Search Results

Search found 25401 results on 1017 pages for 'adobe partner program'.

Page 343/1017 | < Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >

  • Couchdb conflict resolution

    - by Sundar
    How does CouchDB handles conflicts while doing bi-directional replication? For example: Lets say there are two address book databases (in server A and B). There is a document for Jack which contains contact details of Jack. Server A and B are replicated and both have the same version of Jack document. In server A, Jack's mobile no is updated. In server B, Jack's address is updated. Now when we do bi-directional replication there is a conflict. How does couchDB handles it? If we initiate replication in a Java program, is there a way to know whether there were any conflicts from the java program?

    Read the article

  • OnExit is not entering via PostSharp in asp.net project.

    - by mark smith
    Hi there, I have setup PostSharp and it appears to be working but i don't get it entering OnExit (i have logged setup to ensure it is working) ... Its a bit tricky to configure with asp.net - or is it just me ... I am using the 1.5 new version I basically have the following in my web.config and i had to add the SearchPath otherwise it can't find my assemblies <postsharp directory="C:\Program Files\PostSharp 1.5" trace="true"> <parameters> <!--<add name="parameter-name" value="parameter-value"/>--> </parameters> <searchPath> <!-- Always add the binary folder to the search path. --> <add name="bin" value="~\bin"/> </searchPath> </postsharp> I have set tracing on but what is strange to me is that it appears to build to the temp directory, maybe this is my issue, i am unsure .. hence i do F5 ... Is it possible to name the Output directory and output file?? As you can see it is editing a DLL in the temp dir so IIS is no longer in control so it doesn't execute it ??? Confused! :-) C:\Program Files\PostSharp 1.5\postsharp.exe "/P:Output=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" "/P:IntermediateDirectory=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp " /P:CleanIntermediate=False /P:ReferenceDirectory=. /P:SignAssembly=False /P:PrivateKeyLocation= /P:ResolvedReferences= "/P:SearchPath=C:\Source Code\Visual Studio 2008\Projects\mysitemvc\mysitemvc\bin," /V /SkipAutoUpdate "C:\Program Files\PostSharp 1.5\Default.psproj" "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\before-postsharp\App_Web_04ae3ewy.dll" PostSharp 1.5 [1.5.6.627] - Copyright (c) Gael Fraiteur, 2005-2009. info PS0035: C:\Windows\Microsoft.NET\Framework\v2.0.50727\ilasm.exe "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.il" /QUIET /DLL /PDB "/RESOURCE=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.res" "/OUTPUT=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" /SUBSYSTEM=3 /FLAGS=1 /BASE=18481152 /STACK=1048576 /ALIGNMENT=512 /MDV=v2.0.50727

    Read the article

  • Linking with Boost error

    - by drhorrible
    I just downloaded and ran the boost installer for version 1.42 (from boostpro.com), and set up my project according to the getting started guide. However, when I build the program, I get this linker error: LINK : fatal error LNK1104: cannot open file 'libboost_program_options-vc90-mt-gd-1_42.lib' The build log adds this (I've replaced project-specific paths with *'s): Creating temporary file "******\Debug\RSP00001252363252.rsp" with contents [ /OUT:"*********.exe" /INCREMENTAL /LIBPATH:"C:\Program Files\boost\boost_1_42_0\lib" /MANIFEST /MANIFESTFILE:"Debug\hw6.exe.intermediate.manifest" /MANIFESTUAC:"level='asInvoker' uiAccess='false'" /DEBUG /PDB:"********\Debug\***.pdb" /SUBSYSTEM:CONSOLE /DYNAMICBASE /NXCOMPAT /MACHINE:X86 kernel32.lib user32.lib gdi32.lib winspool.lib comdlg32.lib advapi32.lib shell32.lib ole32.lib oleaut32.lib uuid.lib odbc32.lib odbccp32.lib ".\Debug\****.obj" ".\Debug\****.exe.embed.manifest.res" ] Creating command line "link.exe @********\Debug\RSP00001252363252.rsp /NOLOGO /ERRORREPORT:PROMPT" I've also emailed [email protected] (with a message very similar to this), but I thought maybe so would be faster.

