Search Results

Search found 1552 results on 63 pages for 'homework'.

Page 36/63 | < Previous Page | 32 33 34 35 36 37 38 39 40 41 42 43  | Next Page >

  • overflow technique in stack

    - by metashockwave
    int main(void) { problem2(); } void doit2(void) { int overflowme[16]; //overflowme[37] =0; } void problem2(void) { int x = 42; doit2(); printf("x is %d\n", x); printf("the address of x is 0x%x\n", &x); } Would someone help me understand why overflowme[37] =0; from the doit2 function will overwrite the value of x? (please include Program Counter and Frame Pointer of the function doit2 in your explanation) Thank you! It works every time with Project properties-Configuration properties-C/C++ -Code Generation-Basic Runtime Checks set to "Default". so it's not an undefined behavior.

    Read the article

  • How can I match a phone number with a regex? [closed]

    - by Zerobu
    Possible Duplicate: A comprehensive regex for phone number validation I would like a regular expression in this format. It Must match one of the following formats: (###)###-#### ###-###-#### ###.###.#### ########## Strip all whitespace. Make sure it's a valid phone number, then (if necessary) translate it to the first format listed above.

    Read the article

  • problem with join SQL Server 2000

    - by eyalb
    I have 3 tables - Items, Props, Items_To_Props i need to return all items that match all properties that i send example items 1 2 3 4 props T1 T2 T3 items_to_props 1 T1 1 T2 1 T3 2 T1 3 T1 when i send T1,T2 i need to get only item 1

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

  • What is the purpose of this string argument in a JavaScript function?

    - by Adel
    In the following function, there is the line: var username=getCookie("username"); Here's the whole function: function checkCookie() { var username=getCookie("username"); if (username!=null && username!="") { alert("Welcome again " + username); } else { username=prompt("Please enter your name:",""); if (username!=null && username!="") { setCookie("username",username,365); } } What is the point of the "username" argument being passed above? function getCookie(c_name) { var i,x,y,ARRcookies=document.cookie.split(";"); for (i=0;i<ARRcookies.length;i++) { x=ARRcookies[i].substr(0,ARRcookies[i].indexOf("=")); y=ARRcookies[i].substr(ARRcookies[i].indexOf("=")+1); x=x.replace(/^\s+|\s+$/g,""); if (x==c_name) { return unescape(y); } } } The whole code is here Thanks!

    Read the article

  • Returnimng collection of interfaces

    - by apoorv020
    I have created the following interface public interface ISolutionSpace { public boolean isFeasible(); public boolean isSolution(); public Set<ISolutionSpace> generateChildren(); } However, in the implementation of ISolutionSpace in a class called EightQueenSolutionSpace, I am going to return a set of EightQueenSolutionSpace instances, like the following stub: @Override public Set<ISolutionSpace> generateChildren() { return new HashSet<EightQueenSolutionSpace>(); } However this stub wont compile. What changes do I need to make? EDIT: I tried 'HashSet' as well and had tried using the extends keyword. However since 'ISolutionSpace' is an interface and EightQueenSolutionSpace is an implementation(and not a subclass) of 'ISolutionSpace', it is still not working.

    Read the article

  • help implementing algorithm

    - by davit-datuashvili
    http://en.wikipedia.org/wiki/All_nearest_smaller_values this is site of the problem and here is my code but i have some trouble to implement it import java.util.*; public class stack{ public static void main(String[]args){ int x[]=new int[]{ 0, 8, 4, 12, 2, 10, 6, 14, 1, 9, 5, 13, 3, 11, 7, 15 }; Stack<Integer> st=new Stack<Integer>(); for (int a:x){ while (!st.empty() && st.pop()>=a){ System.out.println( st.pop()); if (st.empty()){ break; } else{ st.push(a); } } } } } and here is pseudo code from site S = new empty stack data structure for x in the input sequence: while S is nonempty and the top element of S is greater than or equal to x: pop S if S is empty: x has no preceding smaller value else: the nearest smaller value to x is the top element of S push x onto S

