storage.MoveDataWizard.GettingStartedPage [1516] 110315.190857.9417: Wizard: TOC Storage.MoveDataWizard.GettingStartedPage is on ExpectedPath [1516] 110315.190857.9577: Wizard: Storage.MoveDataWizard.GettingStartedPage entered [1516] 110315.190857.9657: Wizard: Admin:QueryNextPage(Storage.MoveDataWizard.GettingStartedPage) = Storage.MoveDataWizard.DiagnoseDataStorePage [1516] 110315.190857.9657: Wizard: TOC Storage.MoveDataWizard.DiagnoseDataStorePage is on ExpectedPath [1516] 110315.190857.9657: Wizard: Admin:QueryNextPage(Storage.MoveDataWizard.DiagnoseDataStorePage) = Storage.MoveDataWizard.NewDataStoreLocationPage [1516] 110315.190857.9657: Wizard: TOC Storage.MoveDataWizard.NewDataStoreLocationPage is on ExpectedPath [1516] 110315.190857.9657: Wizard: Admin:QueryNextPage(Storage.MoveDataWizard.NewDataStoreLocationPage) = null [1516] 110315.190857.9697: Wizard: ---------------------------------- [1516] 110315.190857.9697: Wizard: The pages visted: [1516] 110315.190857.9697: Wizard: Current Page := [TOC Storage.MoveDataWizard.GettingStartedPage] [1516] 110315.190857.9697: Wizard: [TOC] : TOC Storage.MoveDataWizard.DiagnoseDataStorePage [1516] 110315.190857.9697: Wizard: [TOC] : TOC Storage.MoveDataWizard.NewDataStoreLocationPage [1516] 110315.190857.9697: Wizard: Step 1 of 3 [1516] 110315.190907.0406: Wizard: Admin:QueryNextPage(Storage.MoveDataWizard.GettingStartedPage) = Storage.MoveDataWizard.DiagnoseDataStorePage [1516] 110315.190907.0416: Wizard: Storage.MoveDataWizard.GettingStartedPage exited with the button: Next [1516] 110315.190907.0416: WizardChainEngine Next Clicked: Going to page {0}.: Storage.MoveDataWizard.DiagnoseDataStorePage [1516] 110315.190907.0496: Wizard: Storage.MoveDataWizard.DiagnoseDataStorePage entered [1516] 110315.190907.0606: Wizard: Admin:QueryNextPage(Storage.MoveDataWizard.DiagnoseDataStorePage) = Storage.MoveDataWizard.NewDataStoreLocationPage [1516] 110315.190907.0606: Wizard: Admin:QueryNextPage(Storage.MoveDataWizard.NewDataStoreLocationPage) = null [1516] 110315.190907.0606: Wizard: ---------------------------------- [1516] 110315.190907.0606: Wizard: The pages visted: [1516] 110315.190907.0606: Wizard: [TOC] visited: TOC Storage.MoveDataWizard.GettingStartedPage [1516] 110315.190907.0606: Wizard: Current Page := [TOC Storage.MoveDataWizard.DiagnoseDataStorePage] [1516] 110315.190907.0616: Wizard: [TOC] : TOC Storage.MoveDataWizard.NewDataStoreLocationPage [1516] 110315.190907.0616: Wizard: Step 2 of 3 [19772] 110315.190907.0656: Storage: Starting System Diagnosis [19772] 110315.190907.0656: Storage: Getting Data Store Information [19772] 110315.190907.1086: Storage: Create the list of storage and DB directory path [19772] 110315.190907.1246: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingTasks..ctor [19772] 110315.190907.1546: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingTasks.Initialize [19772] 110315.190907.1596: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.Initialize [19772] 110315.190907.1606: Messaging: Exchange install path: C:\Program Files\Microsoft\Exchange Server\bin [19772] 110315.190908.4157: Messaging: E12 Monad runspace created ID: Microsoft.PowerShell [19772] 110315.190908.4237: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190908.4287: Messaging: Executed management shell command: get-exchangeserver [19772] 110315.190910.2369: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190910.2369: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.Initialize [19772] 110315.190910.5699: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingTasks.GatherAdminInfo [19772] 110315.190910.5699: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190910.5719: Messaging: Executed management shell command: get-user -Identity "dmagroup.local\Administrator" [19772] 110315.190911.0870: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.0880: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.0880: Messaging: Executed management shell command: get-mailbox -Identity "d2ae2bf0-48a7-4ce9-9e72-bb3c765454ac" [19772] 110315.190911.1300: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.1310: Messaging: User Administrator is mail enabled and can use MessagingManagement to send mail. [19772] 110315.190911.1310: Messaging: Email address used for user: [email protected] [19772] 110315.190911.1440: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.1440: Messaging: Executed management shell command: get-group -Identity "Domain Admins" [19772] 110315.190911.1630: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.1640: Messaging: User Administrator is a member of Domain Admins and can use MessagingManagement to manage Exchange. [19772] 110315.190911.1640: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingTasks.GatherAdminInfo [19772] 110315.190911.1640: Messaging: MessagingManagement enabled for Exchange management: True [19772] 110315.190911.1640: Messaging: MessagingManagement enabled for mail submission: True [19772] 110315.190911.1640: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingTasks.Initialize [19772] 110315.190911.1640: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Tasks.TaskMoveExchangeData.CreateDataStoreDriveList [19772] 110315.190911.1670: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.Initialize [19772] 110315.190911.1670: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.1670: Messaging: Executed management shell command: get-storagegroup -Server "SERVER01" [19772] 110315.190911.2990: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.3070: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.Initialize [19772] 110315.190911.3070: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.3070: Messaging: Executed management shell command: get-mailboxdatabase -Server "SERVER01" [19772] 110315.190911.4440: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.4520: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.Initialize [19772] 110315.190911.4520: Messaging: Begin Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.4520: Messaging: Executed management shell command: get-publicfolderdatabase -Server "SERVER01" [19772] 110315.190911.5240: Messaging: End Microsoft.WindowsServerSolutions.Messaging.Management.MessagingRunspace.StaticExecute [19772] 110315.190911.5510: Storage: Data Store Drive/s Details:Name=C:\,Size=12675712420 [19772] 110315.190911.5510: Storage: Data Store Size Details: Current Total Size=12675712420 Required Size=12675712420 [19772] 110315.190911.5510: Storage: MoveData Task can move the Data Store=True [19772] 110315.190911.8401: Storage: An error was encountered when performing system diagnosis : ErrorCode:0 BaseException: Microsoft.WindowsServerSolutions.Storage.Common.StorageException: WMI error occurred while accessing drive ---> System.Management.ManagementException: Not found at System.Management.ManagementException.ThrowWithExtendedInfo(ManagementStatus errorCode) at System.Management.ManagementObjectCollection.ManagementObjectEnumerator.MoveNext() at Microsoft.WindowsServerSolutions.Storage.Common.DriveUtil.IsDriveRemovable(String drive) --- End of inner exception stack trace --- at Microsoft.WindowsServerSolutions.Storage.Common.DriveUtil.IsDriveRemovable(String drive) at Microsoft.WindowsServerSolutions.Storage.Common.DataStoreInfo.LoadAvailableDrives() at Microsoft.WindowsServerSolutions.Storage.Common.MoveDataUtil.CanMoveData(DataStoreInfo storeInfo, MoveDataError& error) at Microsoft.WindowsServerSolutions.Storage.MoveData.DiagnoseDataStorePagePresenter.DiagnoseDataStore(Object sender, DoWorkEventArgs args) [1516] 110315.190912.0331: Storage: An error occured during the execution: System.Reflection.TargetInvocationException: Exception has been thrown by the target of an invocation. ---> ErrorCode:0 BaseException: Microsoft.WindowsServerSolutions.Storage.Common.StorageException: Diagnosing the Data Store failed (see the inner exception) ---> ErrorCode:0 BaseException: Microsoft.WindowsServerSolutions.Storage.Common.StorageException: WMI error occurred while accessing drive ---> System.Management.ManagementException: Not found at System.Management.ManagementException.ThrowWithExtendedInfo(ManagementStatus errorCode) at System.Management.ManagementObjectCollection.ManagementObjectEnumerator.MoveNext() at Microsoft.WindowsServerSolutions.Storage.Common.DriveUtil.IsDriveRemovable(String drive) --- End of inner exception stack trace --- at Microsoft.WindowsServerSolutions.Storage.Common.DriveUtil.IsDriveRemovable(String drive) at Microsoft.WindowsServerSolutions.Storage.Common.DataStoreInfo.LoadAvailableDrives() at Microsoft.WindowsServerSolutions.Storage.Common.MoveDataUtil.CanMoveData(DataStoreInfo storeInfo, MoveDataError& error) at Microsoft.WindowsServerSolutions.Storage.MoveData.DiagnoseDataStorePagePresenter.DiagnoseDataStore(Object sender, DoWorkEventArgs args) at System.ComponentModel.BackgroundWorker.WorkerThreadStart(Object argument) --- End of inner exception stack trace --- at Microsoft.WindowsServerSolutions.Storage.MoveData.DiagnoseDataStorePagePresenter.backgroundWorker_RunWorkerCompleted(Object sender, RunWorkerCompletedEventArgs e) --- End of inner exception stack trace --- at System.RuntimeMethodHandle._InvokeMethodFast(Object target, Object[] arguments, SignatureStruct& sig, MethodAttributes methodAttributes, RuntimeTypeHandle typeOwner) at System.Reflection.RuntimeMethodInfo.Invoke(Object obj, BindingFlags invokeAttr, Binder binder, Object[] parameters, CultureInfo culture, Boolean skipVisibilityChecks) at System.Delegate.DynamicInvokeImpl(Object[] args) at System.Windows.Forms.Control.InvokeMarshaledCallbackDo(ThreadMethodEntry tme) at System.Windows.Forms.Control.InvokeMarshaledCallbackHelper(Object obj) at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Forms.Control.InvokeMarshaledCallback(ThreadMethodEntry tme) at System.Windows.Forms.Control.InvokeMarshaledCallbacks() at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.Control.ControlNativeWindow.WndProc(Message& m) at System.Windows.Forms.NativeWindow.DebuggableCallback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) at System.Windows.Forms.UnsafeNativeMethods.DispatchMessageW(MSG& msg) at System.Windows.Forms.Application.ComponentManager.System.Windows.Forms.UnsafeNativeMethods.IMsoComponentManager.FPushMessageLoop(Int32 dwComponentID, Int32 reason, Int32 pvLoopData) at System.Windows.Forms.Application.ThreadContext.RunMessageLoopInner(Int32 reason, ApplicationContext context) at System.Windows.Forms.Application.ThreadContext.RunMessageLoop(Int32 reason, ApplicationContext context) at Microsoft.WindowsServerSolutions.Common.Wizards.Framework.WizardFrameView.Create() at Microsoft.WindowsServerSolutions.Common.Wizards.Framework.WizardChainEngine.Launch() at Microsoft.WindowsServerSolutions.Storage.MoveData.MainClass.LaunchMoveDataWizard() at Microsoft.WindowsServerSolutions.Storage.MoveData.MainClass.Main(String[] args)

    Read the article

  • Reconstructing Position in the Original Array from the Position in a Stripped Down Array

    - by aronchick
    I have a text file that contains a number of the following: <ID> <Time 1> --> <Time 2> <Quote (potentially multiple line> <New Line Separator> <ID> <Time 1> --> <Time 2> <Quote (potentially multiple line> <New Line Separator> <ID> <Time 1> --> <Time 2> <Quote (potentially multiple line> <New Line Separator> I have a very simple regex for stripping these out into a constant block so it's just: <Quote> <Quote> <Quote> What I'd like to do is present the quotes as a block to the user, and have them select it (using jQuery.fieldSelection) and then use the selected content to back out to the original array, so I can get timing and IDs. Because this has to go out to HTML, and the user has to be able to select the text on the screen, I can't do anything like hidden divs or hidden input fields. The only data I will have is the character range selected on screen. To be specific, this is what it looks like: 1 0:00 --> 0:05 He was bored. So bored. His great intellect, seemingly inexhaustible, was hungry for new challenges but he was the last of the great innovators 2 0:05 --> 0:10 - society's problems had all been solved. 3 0:11 --> 0:20 All seemingly unconnected disciplines had long since been found to be related in horrifically elusive and contrived ways and he had mastered them all. And this is what I'd like to present to the user for selection: He was bored. So bored. His great intellect, seemingly inexhaustible, was hungry for new challenges but he was the last of the great innovators - society's problems had all been solved. All seemingly unconnected disciplines had long since been found to be related in horrifically elusive and contrived ways and he had mastered them all. Has anyone com across something like this before? Any ideas how to take the selected text, or selection position, and go backwards to the original meta-data?

    Read the article

  • SyntaxError using gdata-python-client to access Google Book Search Data API

    - by isbadawi
    >>> import gdata.books.service >>> service = gdata.books.service.BookService() >>> results = service.search_by_keyword(isbn='0434003484') Traceback (most recent call last): File "<pyshell#4>", line 1, in <module> results = service.search_by_keyword(isbn='0434003484') ... snip ... File "C:\Python26\lib\site-packages\atom\__init__.py", line 127, in CreateClassFromXMLString tree = ElementTree.fromstring(xml_string) File "<string>", line 85, in XML SyntaxError: syntax error: line 1, column 0 This is a minimal example -- in particular, the book service unit tests included in the package also fail with the exact same error. I've looked at the wiki and open issue tickets on Google Code to no avail (and this seems to me more apt to be a silly error on my end rather than a problem with the library). I'm not sure how to interpret the error message. If it matters, I'm using python 2.6.5.

    Read the article

< Previous Page | 317 318 319 320 321 322 323 324 325 326 327 328  | Next Page >