    Read the article

  • How can I flush the output of disp in Octave?

    - by Nathan Fellman
    I have a program in Octave that has a loop - running a function with various parameters, not something that I can turn into matrices. At the beginning of each iteration I print the current parameters using disp. The first times I ran it I had a brazillion warnings, and then I also got these prints. Now that I cleaned them up, I no longer see them. My guess is that they're stuck in a buffer, and I'll see them when the program ends or the buffer fills. Is there any way to force a flush of the print buffer so that I can see my prints?

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • c# Properties.Settings.Default Doesn't work as expected

    - by Jack
    I've been working on a program to automate my backup checks with LogMeIn backup (a windows forms based program). I now need a way to store user settings, to save information easily. I've never worked with the Application/User settings that is somewhat "built-in" - and decided to try it, but ran into problems. I added four settings for now: IncludeCriteria (Specialized.StringCollection) ExcludeCriteria (Specialized.StringCollection) ReportPath (string) ReportType (int) But the behavior doesn't act as expected (go figure). After saving some values in my program, I go back into edit/view my settings values using the VS 2008 settings editor. None of my values are stored. While I think this may be because those values are just default values, wouldn't that be where they can be stored/read/changed? Here is my load form code (still very unrefined): private void setupForm() { txtPath.Text = BackupReport.Properties.Settings.Default.ReportPath == null ? "" : BackupReport.Properties.Settings.Default.ReportPath; if (BackupReport.Properties.Settings.Default.ReportType == 0) { radioHTML.Checked = true; } else radioExcel.Checked = true; if (BackupReport.Properties.Settings.Default.IncludeCriteria.Count > 0) { listIncludeCriteria.DataSource = Properties.Settings.Default.IncludeCriteria; //foreach (string s in Properties.Settings.Default.IncludeCriteria) // listIncludeCriteria.Items.Add(s); } if (BackupReport.Properties.Settings.Default.ExcludeCriteria.Count > 0) { listExcludeCriteria.DataSource = BackupReport.Properties.Settings.Default.ExcludeCriteria; //foreach (string s in Properties.Settings.Default.ExcludeCriteria) // listExcludeCriteria.Items.Add(s); } } listIncludeCriteria is just a listbox. When the user saves I call this method: private void saveSettings() { //var settings = BackupReport.Properties.Settings; if (txtPath.Text != "") { BackupReport.Properties.Settings.Default.ReportPath = txtPath.Text; } if (listIncludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.IncludeCriteria = (StringCollection)listIncludeCriteria.Items.AsQueryable(); foreach (var i in listIncludeCriteria.Items) { if (!isIncludeDuplicate(i.ToString())) BackupReport.Properties.Settings.Default.IncludeCriteria.Add(i.ToString()); } } if (listExcludeCriteria.Items.Count > 0) { //BackupReport.Properties.Settings.Default.ExcludeCriteria = (StringCollection)listExcludeCriteria.Items.AsQueryable(); foreach (var i in listExcludeCriteria.Items) { if (!isExcludeDuplicate(i.ToString())) Properties.Settings.Default.ExcludeCriteria.Add(i.ToString()); } } if (radioExcel.Checked == true) BackupReport.Properties.Settings.Default.ReportType = 1; else BackupReport.Properties.Settings.Default.ReportType = 0; BackupReport.Properties.Settings.Default.Save(); //Properties.Settings.Default.Save(); this.DialogResult = DialogResult.OK; this.Close(); } The wierd thing is when the form loads, the path I put in the first time seems to come up (ReportPath) - even the listBoxes are populated with a bunch of crap I put in - yet I cant find these values anywhere. Any help would be appreciated! Josh

    Read the article

  • Undefined variable from import when using wxPython in pydev

    - by Bibendum
    I just downloaded wxPython, and was running some of the sample programs from here. However, on every line that uses a variable from wx.*, I get a "Undefined variable from import error" For example, the following program generates five errors on lines 1,4,8, and two on line 5: import wx class MyFrame(wx.Frame): """ We simply derive a new class of Frame. """ def __init__(self, parent, title): wx.Frame.__init__(self, parent, title=title, size=(200,100)) self.control = wx.TextCtrl(self, style=wx.TE_MULTILINE) self.Show(True) app = wx.App(False) frame = MyFrame(None, 'Small editor') app.MainLoop() The program, however, compiles and runs perfectly. I haven't made any significant modifications to pydev or eclipse, and the wxPython install is fresh.

    Read the article

  • Let’s Get Social

    - by Kristin Rose
    v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} You can try to run from it like a bad Facebook picture but you can’t hide. Social media as we know it is quickly taking over our lives and is not going away any time soon. Though attempting to reach as many Twitter followers as Lady Gaga is daunting, learning how to leverage social media to meet your customer’s needs is not. For Oracle, this means interacting directly with our partners through our many social media outlets, and refraining from posting a mindless status on the pastrami on rye we ate for lunch today… though it was delicious. The “correct” way to go about social media is going to mean something different to each company. For example, sending a customer more than one friend request a day may not be the best way to get their attention, but using social media as a two-way marketing channel is. Oracle’s Partner Business Center’s (PBC) twitter handle was recently mentioned by Elateral as the “ideal way to engage with your market and use social media in the channel”. Why you ask? Because the PBC has two named social media leads manning the Twitter feed at all times, helping partners get the information and answers they need more quickly than a Justin Bieber video gone viral. So whether you want to post a video of your favorite customer attempting the Marshmallow challenge or tweet like there’s no tomorrow, be sure to follow @OraclePartnerBiz today, and see how they can help you achieve your next partner milestone with Oracle. Happy Socializing, The OPN Communications Team v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • 'dxerr9.h': No such file or directory

    - by numerical25
    I am trying to compile a program I took off a cd from a book that uses directx to render 3d objects. when i press compile I get the following error C1083: Cannot open include file: 'dxerr9.h': No such file or directory I am using VC++ 2008 Express Edition and i am running off of Vista. I went to the following folder C:\Program Files\Microsoft SDKs\Windows\v6.0A\Include and I was not able to find the header there. Unless I am looking in the wrong place. When I initially installed DX sdk I allowed the installer to put everything in a default location. I am not sure If I am looking in the right places or what.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • Why do I get a null pointer exception from TabWidget?

    - by rushinge
    I'm writing an android program in which I have an activity that uses tabs. The Activity public class UnitActivity extends TabActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TabHost tabHost = getTabHost(); TabSpec spec; Resources res = getResources(); LayoutInflater.from(this).inflate(R.layout.unit_view, tabHost.getTabContentView(), true); spec = tabHost.newTabSpec("controls"); spec.setIndicator("Control", res.getDrawable(R.drawable.ic_tab_equalizer)); spec.setContent(R.id.txtview); tabHost.addTab(spec); } } The XML referenced by R.layout.unit_view <?xml version="1.0" encoding="utf-8"?> <TabHost xmlns:android="http://schemas.android.com/apk/res/android" android:id="@android:id/tabhost" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TabWidget android:id="@android:id/tabs" android:layout_width="fill_parent" android:layout_height="wrap_content"/> <FrameLayout android:id="@android:id/tabcontent" android:layout_width="fill_parent" android:layout_height="fill_parent" android:padding="5dp"> <TextView android:id="@+id/txtview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:gravity="bottom" android:text="nullpointer this!" /> </FrameLayout> </LinearLayout> </TabHost> As far as I can see I'm doing the same thing I see in the tabs1 api sample from the android sdk. I've tried "getLayoutInflator()" instead of "LayoutInflator.from(this)" with the same result. If I replace the LayoutInflater line with "setContentView(R.layout.unit_view)" my program doesn't crash with a null pointer exception but my content is completely blank and empty. I get the tab and that's it. I've checked to make sure R.layout.unit_view and tabHost are not null when it runs the LayoutInflater line and they seem to be fine. They're defenitely not null. I've also checked to make sure LayoutInflater.from(this) returns a valid layout inflater object and it does. The logcat indicating the error says E/AndroidRuntime( 541): java.lang.NullPointerException E/AndroidRuntime( 541): at android.widget.TabWidget.dispatchDraw(TabWidget.java:206) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1531) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.ViewGroup.drawChild(ViewGroup.java:1529) E/AndroidRuntime( 541): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1258) E/AndroidRuntime( 541): at android.view.View.draw(View.java:6538) E/AndroidRuntime( 541): at android.widget.FrameLayout.draw(FrameLayout.java:352) E/AndroidRuntime( 541): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1830) E/AndroidRuntime( 541): at android.view.ViewRoot.draw(ViewRoot.java:1349) E/AndroidRuntime( 541): at android.view.ViewRoot.performTraversals(ViewRoot.java:1114) E/AndroidRuntime( 541): at android.view.ViewRoot.handleMessage(ViewRoot.java:1633) E/AndroidRuntime( 541): at android.os.Handler.dispatchMessage(Handler.java:99) E/AndroidRuntime( 541): at android.os.Looper.loop(Looper.java:123) E/AndroidRuntime( 541): at android.app.ActivityThread.main(ActivityThread.java:4363) E/AndroidRuntime( 541): at java.lang.reflect.Method.invokeNative(Native Method) E/AndroidRuntime( 541): at java.lang.reflect.Method.invoke(Method.java:521) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) E/AndroidRuntime( 541): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) E/AndroidRuntime( 541): at dalvik.system.NativeStart.main(Native Method) I/Process ( 61): Sending signal. PID: 541 SIG: 3 I/dalvikvm( 541): threadid=7: reacting to signal 3 I/dalvikvm( 541): Wrote stack trace to '/data/anr/traces.txt' Anybody have any idea how I can get this content into a tab without crashing my application? My actual program is more complex and has more than one tab but I simplified it down to this in an attempt to find out why it's crashing but it still crashes and I don't know why. If I don't use LayoutInflator my program doesn't crash but I don't get any content either, just tabs.

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • New OFM versions released SOA Suite 11.1.1.4 &amp; BPM 11.1.1.4 &amp; JDeveloper 11.1.1.4 WebLogic on JRockit 10.3.4 feedback from the community

    - by Jürgen Kress
    Oracle SOA Suite 11g Installations This is the latest release of the Oracle SOA Suite 11g. Please see the Documentation tab for Release Notes, Installation Guides and other release specific information. Please also see the List of New Features and Samples provided for this release. Release 11gR1 (11.1.1.4.0) Microsoft Windows (32-bit JVM) Linux (32-bit JVM) Generic Oracle JDeveloper 11g Rel 1 (11.1.1.x) (JDeveloper + ADF) Integrated development environment certified on Windows, Linux, and Macintosh. License is free (read the Pricing FAQ). Studio Edition for Windows (1.2 GB) | Studio Edition for Linux (1.3 GB) | See All See Additional Development Tools Oracle WebLogic Server 11g Rel 1 (10.3.4) Installers The WebLogic Server installers include Oracle Coherence and Oracle Enterprise Pack for Eclipse and supports development with other Fusion Middleware products . The zip includes WebLogic Server only and is intended for WebLogic Server development only. Linux x86 (1.1 GB) | Windows x86 (1 GB) Zip for Windows x86, Linux x86, Mac OS X (316 MB) | See All Oracle WebLogic Server 11gR1 (10.3.4) on JRockit Virtual Edition Download For additional downloads please visit the Oracle Fusion Middleware Products Update Center Share your feedback with the @soacommunity on twitter SOASimone Simone Geib SOA Suite 11gR1 (11.1.1.4.0) has just been released: http://www.oracle.com/technetwork/middleware/soasuite/downloads/index.html gschmutz gschmutz My new blog post: WebLogic Server, JDev, SOA, BPM, OSB and CEP 11.1.1.4 (PS3) available! - http://tinyurl.com/4negnpn simon_haslam Simon Haslam I'm very pleased to see WLS 10.3.4 for JRockit VE launched at the same time as the rest of PS3 http://j.mp/gl1nQm (32bit anyway) lucasjellema Lucas Jellema See http://www.oracle.com/ocom/groups/public/@otn/documents/webcontent/156082.xml for PS3 extension downloads BPM, SOA Editor, WebCenter demed demed List of new features in @OracleSOA 11gR1 PS3: http://bit.ly/fVRwsP is not extremely long but huge release by # of bugs fixed. Go! biemond Edwin Biemond WebLogic 10.3.4 new features http://bit.ly/f7L1Eu Exalogic Elastic Cloud , JPA2 , Maven plugin, OWSM policies on WebLogic SCA applications JDeveloper JDeveloper & ADF JDeveloper and Oracle ADF 11g Release 1 Patch Set 3 (11.1.1.4.0): New Features and Bug Fixes http://bit.ly/feghnY simon_haslam Simon Haslam WebLogic Server 10.3.4 (i.e. 11gR1 PS3) available now too http://bit.ly/eeysZ2 JDeveloper JDeveloper & ADF Share your impressions on the new JDeveloper 11g Patchset 3 release that came out today! Download it here: http://bit.ly/dogRN8 VikasAatOracle Vikas Anand SOA Suite 11gR1PS3 is Hotpluggable ...see list of features that @Demed posted..#soa #soacommunity   New versions of Oracle Fusion Middleware 11g R1 (11.1.1.4.x)  include: Oracle WebLogic Server 11g R1 (10.3.4) Oracle SOA Suite 11g R1 (11.1.1.4.0) Oracle Business Process Management 11g R1 (11.1.1.4.0) Oracle Complex Event Processing 11g R1 (11.1.1.4.0) Oracle Application Integration Architecture Foundation Pack 11g R1 (11.1.1.4.0) Oracle Service Bus 11g R1 (11.1.1.4.0) Oracle Enterprise Repository 11g R1 (11.1.1.4.0) Oracle Identity Management 11g R1 (11.1.1.4.0) Oracle Enterprise Content Management 11g R1 (11.1.1.4.0) Oracle WebCenter 11g R1 (11.1.1.4.0) - coming soon Oracle Forms, Reports, Portal & Discoverer 11g R1 (11.1.1.4.0) Oracle Repository Creation Utility 11g R1 (11.1.1.4.0) Oracle JDeveloper & Application Development Runtime 11g R1 (11.1.1.4.0) Resources Download  (OTN) Certification Documentation   New Features in Oracle SOA Suite 11g Release 1 (11.1.1.4.0) Updated: January, 2011 Go to Oracle SOA Suite 11g Doc Introduction Oracle SOA Suite 11gR1 (11.1.1.4.0) includes both bug fixes as well as new features listed below - click on the title of each feature for more details. Downloads, documentation links and more information on the Oracle SOA Suite available on the SOA Suite OTN page and as always, we welcome your feedback on the SOA OTN forum. New in Oracle SOA Suite in this release BPEL Component BPEL 2.0 support in JDeveloper The BPEL editor in JDeveloper now generates BPEL 2.0 code and introduces several new activities. Augmented XML variables auto-initialization capabilities The XML variable auto-initialization capabilities have been enhanced to support two need additional use cases: to initialize the to-spec node if it doesn't exist during the rule and to initialize array elements. New Assign Activity dialog The new Assign Activity supports the same drag & drop paradigm used for the XSLT mapper, greatly streamlining the task of assigning multiple variables. Mediator Component Time window parameter for the resequencer This new parameter lets users initiate a best-effort resequencing based on a time window rather than a number of messages. Support for attachments in the Mediator assign dialog The Mediator assign dialog now supports attachment, enabling usage of the Mediator to transmit attachments even if source and target schemas are different. Adapters & Bindings ChunkSize property added to the File Adapter header properties The ChunkSize property of the File Adapter is now available as a header property, allowing in-process modification of the value for this property. Improved support for distributed WLS JMS topics though automatic rebalancing of listeners The JMS Adapter has been enhanced to subscribe to administrative events from WLS JMS. Based on these events, it dynamically rebalances listeners when there are changes to the members of a local or remote WLS JMS distributed destination. JDeveloper configuration wizard for custom JCA adapters A new wizard is available in JDeveloper to configure custom-built adapters Administration & Enterprise Manager Enhanced purging capabilities to manage database growth Historical instance data can now be purged using three different strategies: batch script, scheduled batch script or data partitioning. Asynchronous bulk instance deletion in Enterprise Manager Bulk deletion of instances in Enterprise Manager now executes as an asynchronous operation in Enterprise Manager, returning control to the user as soon as the action has been submitted and acknowledged. B2B Ability to schedule partner downtime This feature allows trading partners to notify each other about planned downtime and to delay delivery of messages during that period. Message sequencing B2B now supports both inbound and outbound message sequencing. Simplified BAM integration with B2B B2B ships with various pre-configured artifacts to simplify monitoring in BAM. Instance Message Java API for B2B The new instance message Java API supports programmatic access to B2B instance message data. Oracle Service Bus (OSB) Certification of the File and FTP JCA Adapters The File and FTP JCA adapters are now certified for use with Oracle Service Bus (in addition to the native transports). Security enhancements Oracle Service Bus now supports SAML 2.0 as well as the OWSM authorization policies. Check the Oracle Service Bus 11.1.1.4 Release Notes for a complete list of new features. Installation, Hot-Pluggability & Certifications Ability to run Oracle SOA Suite on IBM WebSphere Application Server Oracle SOA Suite can now be deployed on IBM WebSphere Application Server Network Deployment (ND) 7.0.11 and IBM WebSphere Application Server 7.0.11. Single JVM developer installation template Oracle SOA Suite can now be targeted to the WebLogic admin server - there is no requirement to also have a managed server. This topology is intended to minimize the memory foorprint of development environments. This is in addition to the list of supported browsers, operating systems and databases already certified in prior releases. Complex Event Processing (CEP) IDE enhancements This release introduces several enhancements to the development IDE, such as adapter wizards and event-type repository. CQL enhancements CQL enhancements include JDBC data cartridges and parametrized queries. Tracing and injecting events in the Event Processing Network (EPN) In the development environment you can now trace and inject events. Check the Oracle CEP 11.1.1.4 Release Notes for a complete list of new features. SOA Suite page on OTN For more information on SOA Specialization and the SOA Partner Community please feel free to register at www.oracle.com/goto/emea/soa (OPN account required) Blog Twitter LinkedIn Mix Forum Wiki Website Technorati Tags: SOA Suite 11.1.1.4,JDeveloper 11.1.1.4,WebLogic 10.3.4,JRockit 10.3.4,SOA Community,Oracle,OPN,SOA,Simone Geib,Guido Schmutz,Edwin Biemond,Lucas Jellema,Simon Haslam,Demed,Vikas Anand,Jürgen Kress

    Read the article

  • MIDL2003 Error in VC6 project

    - by graham.reeds
    While bug fixing I tracked a problem to an old vc6 compiled dll that hasn't been touched in nearly 3 years. After checking out the most recent source I am getting the following error when trying to compile. Processing C:\PROGRAM FILES\MICROSOFT SDK\INCLUDE\msxml.idl msxml.idl .\ocidl.idl(1524) : error MIDL2003 : redefinition : IErrorLog .\ocidl.idl(1541) : error MIDL2003 : redefinition : IPropertyBag Google gives lots of suggestions regarding Visual Studio 2002 - 2003 errors but I can't find anything that relates to Visual Studio 6 or can be applied to my problem. I did find this page but following it's advice didn't fix my problem. Does anyone have any suggestions on how to fix this? (I am presuming that it did work once.) Other items of interest: I have the February 2003 Platform SDK installed, and looking at the add/remove program page I have Micrsoft XML Parser and SDK, MSXML 4.0 SP2 and MSXML 6.0 Parser too.

    Read the article

< Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >