Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 34/63 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • Recursion problem in algorithm

    - by Marthin
    I'm not sure if this is the right place to post this, but the problem actually belongs to a programming assignment. Solve the recursion: T(0) = 2; T(n) = T(n-1) + 2; Solution: T(n) = 2(n+1) Could someone please show me how they got to that solution?

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • How is it possible to legally write ::: in C++ and ??? in C#?

    - by daveny
    These questions are a kind of game, and I did not find the solution for them. It is possible to write ::: in C++ without using quotes or anything like this and the compiler will accept it (macros are prohibited too). And the same is true for C# too, but in C#, you have to write ???. I think C++ will use the :: scope operator and C# will use ? : , but I do not know the answers to them. Any idea?

    Read the article

  • java.lang.ClassNotFoundException in Netbeans. 5 hours to fix

    - by user1304281
    Hi I've got to submit an interpreter assignment tonight and all of a sudden it stopped working! It was working yesterday but now when I try to create a class instance at runtime I get classnotfoundexception. My project has no libraries or dependencies, I've written everything myself. I've googled around and it seems to be an issue with classpath but I've had no luck fooling with the project properties on netbeans. Here's some code: package interpreter; import interpreter.bytecode.ByteCode; import java.io.*; import java.lang.reflect.*; class ByteCodeLoader { //.... String codeClass = CodeTable.CodeTable.get(args[0]); ByteCode bytecode = (ByteCode)(Class.forName("interpreter.bytecode."+codeClass).newInstance()); //this throws exception } all of my ByteCodes are contained within a subpackage of interpreter called interpreter.bytecode. I'll be watching this thread so I can answer/clarify any questions immediately. Thanks for your time!

    Read the article

  • C programming - How to print numbers with a decimal component using only loops?

    - by californiagrown
    I'm currently taking a basic intro to C programming class, and for our current assignment I am to write a program to convert the number of kilometers to miles using loops--no if-else, switch statements, or any other construct we haven't learned yet are allowed. So basically we can only use loops and some operators. The program will generate three identical tables (starting from 1 kilometer through the input value) for one number input using the while loop for the first set of calculations, the for loop for the second, and the do loop for the third. I've written the entire program, however I'm having a bit of a problem with getting it to recognize an input with a decimal component. Here is what I have for the while loop conversions: #include <stdio.h> #define KM_TO_MILE .62 main (void) { double km, mi, count; printf ("This program converts kilometers to miles.\n"); do { printf ("\nEnter a positive non-zero number"); printf (" of kilometers of the race: "); scanf ("%lf", &km); getchar(); }while (km <= 1); printf ("\n KILOMETERS MILES (while loop)\n"); printf (" ========== =====\n"); count = 1; while (count <= km) { mi = KM_TO_MILE * count; printf ("%8.3lf %14.3lf\n", count, mi); ++count; } getchar(); } The code reads in and converts integers fine, but because the increment only increases by 1 it won't print a number with a decimal component (e.g. 3.2, 22.6, etc.). Can someone point me in the right direction on this? I'd really appreciate any help! :)

    Read the article

  • How to store multiple variables from a File Input of unknown size in Java?