    Read the article

  • help implementing All Nearest Smaller Values algorithm

    - by davit-datuashvili
    http://en.wikipedia.org/wiki/All_nearest_smaller_values this is site of the problem and here is my code but i have some trouble to implement it import java.util.*; public class stack{ public static void main(String[]args){ int x[]=new int[]{ 0, 8, 4, 12, 2, 10, 6, 14, 1, 9, 5, 13, 3, 11, 7, 15 }; Stack<Integer> st=new Stack<Integer>(); for (int a:x){ while (!st.empty() && st.pop()>=a){ System.out.println( st.pop()); if (st.empty()){ break; } else{ st.push(a); } } } } } and here is pseudo code from site S = new empty stack data structure for x in the input sequence: while S is nonempty and the top element of S is greater than or equal to x: pop S if S is empty: x has no preceding smaller value else: the nearest smaller value to x is the top element of S push x onto S

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to turn this simple 10 digit hex number back into 8 digits?

    - by Babil
    The algorithm to convert input 8 digit hex number into 10 digit are following: Given that the 8 digit number is: '12 34 56 78' x1 = 1 * 16^8 * 2^3 x2 = 2 * 16^7 * 2^2 x3 = 3 * 16^6 * 2^1 x4 = 4 * 16^4 * 2^4 x5 = 5 * 16^3 * 2^3 x6 = 6 * 16^2 * 2^2 x7 = 7 * 16^1 * 2^1 x8 = 8 * 16^0 * 2^0 Final 10 digit hex is: = x1 + x2 + x3 + x4 + x5 + x6 + x7 + x8 = '08 86 42 98 E8' The problem is - how to go back to 8 digit hex from a given 10 digit hex (for example: 08 86 42 98 E8 to 12 34 56 78) Some sample input and output are following: input output 11 11 11 11 08 42 10 84 21 22 22 33 33 10 84 21 8C 63 AB CD 12 34 52 D8 D0 88 64 45 78 96 32 21 4E 84 98 62 FF FF FF FF 7B DE F7 BD EF

    Read the article

  • Codesample with bufferoverflow (gets method). Why does it not behave as expected?

    - by citronas
    This an extract from an c program that should demonstrate a bufferoverflow. void foo() { char arr[8]; printf(" enter bla bla bla"); gets(arr); printf(" you entered %s\n", arr); } The question was "How many input chars can a user maximal enter without a creating a buffer overflow" My initial answer was 8, because the char-array is 8 bytes long. Although I was pretty certain my answer was correct, I tried a higher amount of chars, and found that the limit of chars that I can enter, before I get a segmentation fault is 11. (Im running this on A VirtualBox Ubuntu) So my question is: Why is it possible to enter 11 chars into that 8 byte array?

    Read the article

  • question about missing element in array

    - by davit-datuashvili
    i have following problem from book introduction algorithm second edition by MIT university problem is following An array A[1 . . n] contains all the integers from 0 to n except one. It would be easy to determine the missing integer in O(n) time by using an auxiliary array B[0 . . n] to record which numbers appear in A. In this problem, however, we cannot access an entire integer in A with a single operation. The elements of A are represented in binary, and the only operation we can use to access them is “fetch the j th bit of A[i],” which takes constant time. Show that if we use only this operation, we can still determine the missing inte- ger in O(n) time please help

    Read the article

  • Is it possible to call the main(String[] args) after catching an exception?

    - by Jason
    I'm working on a Serpinski triangle program that asks the user for the levels of triangles to draw. In the interests of idiot-proofing my program, I put this in: Scanner input= new Scanner(System.in); System.out.println(msg); try { level= input.nextInt(); } catch (Exception e) { System.out.print(warning); //restart main method } Is it possible, if the user punches in a letter or symbol, to restart the main method after the exception has been caught?

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • circular shift c

    - by simion
    I am doing some past papers and noticed a question where i have to shift the int one place to the right and return it i no in java i can just return n 1; is this possible in c? or is there a typically more compelx way of doing it :D. The method we were given is as follows // Return n after a right circular 1-bit shift unsigned int right_circular_shift_1(unsigned int n) {

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

< Previous Page | 32 33 34 35 36 37 38 39 40 41 42 43  | Next Page >