Search Results

Search found 10033 results on 402 pages for 'execution speed'.

Page 324/402 | < Previous Page | 320 321 322 323 324 325 326 327 328 329 330 331  | Next Page >

• Haskell Linear Algebra Matrix Library for Arbitrary Element Types

  - by Johannes Weiß

  I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

  Read the article

• function's return address is different from its supposed value, buffer overflow,

  - by ultrajohn

  Good day everyone! I’m trying to understand how buffer overflow works. I’m doing this for my project in a computer security course I’m taking. Right now, I’m in the process of determining the address of the function’s return address which I’m supposed to change to perform a buffer overflow attack. I’ve written a simple program based from an example I’ve read in the internet. What this program does is it creates an integer pointer that will be made to point to the address of the function return address in the stack. To do this, (granted I understand how a function/program variables get organized in the stack), I add 8 to the buffer variable’ address and set it as the value of ret. I’m not doing anything here that would change the address contained in the location of func’s return address. here's the program: Output of the program when gets excecuted: As you can see, I’m printing the address of the variables buffer and ret. I’ve added an additional statement printing the value of the ret variable (supposed location of func return address, so this should print the address of the next instruction which will get executed after func returns from execution). Here is the dump which shows the supposed address of the instruction to be executed after func returns. (Underlined in green) As you can see, that value is way different from the value printed contained in the variable ret. My question is, why are they different? (of course in the assumption that what I’ve done are all right). Else, what have I done wrong? Is my understanding of the program’s runtime stack wrong? Please, help me understand this. My project is due nextweek and I’ve barely touched it yet. I’m sorry if I’m being demanding, I badly need your help.

  Read the article

• GAE Task Queue oddness

  - by b3nw

  I have been testing the taskqueue with mixed success. Currently I am using the default queue, in default settings ect ect.... I have a test url setup which inserts about 8 tasks into the queue. With short order, all 8 are completed properly. So far so good. The problem comes up when I re-load that url twice under say a minute. Now watching the task queue, all the tasks are added properly, but only the first batch execute it seems. But the "Run in Last Minute" # shows the right number of tasks being run.... The request logs tell a different story. They show only the first set of 8 running, but all task creation urls working successfully. The oddness of this is that if I wait say a minute between the task creation url requests, it will work fine. Oddly enough changing the bucket_size or execution speed does not seem to help. Only the first batch are executed. I have also reduced the number of requests all the way down to 2, and still found only the first 2 execute. Any others added display the same issues as above. Any suggestions? Thanks

  Read the article

• iPhone - dequeueReusableCellWithIdentifier usage

  - by Jukurrpa

  Hi, I'm working on a iPhone app which has a pretty large UITableView with data taken from the web, so I'm trying to optimize its creation and usage. I found out that dequeueReusableCellWithIdentifier is pretty useful, but after seeing many source codes using this, I'm wondering if the usage I make of this function is the good one. Here is what people usually do: UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:@"Cell"]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:@"Cell"]; // Add elements to the cell return cell; And here is the way I did it: NSString identifier = [NSString stringWithFormat:@"Cell @d", indexPath.row]: // The cell row UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:identifier]; if (cell != nil) return cell; cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:identifier]; // Add elements to the cell return cell; The difference is that people use the same identifier for every cell, so dequeuing one only avoids to alloc a new one. For me, the point of queuing was to give each cell a unique identifier, so when the app asks for a cell it already displayed, neither allocation nor element adding have to be done. In fine I don't know which is best, the "common" method ceils the table's memory usage to the exact number of cells it display, whislt the method I use seems to favor speed as it keeps all calculated cells, but can cause large memory consumption (unless there's an inner limit to the queue). Am I wrong to use it this way? Or is it just up to the developper, depending on his needs?

  Read the article

• Is SQLDataReader slower than using the command line utility sqlcmd?

  - by Andrew

  I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

  Read the article

• Locking a table for getting MAX in LINQ

  - by Hossein Margani

  Hi Every one! I have a query in LINQ, I want to get MAX of Code of my table and increase it and insert new record with new Code. just like the IDENTITY feature of SQL Server, but here my Code column is char(5) where can be alphabets and numeric. My problem is when inserting a new row, two concurrent processes get max and insert an equal Code to the record. my command is: var maxCode = db.Customers.Select(c=>c.Code).Max(); var anotherCustomer = db.Customers.Where(...).SingleOrDefault(); anotherCustomer.Code = GenerateNextCode(maxCode); db.SubmitChanges(); I ran this command cross 1000 threads and each updating 200 customers, and used a Transaction with IsolationLevel.Serializable, after two or three execution an error occured: using (var db = new DBModelDataContext()) { DbTransaction tran = null; try { db.Connection.Open(); tran = db.Connection.BeginTransaction(IsolationLevel.Serializable); db.Transaction = tran; . . . . tran.Commit(); } catch { tran.Rollback(); } finally { db.Connection.Close(); } } error: Transaction (Process ID 60) was deadlocked on lock resources with another process and has been chosen as the deadlock victim. Rerun the transaction. other IsolationLevels generates this error: Row not found or changed. Please help me, thank you.

  Read the article

• WCF Double Hop questions about Security and Binding.

  - by Ken Maglio

  Background information: .Net Website which calls a service (aka external service) facade on an app server in the DMZ. This external service then calls the internal service which is on our internal app server. From there that internal service calls a stored procedure (Linq to SQL Classes), and passes the serialized data back though to the external service, and from there back to the website. We've done this so any communication goes through an external layer (our external app server) and allows interoperability; we access our data just like our clients consuming our services. We've gotten to the point in our development where we have completed the system and it all works, the double hop acts as it should. However now we are working on securing the entire process. We are looking at using TransportWithMessageCredentials. We want to have WS2007HttpBinding for the external for interoperability, but then netTCPBinding for the bridge through the firewall for security and speed. Questions: If we choose WS2007HttpBinding as the external services binding, and netTCPBinding for the internal service is this possible? I know WS-* supports this as does netTCP, however do they play nice when passing credential information like user/pass? If we go to Kerberos, will this impact anything? We may want to do impersonation in the future. If you can when you answer post any reference links about why you're answering the way you are, that would be very helpful to us. Thanks!

  Read the article

• Some general C questions.

  - by b-gen-jack-o-neill

  Hello. I am trying to fully understand the process pro writing code in some language to execution by OS. In my case, the language would be C and the OS would be Windows. So far, I read many different articles, but I am not sure, whether I understand the process right, and I would like to ask you if you know some good articles on some subjects I couldn´t find. So, what I think I know about C (and basically other languages): C compiler itself handles only data types, basic math operations, pointers operations, and work with functions. By work with functions I mean how to pass argument to it, and how to get output from function. During compilation, function call is replaced by passing arguments to stack, and than if function is not inline, its call is replaced by some symbol for linker. Linker than find the function definition, and replace the symbol to jump adress to that function (and of course than jump back to program). If the above is generally true and I get it right, where to final .exe file actually linker saves the functions? After the main() function? And what creates the .exe header? Compiler or Linker? Now, additional capabilities of C, today known as C standart library is set of functions and the declarations of them, that other programmers wrote to extend and simplify use of C language. But these functions like printf() were (or could be?) written in different language, or assembler. And there comes my next question, can be, for example printf() function be written in pure C without use of assembler? I know this is quite big question, but I just mostly want to know, wheather I am right or not. And trust me, I read a lots of articles on the web, and I would not ask you, If I could find these infromation together on one place, in one article. Insted I must piece by piece gather informations, so I am not sure if I am right. Thanks.

  Read the article

• EF 4.0 : Save Changes Retry Logic

  - by BGR

  Hi, I would like to implement an application wide retry system for all entity SaveChanges method calls. Technologies: Entity framework 4.0 .Net 4.0 namespace Sample.Data.Store.Entities { public partial class StoreDB { public override int SaveChanges(System.Data.Objects.SaveOptions options) { for (Int32 attempt = 1; ; ) { try { return base.SaveChanges(options); } catch (SqlException sqlException) { // Increment Trys attempt++; // Find Maximum Trys Int32 maxRetryCount = 5; // Throw Error if we have reach the maximum number of retries if (attempt == maxRetryCount) throw; // Determine if we should retry or abort. if (!RetryLitmus(sqlException)) throw; else Thread.Sleep(ConnectionRetryWaitSeconds(attempt)); } } } static Int32 ConnectionRetryWaitSeconds(Int32 attempt) { Int32 connectionRetryWaitSeconds = 2000; // Backoff Throttling connectionRetryWaitSeconds = connectionRetryWaitSeconds * (Int32)Math.Pow(2, attempt); return (connectionRetryWaitSeconds); } /// <summary> /// Determine from the exception if the execution /// of the connection should Be attempted again /// </summary> /// <param name="exception">Generic Exception</param> /// <returns>True if a a retry is needed, false if not</returns> static Boolean RetryLitmus(SqlException sqlException) { switch (sqlException.Number) { // The service has encountered an error // processing your request. Please try again. // Error code %d. case 40197: // The service is currently busy. Retry // the request after 10 seconds. Code: %d. case 40501: //A transport-level error has occurred when // receiving results from the server. (provider: // TCP Provider, error: 0 - An established connection // was aborted by the software in your host machine.) case 10053: return (true); } return (false); } } } The problem: How can I run the StoreDB.SaveChanges to retry on a new DB context after an error occured? Something simular to Detach/Attach might come in handy. Thanks in advance! Bart

  Read the article

• How to reliably send a request cross domain and cross browser on page unload

  - by Agmin

  I have javascript code that's loaded by 3rd parties. The javascript keeps track of a number of metrics, and when a user exits the page I'd like to send the metrics back to my server. Due to XSS checks in some browsers, like IE, I cannot do a simple jquery.ajax() call. Instead, I'm appending an image src to the page with jquery. Here's the code, cased by browser: function record_metrics() { //Arbitrary code execution here to set test_url $esajquery('#MainDiv').append("<img src='" + test_url + "' />"); } if ($esajquery.browser.msie) { window.onbeforeunload = function() { record_metrics(); } } else { $esajquery(window).unload( function(){ record_metrics(); } ); } FF aborts the request to "test_url" if I use window.onbeforeunload, and IE8 doesn't work with jquery's unload(). IE8 also fails to work if the arbitrary test_url setting code is too long, although IE8 seems to work fine if the is immediately appended to the DOM. Is there a better way to solve this issue? Unfortunately this really needs to execute when a user leaves the page.

  Read the article

• Change made in the Converter will notify the change in the bound property?

  - by Kishore Kumar

  I have two property FirstName and LastName and bound to a textblock using Multibinidng and converter to display the FullName as FirstName + Last Name. FirstName="Kishore" LastName="Kumar" In the Converter I changed the LastName as "Changed Text" values[1] = "Changed Text"; After executing the Converter my TextBlock will show "Kishore Changed Text" but Dependency property LastName is still have the last value "Kumar". Why I am not getting the "Changed Text" value in the LastName property after the execution?. Will the change made at converter will notify the bound property? <Window.Resources> <local:NameConverter x:Key="NameConverter"></local:NameConverter> </Window.Resources> <Grid> <TextBlock> <TextBlock.Text> <MultiBinding Converter="{StaticResource NameConverter}"> <Binding Path="FirstName"></Binding> <Binding Path="LastName"></Binding> </MultiBinding> </TextBlock.Text> </TextBlock> </Grid> Converter: public class NameConverter:IMultiValueConverter { #region IMultiValueConverter Members public object Convert(object[] values, Type targetType, object parameter, System.Globalization.CultureInfo culture) { values[1] = "Changed Text"; return values[0].ToString() + " " + values[1].ToString(); } public object[] ConvertBack(object value, Type[] targetTypes, object parameter, System.Globalization.CultureInfo culture) { throw new NotImplementedException(); } #endregion }

  Read the article

• What strategy do you use to sync your code when working from home

  - by Ben Daniel

  At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

  Read the article

• Versioning SharePoint binary Workflow ASPX task forms

  - by Janis Veinbergs

  Hello. As noted by some developers, workflow versioning is somekind of headache in SharePoint. I`m wondering is there a way I can version my aspx forms? For sure, i can version code behind assemblies, but if markup changes for any of my files in LAYOUTS folder? Is there versioning available for files or do i have to choose new filename for my form? Sorry, i should have been more specific. Yes, i have files under version control (i can restore previous versions etc), but i`m not talking about this kind of version control. But by deploying new Workflow Version, i must not delete old one, because it is still running on many items in SharePoint, but rather , as noted in previous links, deploy new one so i don't break execution of workflows. But workflows will still break if i don't preserve old aspx forms used by users to interact with workflows. So i must ensure that Assemblies with old version numbers used by old workflow exists (this one is ok, i just changed assembly version number and deployed to GAC) I must ensure that old workflow still uses old aspx form used users to interact with workflow, but new workflow version should use new aspx form with more options (how to do this?).

  Read the article

• Vlad the deployer on Dreamhost - initial script

  - by xmariachi

  Hi, I'm trying to deploy an app with SVN and Vlad the deployer. Vlad and its dependencies are installed and seem OK. I'm trying the following: rake prod vlad:update Being my config/deploy.rb file: task :prod do set :application, "xxx" set :deploy_timestamped, "false" set :user, "username" set :scm_user, "scmusername" set :repository, "http://domain.com/svn/app" set :domain, "domain.com" set :deploy_to, "/home/username/deployments/app" puts "Production deployment to #{deploy_to}" end I have done "rake prod vlad:setup" already, that's fine. But when calling "rake prod vlad:update", I get the following A ...file Exported revision 14. ln: creating symbolic link `/home/username/deployments/drupalgestalt/releases/20100503164225/public/system' to `/home/username/deployments/drupalgestalt/shared/system': No such file or directory rake aborted! execution failed with status 1: ssh domain.com ln -s /home/username/deployments/app/shared/log /home/username/deployments/app/releases/20100503164225/log && ln -s /home/username/deployments/app/shared/system /home/username/deployments/app/releases/20100503164225/public/system && ln -s /home/username/deployments/app/shared/pids /home/username/deployments/app/releases/20100503164225/tmp/pids Apparently it complains when creating the ln, but permissions are all set up fine. Am I doing anything wrong? I'm just starting with Vlad on the assumption it was super-easy to set up. Had played a bit with cap in the past, and I do like Vlad idea.

  Read the article

• Is there a way in .NET to access the bytecode/IL/CLR that is currently running?

  - by Alix

  Hi. I'd like to have access to the bytecode that is currently running or about to run in order to detect certain instructions and take specific actions (depending the instructions). In short, I'd like to monitor the bytecode in order to add safety control. Is this possible? I know there are some AOP frameworks that notify you of specific events, like an access to a field or the invocation of a method, but I'd like to skip that extra layer and just look at all the bytecode myself, throughout the entire execution of the application. I've already looked at the following questions (...among many many others ;) ):     Preprocessing C# - Detecting Methods     What CLR/.NET bytecode tools exist? as well as several AOP frameworks (although not in great detail, since they don't seem to do quite what I need) and I'm familiar with Mono.Cecil. I appreciate alternative suggestions, but I don't want to introduce the overhead of an AOP framework when what I actually need is access to the bytecode, without all the stuff they add on top to make it more user-friendly (... admittedly very useful stuff when you don't want to go low-level). Thanks :)