    - by AlphaOmegaStrife
    I'm a total beginner with my first programming assignment in Java. For our programming assignment, we will be given a .txt file of students like so: 3 345 Lisa Miller 890238 Y 2 <-(Number of classes) Mathematics MTH345 4 A Physics PHY357 3 B Bill Wilton 798324 N 2 English ENG378 3 B Philosophy PHL534 3 A Dandy Goat 746333 Y 1 History HIS101 3 A" The teacher will give us a .txt file on the day of turning it in with a list of unknown students. My problem is: I have a specific class for turning the data from the file into variables to be used for a different class in printing it to the screen. However, I do not know of a good way to get the variables from the input file for the course numbers, since that number is not predetermined. The only way I can think of to iterate over that unknown amount is using a loop, but that would just overwrite my variables every time. Also, the teacher has requested that we not use any JCL classes (I don't really know what this means.) Sorry if I have done a poor job of explaining this, but I can't think of a better way to conceptualize it. Let me know if I can clarify. Edit: public static void analyzeData() { Scanner inputStream = null; try { inputStream = new Scanner(new FileInputStream("Programming Assignment 1 Data.txt")); } catch (FileNotFoundException e) { System.out.println("File Programming Assignment 1 Data.txt could not be found or opened."); System.exit(0); } int numberOfStudents = inputStream.nextInt(); int tuitionPerHour = inputStream.nextInt(); String firstName = inputStream.next(); String lastname = inputStream.next(); String isTuitionPaid = inputStream.next(); int numberOfCourses = inputStream.nextInt(); String courseName = inputStream.next(); String courseNumber = inputStream.next(); int creditHours = inputStream.nextInt(); String grade = inputStream.next(); To show the methods I am using now, I am just using a Scanner to read from the file and for Scanner inputStream, I am using nextInt() or next() to get variables from the file. Obviously this will not work when I do not know exactly how many classes each student will have.

    Read the article

  • Java program grading

    - by pasito15
    I've been working on this program for hours and I can't figure out how to get the program to actually print the grades from the scores Text file public class Assign7{ private double finalScore; private double private_quiz1; private double private_quiz2; private double private_midTerm; private double private_final; private final char grade; public Assign7(double finalScore){ private_quiz1 = 1.25; private_quiz2 = 1.25; private_midTerm = 0.25; private_final = 0.50; if (finalScore >= 90) { grade = 'A'; } else if (finalScore >= 80) { grade = 'B'; } else if (finalScore >= 70) { grade = 'C'; } else if (finalScore>= 60) { grade = 'D'; } else { grade = 'F'; } } public String toString(){ return finalScore+":"+private_quiz1+":"+private_quiz2+":"+private_midTerm+":"+private_final; } } this code compiles as well as this one import java.util.*; import java.io.*; public class Assign7Test{ public static void main(String[] args)throws Exception{ int q1,q2; int m = 0; int f = 0; int Record ; String name; Scanner myIn = new Scanner( new File("scores.txt") ); System.out.println( myIn.nextLine() +" avg "+"letter"); while( myIn.hasNext() ){ name = myIn.next(); q1 = myIn.nextInt(); q2 = myIn.nextInt(); m = myIn.nextInt(); f = myIn.nextInt(); Record myR = new Record( name, q1,q2,m,f); System.out.println(myR); } } public static class Record { public Record() { } public Record(String name, int q1, int q2, int m, int f) { } } } once a compile the code i get this which dosent exactly compute the numbers I have in the scores.txt Name quiz1 quiz2 midterm final avg letter Assign7Test$Record@4bcc946b Assign7Test$Record@642423 Exception in thread "main" java.until.InputMismatchException at java.until.Scanner.throwFor(Unknown Source) at java.until.Scanner.next(Unknown Source) at java.until.Scanner.nextInt(Unknown Source) at java.until.Scanner.nextInt(Unknown Source) at Assign7Test.main(Assign7Test.java:25)

    Read the article

  • How can I match a phone number with a regex? [closed]

    - by Zerobu
    Possible Duplicate: A comprehensive regex for phone number validation I would like a regular expression in this format. It Must match one of the following formats: (###)###-#### ###-###-#### ###.###.#### ########## Strip all whitespace. Make sure it's a valid phone number, then (if necessary) translate it to the first format listed above.

    Read the article

  • single user dungeon

    - by mario estes
    hey dudes, my first question anyway, i have made a single user dungeon and am looking to change it in to a multi user dungoen how can i do this by the way im using python to make the sud in to a mud lol

    Read the article

  • Picking apples off a tree

    - by John Retallack
    I have the following problem: I am given a tree with N apples, for each apple I am given it's weight and height. I can pick apples up to a given height H, each time I pick an apple the height of every apple is increased with U. I have to find out the maximum weight of apples I can pick. 1 = N = 100000 0 < {H, U, apples' weight and height, maximum weight} < 231 Example: N=4 H=100 U=10 height weight 82 30 91 10 93 5 94 15 The answer is 45: first pick the apple with the weight of 15 then the one with the weight of 30. Could someone help me approach this problem?

    Read the article

  • Decrypt PHP encrypted string in C#

    - by NotDan
    I have a string encrypted in PHP that I would like to decrypt in C#. I used the tutorial below to do the encryption, but am having problems decrypting. Can anyone post an example on how to do this? http://www.sanity-free.org/131/triple_des_between_php_and_csharp.html

    Read the article

  • Getter/Setter (composition, Java, HW)

    - by Crystal
    I have one class called Person that basically looks like: public class Person { String firstName; String lastName; String telephone; String email; public Person() { firstName = ""; lastName = ""; telephone = ""; email = ""; } public Person(String firstName, String lastName, String telephone, String email) { this.firstName = firstName; this.lastName = lastName; this.telephone = telephone; this.email = email; } public String getFirstName() { return firstName; } public void setFirstName(String firstName) { this.firstName = firstName; } .... Using that class, I setup an abstract class called Loan that looks like: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId(int nextId) { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount(double loanAmount) { return loanAmount; } private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } I have to extend the Loan class with CarLoan and it looks like: public class CarLoan extends Loan { public CarLoan(Person client, double vehiclePrice, double downPayment, double salesTax, double interestRate, CAR_LOAN_TERMS length) { super.setClient(client); super.setInterestRate(interestRate); this.client = client; this.vehiclePrice = vehiclePrice; this.downPayment = downPayment; this.salesTax = salesTax; this.length = length; } public void setVehiclePrice(double vehiclePrice) { this.vehiclePrice = vehiclePrice; } public double getVehiclePrice() { return vehiclePrice; } public void setDownPayment(double downPayment) { this.downPayment = downPayment; } public double getDownPayment() { return downPayment; } public void setSalesTax(double salesTax) { this.salesTax = salesTax; } public double getSalesTax() { return salesTax; } public String toString() { return getClass().getName() + "[vehiclePrice = " + vehiclePrice + '\n' + "downPayment = " + downPayment + '\n' + "salesTax = " + salesTax + "]"; } public enum CAR_LOAN_TERMS {TWO_YEAR, THREE_YEAR, SIX_YEAR}; private double vehiclePrice; private double downPayment; private double salesTax; Few questions. (a) Is what I did in the Loan class to setClient correct given what I have in the Person class? (e.g.this.client = client) (b) Can I call super twice in a method? I have to set two attributes from the Loan class from the constructor in the CarLoan class and I thought that would be a way to do it. (c) Do you have to set attributes for enumeration types differently in a constructor or getter/setter methods? I get an error for (this.length = length) in my CarLoan class and I was unsure of how enumeration values should be set. Thanks!

    Read the article

  • Help with shopping cart in javascript

    - by user228390
    Hey guys, I'm having problems with my shopping cart. What I am trying to do is make a function that will add an item the cart and then and function that will view the cart and show the details. But what I have got so far does not do that, it just simply adds and goes straight to view cart. Also I wanted to store the name of each items in different global arrays (name, price and sum) but I can't get it work that way. Can any help me overcome this problem? Edit: I've tried to get it to work by adding some more items and attaching it to another html page, but now the code does not seem to work at all , before it showed the price and total and now I get nothing . javascript code function round_total (c) { var pennies = c * 100; pennies = Math.round(pennies); var strPennies = "" + pennies; var len = strPennies.length; return parseFloat(strPennies.substring(0, len - 2) + "." + strPennies.substring(len - 2, len)); } // End of round_total function. /* Start of generate_page function. */ function generate_page (form) { tax = 0.08; delivery_p = 2.99; var odate = new Date(); var qty = form.quantity.value; var product_v = new String(form.product.value); var total_price = product_v.substr(product_v.indexOf("$") + 1, product_v.length - product_v.indexOf("$")); var price_without_tax = round_total(qty * total_price); var ttax = round_total(price_without_tax * tax); var delivery = round_total(qty * delivery_p); var total_p = round_total(price_without_tax + ttax + delivery); document.writeln("Quantity: " + qty + "<br>"); document.writeln("Price: $" + total_price + "<br>"); document.writeln("Delivery: $" + delivery + "<br>"); document.writeln("Total: $" + total_p + "<br>"); document.writeln("Order placed on: " + odate.toGMTString()); } function calculate() { round_total (c)(); generate_page (form)(); } HTML code: Shopping cart Welcome, Guest Login Sign Up Stay Updated: Subscribe via RSS Email Updates <div id="header"> <div id="branding" class="container"> <h1>The Finest Toy<br /> Store Online</h1> <p class="desc">If you're looking for a toy shop then look no further.<br/> Go on, treat the kids with our huge selection of<br/>online toy shops selling toys for all ages.</p> </div><!-- end branding --> <div id="navigation"> <ul id="menu" class="container"> <li><a href="#">HOME</a></li> <li><a href="#">ABOUT</a></li> <li><a href="#">Online Store</a></li> <li><a href="#">CONTACT</a></li> </ul> </div><!-- end navigation --> </div><!-- end header --> Shopping Cart Nintendo DS Xbox Product: Console £149.99 Console + Games £169.99 Quantity: Product: Console £149.99 Console + Games £169.99 Quantity:     Playstation 3 Wii Product: Console £149.99 Console + Games £169.99 Quantity:   Product: Console £149.99 Console + Games £169.99 Quantity:        <input type="submit" value="Add to cart" name="submit" onClick="cart()";/><input , type="reset" value="Reset" name="reset" Copyright © 2010 shopping cart. Content and Header © |Back to top Do I need to show my CSS as well? (Sorry about the coding its not working properly for me, its not showing up the way it should be)

    Read the article

  • A two player game over the intranet..

    - by Santwana
    Hi everybody.. I am a student of 3rd year engineering and only a novice in my programming skills. I need some help with my project.. I wish to develop a two player game to be played over the network (Intranet). I want to develop a simple website with a few html pages for this.My ideas for the project run as follows: 1.People can log in from different systems and check who ever is online on the network currently. the page also shows who is playing with whom. 2.If a person is interested in playing with a player who is currently online, he sends a request of which the other player is somehow notified( using a message or an alert on his profile page..) 3.If the player accepts the request, a game is started. This is exactly where I am clueless.. How can I make them play the game? I need to develop a turn based game with two players, eg chessboard.. how can I do this? The game has to be played live.. and it is time tracked. i need your help with coding the above.. the other features i wish to include are: 4.The game could not be abruptly terminated by any one if the users.The request to terminate the game should be sent to the other player first and only if he accepts can the game be terminated. Whoever wins the game would get a plus 10 on their credit and if he terminated he gets a minus 10. The credits remains constant even if he loses but the success percentage is reduced. 6.The player with highest winning percentage is projected as the player of the week on the home page and he can post a challenge to all others.. I only have an intermediate knowledge of core java and know the basics of Swing and Awt. I am not at all familiar with networking in java right now. I have 5 to 6 weeks of time for developing the project but I hope to learn the things before I start my project. i would prefer to use a lan to illustrate the project and I know only java,jsp,oracle,html and bit of xml to develop my proj. Also I wish to know if I can code this within 6 weeks, would it be too difficult or complicated? Please spare some time to tell me. Please.. please.. I need your suggestions and help.. thank you so much..

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >