Search Results

Search found 58168 results on 2327 pages for 'mysql real escape string'.

Page 36/2327 | < Previous Page | 32 33 34 35 36 37 38 39 40 41 42 43  | Next Page >

  • mysql server overloading without error

    - by beny
    Hi, I have a serious problem on my server with MySQL server, it overload itself without any error in /var/log/mysqld What steps should I do to find out the problem ? my.cnf is [mysqld] set-variable=local-infile=0 datadir=/var/lib/mysql socket=/var/lib/mysql/mysql.sock user=mysql old_passwords=1 skip-bdb set-variable = innodb_buffer_pool_size=256M set-variable = innodb_additional_mem_pool_size=20M set-variable = innodb_log_file_size=128M set-variable = innodb_log_buffer_size=8M innodb_data_file_path = ibdata1:1000M:autoextend Please help, thx

    Read the article

  • Cloning a VM to add a new MySQL Slave

    - by Ben Holness
    I am in the process of adding a new slave to a replicated mysql setup. All of the slave nodes are virtual machines. If I clone one of the nodes to a new VM, then start it with no networking, stop mysql, change the server-id in my.cnf to a new id and then restart mysql and networking, will it all work correctly, or will mysql get confused because it used to be a different server id? OS: Ubuntu 10.10 VM Platform: VMWare 5 MySQL : Server version: 5.1.49-1ubuntu8.1-log (Ubuntu)

    Read the article

  • What is the fastest method to restore MySQL replication?

    - by dwhere
    I have a MySQL (5.1) master-slave replication pair and replication to the slave has failed. It failed because the master ran out of disk space and the relay-logs became corrupt. The master is now back online and working properly. Since there is this error in the log the slave process can't simply be restarted. The server has a single 40GB InnoDB database and I would like to know what is the fastest method for getting the slave back in sync to minimize downtime.

    Read the article

  • mysql on ubunto 4 is not running and is not remotely accessible

    - by user628119
    Currently i installed ubunot on ubunto 4.4, and using following commands i can see mysql, mysqld running ps -ef | grep mysql ps -ef | grep mysqld but when I run, netstat i don't see mysql and 3306 anywhere. in my.cnf file, i have given my ip and port is 3306. also when i run this command sudo netstat -tap | grep mysql i don't see anything and commands I needed to run the mysql 5 on port 3306 and on ip=x.x.x.x for remotely accessible Looking forward to your reply

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Unresolved external symbol - MySQL API C++

    - by Zack_074
    Hey I've had nonstop problems with SQL. I'm trying to get some experience because I know it's a vital part of the industry. I got it working with C#, but now I'm working on connecting to a database in c++. I have the project properly linked and what not. Here's my code and the errors I'm getting. #include "stdafx.h" #include <mysql.h> #include <iostream> MYSQL mysql; MYSQL_RES result; using namespace std; int _tmain(int argc, _TCHAR* argv[]) { mysql_init(&mysql); if(!mysql_real_connect(&mysql, "localhost", "root", "angel552002", "MyDatabse", 0, NULL, 0)) { printf("Failed to connect"); } return 0; } and the errors: Error 1 error LNK2001: unresolved external symbol _mysql_real_connect@32 c:\Users\Zack-074\documents\visual studio 2010\Projects\MySql\MySql\MySql.obj Error 2 error LNK2001: unresolved external symbol _mysql_init@4 c:\Users\Zack-074\documents\visual studio 2010\Projects\MySql\MySql\MySql.obj Error 3 error LNK1120: 2 unresolved externals c:\users\zack-074\documents\visual studio 2010\Projects\MySql\Debug\MySql.exe 1 I really appreciate the help.

    Read the article

  • MYSQL not running on Ubuntu OS - Error 2002.