  Read the article

• Problem in creating win installer in i

  - by user356108

  Hi Everyone, I am trying to create an executable file (.exe) of iReport with my module included in it. While I run the target the create-iReport-distro-win-installer, I am getting the following error. Note: I am using netbeans 6.5.1 java.io.IOException: Cannot run program "makensis" (in directory "C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src"): CreateProcess error=2, The system cannot find the file specified at java.lang.ProcessBuilder.start(ProcessBuilder.java:459) at java.lang.Runtime.exec(Runtime.java:593) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tools.ant.taskdefs.Execute$Java13CommandLauncher.exec(Execute.java:832) at org.apache.tools.ant.taskdefs.Execute.launch(Execute.java:447) at org.apache.tools.ant.taskdefs.Execute.execute(Execute.java:461) at net.sf.nsisant.Task.execute(Task.java:205) at org.apache.tools.ant.UnknownElement.execute(UnknownElement.java:288) at sun.reflect.GeneratedMethodAccessor97.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tools.ant.dispatch.DispatchUtils.execute(DispatchUtils.java:106) at org.apache.tools.ant.Task.perform(Task.java:348) at org.apache.tools.ant.Target.execute(Target.java:357) at org.apache.tools.ant.Target.performTasks(Target.java:385) at org.apache.tools.ant.Project.executeSortedTargets(Project.java:1337) at org.apache.tools.ant.Project.executeTarget(Project.java:1306) at org.apache.tools.ant.helper.DefaultExecutor.executeTargets(DefaultExecutor.java:41) at org.apache.tools.ant.Project.executeTargets(Project.java:1189) at org.apache.tools.ant.module.bridge.impl.BridgeImpl.run(BridgeImpl.java:273) at org.apache.tools.ant.module.run.TargetExecutor.run(TargetExecutor.java:499) at org.netbeans.core.execution.RunClassThread.run(RunClassThread.java:151) Caused by: java.io.IOException: CreateProcess error=2, The system cannot find the file specified at java.lang.ProcessImpl.create(Native Method) at java.lang.ProcessImpl.<init>(ProcessImpl.java:81) at java.lang.ProcessImpl.start(ProcessImpl.java:30) at java.lang.ProcessBuilder.start(ProcessBuilder.java:452) ... 24 more C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src\build.xml:327: Command failed: 'makensis /DPRODUCT_VERSION=3.7.2 /DPRODUCT_NAME=iReport /DPRODUCT_WEB_SITE=http://ireport.sourceforge.net "C:\Program Files\NetBeans 6.5.1\iReport-3.7.2-src\etc\iReportInstaller.nsi"' BUILD FAILED (total time: 1 minute 22 seconds)

  Read the article

• Far jump in ntdll.dll's internal ZwCreateUserProcess

  - by user49164

  I'm trying to understand how the Windows API creates processes so I can create a program to determine where invalid exes fail. I have a program that calls kernel32.CreateProcessA. Following along in OllyDbg, this calls kernel32.CreateProcessInternalA, which calls kernel32.CreateProcessInternalW, which calls ntdll.ZwCreateUserProcess. This function goes: mov eax, 0xAA xor ecx, ecx lea edx, dword ptr [esp+4] call dword ptr fs:[0xC0] add esp, 4 retn 0x2C So I follow the call to fs:[0xC0], which contains a single instruction: jmp far 0x33:0x74BE271E But when I step this instruction, Olly just comes back to ntdll.ZwCreateUserProcess at the add esp, 4 right after the call (which is not at 0x74BE271E). I put a breakpoint at retn 0x2C, and I find that the new process was somehow created during the execution of add esp, 4. So I'm assuming there's some magic involved in the far jump. I tried to change the CS register to 0x33 and EIP to 0x74BE271E instead of actually executing the far jump, but that just gave me an access violation after a few instructions. What's going on here? I need to be able to delve deeper beyond the abstraction of this ZwCreateUserProcess to figure out how exactly Windows creates processes.

  Read the article

• How to stop MVC caching the results of invoking and action method?

  - by Trey Carroll

  I am experiencing a problem with IE caching the results of an action method. Other articles I found were related to security and the [Authorize] attribute. This problem has nothing to do with security. This is a very simple "record a vote, grab the average, return the avg and the number of votes" method. The only slightly interesting thing about it is that it is invoked via Ajax and returns a Json object. I believe that it is the Json object that is getting catched. When I run it from FireFox and watch the XHR traffic with Firebug, everything works perfectly. However, under IE 8 the "throbber" graphic doesn't ever have time to show up and the page elements that display the "new" avg and count that are being injected into the page with jQuery are never different. I need a way to tell MVC to never cache this action method. This article seems to address the problem, but I cannot understand it: http://stackoverflow.com/questions/1441467/prevent-caching-of-attributes-in-asp-net-mvc-force-attribute-execution-every-tim I need a bit more context for the solution to understand how to extend AuthorizationAttribute. Please address your answer as if you were speaking to someone who lacks a deep understanding of MVC even if that means replying with an article on some basics/prerequisites that are required. Thanks, Trey Carroll

  Read the article

• SQL Server CLR stored procedures in data processing tasks - good or evil?

  - by Gart

  In short - is it a good design solution to implement most of the business logic in CLR stored procedures? I have read much about them recently but I can't figure out when they should be used, what are the best practices, are they good enough or not. For example, my business application needs to parse a large fixed-length text file, extract some numbers from each line in the file, according to these numbers apply some complex business rules (involving regex matching, pattern matching against data from many tables in the database and such), and as a result of this calculation update records in the database. There is also a GUI for the user to select the file, view the results, etc. This application seems to be a good candidate to implement the classic 3-tier architecture: the Data Layer, the Logic Layer, and the GUI layer. The Data Layer would access the database The Logic Layer would run as a WCF service and implement the business rules, interacting with the Data Layer The GUI Layer would be a means of communication between the Logic Layer and the User. Now, thinking of this design, I can see that most of the business rules may be implemented in a SQL CLR and stored in SQL Server. I might store all my raw data in the database, run the processing there, and get the results. I see some advantages and disadvantages of this solution: Pros: The business logic runs close to the data, meaning less network traffic. Process all data at once, possibly utilizing parallelizm and optimal execution plan. Cons: Scattering of the business logic: some part is here, some part is there. Questionable design solution, may encounter unknown problems. Difficult to implement a progress indicator for the processing task. I would like to hear all your opinions about SQL CLR. Does anybody use it in production? Are there any problems with such design? Is it a good thing?

  Read the article

• LINQ - How to query a range of effective dates that only has start dates

  - by itchi

  I'm using C# 3.5 and EntityFramework. I have a list of items in the database that contain interest rates. Unfortunately this list only contains the Effective Start Date. I need to query this list for all items within a range. However, I can't see a way to do this without querying the database twice. (Although I'm wondering if delayed execution with EntityFramework is making only one call.) Regardless, I'm wondering if I can do this without using my context twice. internal IQueryable<Interest> GetInterests(DateTime startDate, DateTime endDate) { var FirstDate = Context.All().Where(x => x.START_DATE < startDate).Max(x => x.START_DATE); IQueryable<Interest> listOfItems = Context.All().Where(x => x.START_DATE >= FirstDate && x.START_DATE <= endDate); return listOfItems; }

  Read the article

• Maven GAE Plugin - Unable to run gae:debug

  - by Taylor L

  I'm having trouble running the gae:debug goal of the Maven GAE Plugin. The error I'm receiving is below. Any ideas? I'm running it with "mvn gae:debug". [INFO] Packaging webapp [INFO] Assembling webapp[test-gae] in [C:\development\test-gae\target\test-gae-0.0.1-SNAPSHOT] [INFO] Processing war project [INFO] Webapp assembled in[56 msecs] [INFO] Building war: C:\development\test-gae\target\test-gae-0.0.1-SNAPSHOT.war [INFO] [statemgmt:end-fork] [INFO] Ending forked execution [fork id: -2101914270] [INFO] [gae:debug] Usage: <dev-appserver> [options] <war directory> Options: --help, -h Show this help message and exit. --server=SERVER The server to use to determine the latest -s SERVER SDK version. --address=ADDRESS The address of the interface on the local machine -a ADDRESS to bind to (or 0.0.0.0 for all interfaces). --port=PORT The port number to bind to on the local machine. -p PORT --sdk_root=root Overrides where the SDK is located. --disable_update_check Disable the check for newer SDK versions. EDIT: gae:run with the jvmFlags option is also giving me the same result with the below configuration. <plugin> <groupId>net.kindleit</groupId> <artifactId>maven-gae-plugin</artifactId> <version>0.5.0</version> <configuration> <jvmFlags> <jvmFlag>-Xdebug</jvmFlag> <jvmFlag>-Xrunjdwp:transport=dt_socket,server=y,suspend=n,address=8000</jvmFlag> </jvmFlags> </configuration> </plugin>

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• SVN commit using cruise control

  - by pratap

  hi all, can any one tell how to tell svn that these files are to be deleted from repository through command line. i am using cruise control to automate the svn commit process. but the execution of svn commit command restores the files which i deleted from my working copy. the way i am doing is. 1. delete some files in my working copy.( no. of files in my WC is less than no. of files in repository) 2. execute svn command using cruise control. <exec executable="svn.exe"> <buildArgs>ci -m "test msg" --no-auth-cache --non-interactive</buildArgs> <buildTimeoutSeconds>1000</buildTimeoutSeconds> </exec> result: the deleted files are restored in my WC... Can someone help me in figuring out where i have gone wrong... or if i have to do some changes / configurations... thank u all. regards. uday

  Read the article

• SVN commit using cruise control

  - by pratap

  hi all, i am using cruise control to automate the svn commit process. but the execution of svn commit command restores the files which i deleted from my working copy. the way i am doing is. 1. delete some files in my working copy.( no. of files in my WC is less than no. of files in repository) 2. execute svn command using cruise control. <exec executable="svn.exe"> <buildArgs>ci -m "test msg" --no-auth-cache --non-interactive</buildArgs> <buildTimeoutSeconds>1000</buildTimeoutSeconds> </exec> result: the deleted files are restored in my WC... Can someone help me in figuring out where i have gone wrong... or if i have to do some changes / configurations... thank u all. regards. uday

  Read the article

• How to completely wipe a previous ClickOnce installation?

  - by Dabblernl

  I have a curious problem: My app is distributed through ClickOnce. I recently installed three new clients on a new location. They worked. After an update however, all old clients worked fine, but the three new clients did not. As my code is swallowing an exception somewhere I have been unable thusfar to pinpoint where the error lies. When I XCopy the latest version of the app to the desktop of the three new client computers the program works fine. So, I thought uninstalling and reinstalling the program from the download location should fix the problem, but it does not! I can think of two explanations: The new location has some firewall/virusscanner in place that doesn't like the latest version of my app when it is run from a standard ClickOnce directory, but it allows execution from the desktop. Some old settings (the app uses user scoped and app scoped settings) remain in effect after the uninstall. When I find and check the user.config file for the app however, I find no incorrect setttings there. Thusfar, I have been unable to reproduce the error on any other machine. How can I solve this!?

  Read the article

< Previous Page | 320 321 322 323 324 325 326 327 328 329 330 331  | Next Page >