    - by mgj
    Hi, I am a novice to mysql DB. I am trying to run the MYSQL Server on Ubuntu 10.04. Through Synaptic Package Manager I am have installed the mysql version: mysql-client-5.1 I wonder that how was the database password set for the mysql-client software that I installed through the above way.It would be nice if you could enlighten me on this. When I tried running this database, I encountered the error given below: mohnish@mohnish-laptop:/var/lib$ mysql ERROR 2002 (HY000): Can't connect to local MySQL server through socket '/var/run/mysqld/mysqld.sock' (2) mohnish@mohnish-laptop:/var/lib$ I referred to a similar question posted by another user. I didn't find a solution through the proposed answers. For instance when I tried the solutions posted for the similar question I got the following: mohnish@mohnish-laptop:/var/lib$ service start mysqld start: unrecognized service mohnish@mohnish-laptop:/var/lib$ ps -u mysql ERROR: User name does not exist. ********* simple selection ********* ********* selection by list ********* -A all processes -C by command name -N negate selection -G by real group ID (supports names) -a all w/ tty except session leaders -U by real user ID (supports names) -d all except session leaders -g by session OR by effective group name -e all processes -p by process ID T all processes on this terminal -s processes in the sessions given a all w/ tty, including other users -t by tty g OBSOLETE -- DO NOT USE -u by effective user ID (supports names) r only running processes U processes for specified users x processes w/o controlling ttys t by tty *********** output format ********** *********** long options *********** -o,o user-defined -f full --Group --User --pid --cols --ppid -j,j job control s signal --group --user --sid --rows --info -O,O preloaded -o v virtual memory --cumulative --format --deselect -l,l long u user-oriented --sort --tty --forest --version -F extra full X registers --heading --no-heading --context ********* misc options ********* -V,V show version L list format codes f ASCII art forest -m,m,-L,-T,H threads S children in sum -y change -l format -M,Z security data c true command name -c scheduling class -w,w wide output n numeric WCHAN,UID -H process hierarchy mohnish@mohnish-laptop:/var/lib$ which mysql /usr/bin/mysql mohnish@mohnish-laptop:/var/lib$ mysql ERROR 2002 (HY000): Can't connect to local MySQL server through socket '/var/run/mysqld/mysqld.sock' (2) I even tried referring to http://forums.mysql.com/read.php?11,27769,84713#msg-84713 but couldn't find anything useful. Please let me know how I could tackle this error. Thank you very much..

    Read the article

  • MySQL Config File for Large System

    - by Jonathon
    We are running MySQL on a Windows 2003 Server Enterpise Edition box. MySQL is about the only program running on the box. We have approx. 8 slaves replicated to it, but my understanding is that having multiple slaves connecting to the same master does not significantly slow down performance, if at all. The master server has 16G RAM, 10 Terabyte drives in RAID 10, and four dual-core processors. From what I have seen from other sites, we have a really robust machine as our master db server. We just upgraded from a machine with only 4G RAM, but with similar hard drives, RAID, etc. It also ran Apache on it, so it was our db server and our application server. It was getting a little slow, so we split the db server onto this new machine and kept the application server on the first machine. We also distributed the application load amongst a few of our other slave servers, which also run the application. The problem is the new db server has mysqld.exe consuming 95-100% of CPU almost all the time and is really causing the app to run slowly. I know we have several queries and table structures that could be better optimized, but since they worked okay on the older, smaller server, I assume that our my.ini (MySQL config) file is not properly configured. Most of what I see on the net is for setting config files on small machines, so can anyone help me get the my.ini file correct for a large dedicated machine like ours? I just don't see how mysqld could get so bogged down! FYI: We have about 100 queries per second. We only use MyISAM tables, so skip-innodb is set in the ini file. And yes, I know it is reading the ini file correctly because I can change some settings (like the server-id and it will kill the server at startup). Here is the my.ini file: #MySQL Server Instance Configuration File # ---------------------------------------------------------------------- # Generated by the MySQL Server Instance Configuration Wizard # # # Installation Instructions # ---------------------------------------------------------------------- # # On Linux you can copy this file to /etc/my.cnf to set global options, # mysql-data-dir/my.cnf to set server-specific options # (@localstatedir@ for this installation) or to # ~/.my.cnf to set user-specific options. # # On Windows you should keep this file in the installation directory # of your server (e.g. C:\Program Files\MySQL\MySQL Server X.Y). To # make sure the server reads the config file use the startup option # "--defaults-file". # # To run run the server from the command line, execute this in a # command line shell, e.g. # mysqld --defaults-file="C:\Program Files\MySQL\MySQL Server X.Y\my.ini" # # To install the server as a Windows service manually, execute this in a # command line shell, e.g. # mysqld --install MySQLXY --defaults-file="C:\Program Files\MySQL\MySQL Server X.Y\my.ini" # # And then execute this in a command line shell to start the server, e.g. # net start MySQLXY # # # Guildlines for editing this file # ---------------------------------------------------------------------- # # In this file, you can use all long options that the program supports. # If you want to know the options a program supports, start the program # with the "--help" option. # # More detailed information about the individual options can also be # found in the manual. # # # CLIENT SECTION # ---------------------------------------------------------------------- # # The following options will be read by MySQL client applications. # Note that only client applications shipped by MySQL are guaranteed # to read this section. If you want your own MySQL client program to # honor these values, you need to specify it as an option during the # MySQL client library initialization. # [client] port=3306 [mysql] default-character-set=latin1 # SERVER SECTION # ---------------------------------------------------------------------- # # The following options will be read by the MySQL Server. Make sure that # you have installed the server correctly (see above) so it reads this # file. # [mysqld] # The TCP/IP Port the MySQL Server will listen on port=3306 #Path to installation directory. All paths are usually resolved relative to this. basedir="D:/MySQL/" #Path to the database root datadir="D:/MySQL/data" # The default character set that will be used when a new schema or table is # created and no character set is defined default-character-set=latin1 # The default storage engine that will be used when create new tables when default-storage-engine=MYISAM # Set the SQL mode to strict #sql-mode="STRICT_TRANS_TABLES,NO_AUTO_CREATE_USER,NO_ENGINE_SUBSTITUTION" # we changed this because there are a couple of queries that can get blocked otherwise sql-mode="" #performance configs skip-locking max_allowed_packet = 1M table_open_cache = 512 # The maximum amount of concurrent sessions the MySQL server will # allow. One of these connections will be reserved for a user with # SUPER privileges to allow the administrator to login even if the # connection limit has been reached. max_connections=1510 # Query cache is used to cache SELECT results and later return them # without actual executing the same query once again. Having the query # cache enabled may result in significant speed improvements, if your # have a lot of identical queries and rarely changing tables. See the # "Qcache_lowmem_prunes" status variable to check if the current value # is high enough for your load. # Note: In case your tables change very often or if your queries are # textually different every time, the query cache may result in a # slowdown instead of a performance improvement. query_cache_size=168M # The number of open tables for all threads. Increasing this value # increases the number of file descriptors that mysqld requires. # Therefore you have to make sure to set the amount of open files # allowed to at least 4096 in the variable "open-files-limit" in # section [mysqld_safe] table_cache=3020 # Maximum size for internal (in-memory) temporary tables. If a table # grows larger than this value, it is automatically converted to disk # based table This limitation is for a single table. There can be many # of them. tmp_table_size=30M # How many threads we should keep in a cache for reuse. When a client # disconnects, the client's threads are put in the cache if there aren't # more than thread_cache_size threads from before. This greatly reduces # the amount of thread creations needed if you have a lot of new # connections. (Normally this doesn't give a notable performance # improvement if you have a good thread implementation.) thread_cache_size=64 #*** MyISAM Specific options # The maximum size of the temporary file MySQL is allowed to use while # recreating the index (during REPAIR, ALTER TABLE or LOAD DATA INFILE. # If the file-size would be bigger than this, the index will be created # through the key cache (which is slower). myisam_max_sort_file_size=100G # If the temporary file used for fast index creation would be bigger # than using the key cache by the amount specified here, then prefer the # key cache method. This is mainly used to force long character keys in # large tables to use the slower key cache method to create the index. myisam_sort_buffer_size=64M # Size of the Key Buffer, used to cache index blocks for MyISAM tables. # Do not set it larger than 30% of your available memory, as some memory # is also required by the OS to cache rows. Even if you're not using # MyISAM tables, you should still set it to 8-64M as it will also be # used for internal temporary disk tables. key_buffer_size=3072M # Size of the buffer used for doing full table scans of MyISAM tables. # Allocated per thread, if a full scan is needed. read_buffer_size=2M read_rnd_buffer_size=8M # This buffer is allocated when MySQL needs to rebuild the index in # REPAIR, OPTIMZE, ALTER table statements as well as in LOAD DATA INFILE # into an empty table. It is allocated per thread so be careful with # large settings. sort_buffer_size=2M #*** INNODB Specific options *** innodb_data_home_dir="D:/MySQL InnoDB Datafiles/" # Use this option if you have a MySQL server with InnoDB support enabled # but you do not plan to use it. This will save memory and disk space # and speed up some things. skip-innodb # Additional memory pool that is used by InnoDB to store metadata # information. If InnoDB requires more memory for this purpose it will # start to allocate it from the OS. As this is fast enough on most # recent operating systems, you normally do not need to change this # value. SHOW INNODB STATUS will display the current amount used. innodb_additional_mem_pool_size=11M # If set to 1, InnoDB will flush (fsync) the transaction logs to the # disk at each commit, which offers full ACID behavior. If you are # willing to compromise this safety, and you are running small # transactions, you may set this to 0 or 2 to reduce disk I/O to the # logs. Value 0 means that the log is only written to the log file and # the log file flushed to disk approximately once per second. Value 2 # means the log is written to the log file at each commit, but the log # file is only flushed to disk approximately once per second. innodb_flush_log_at_trx_commit=1 # The size of the buffer InnoDB uses for buffering log data. As soon as # it is full, InnoDB will have to flush it to disk. As it is flushed # once per second anyway, it does not make sense to have it very large # (even with long transactions). innodb_log_buffer_size=6M # InnoDB, unlike MyISAM, uses a buffer pool to cache both indexes and # row data. The bigger you set this the less disk I/O is needed to # access data in tables. On a dedicated database server you may set this # parameter up to 80% of the machine physical memory size. Do not set it # too large, though, because competition of the physical memory may # cause paging in the operating system. Note that on 32bit systems you # might be limited to 2-3.5G of user level memory per process, so do not # set it too high. innodb_buffer_pool_size=500M # Size of each log file in a log group. You should set the combined size # of log files to about 25%-100% of your buffer pool size to avoid # unneeded buffer pool flush activity on log file overwrite. However, # note that a larger logfile size will increase the time needed for the # recovery process. innodb_log_file_size=100M # Number of threads allowed inside the InnoDB kernel. The optimal value # depends highly on the application, hardware as well as the OS # scheduler properties. A too high value may lead to thread thrashing. innodb_thread_concurrency=10 #replication settings (this is the master) log-bin=log server-id = 1 Thanks for all the help. It is greatly appreciated.

    Read the article

  • how to escape a string before insert or update in Ruby

    - by ywenbo
    Hi guy, In ruby ActiveRecord doesn't provide dynamic binding for update and insert sqls, of course i can use raw sql, but that need maintain connection, so i want to know if there is simpler way to escape update or insert sql before executing like code below: ActiveRecord::Base.connection.insert(sql) i think i can write code by gsub, but i know if there has been a ready method to do it. thank you very much, and Merry Christmas for you all.

    Read the article

  • Extracting Data Daily from MySQL to a Local MySQL DB

    - by Sunny Juneja
    I'm doing some experiments locally that require some data from a production MySQL DB that I only have read access to. The schemas are nearly identical with the exception of the omission of one column. My goal is to write a script that I can run everyday that extracts the previous day's data and imports it into my local table. The part that I'm most confused about is how to download the data. I've seen names like mysqldump be tossed around but that seems a way to replicate the entire database. I would love to avoid using php seeing as I have no experience with it. I've been creating CSVs but I'm worried about having the data integrity (what if there is a comma in a field or a \n) as well as the size of the CSV (there are several hundred thousand rows per day).

    Read the article

  • php/mySQL error: mysql_num_rows(): supplied argument is not a valid MySQL result

    - by Michael Robinson
    I'm trying to INSERT INTO a mySQL database and I'm getting this error on: if (mysql_num_rows($login) == 1){ Here is the php, The php does add the user to the database. I can't figure it out. <? session_start(); require("config.php"); $u = $_GET['username']; $pw = $_GET['password']; $pwh = $_GET['passwordhint']; $em = $_GET['email']; $zc = $_GET['zipcode']; $check = "INSERT INTO family (loginName, email, password, passwordhint, location) VALUES ('$u', '$pw', '$pwh', '$em', '$zc')"; $login = mysql_query($check, $link) or die(mysql_error()); if (mysql_num_rows($login) == 1) { $row = mysql_fetch_assoc($login); echo 'Yes';exit; } else { echo 'No';exit; } mysql_close($link); ?> Thanks,

    Read the article

  • Tomcat6 can't connect to MySql (The driver has not received any packets from the server)

    - by Tobias Wiesenthal
    Hi all, i'm running an Apache Tomcat 6.0.20 / MySQL 5.1.37-lubuntu / sun-java6-jdk /sun-java6-jre / sun-java6-bin on my local machine using Ubuntu 9.10 as OS. I'm trying to get a simple DB-query example running for 2 days now, but i still get this Exception: org.apache.jasper.JasperException: javax.servlet.ServletException: javax.servlet.jsp.JspException: Unable to get connection, DataSource invalid: "org.apache.commons.dbcp.SQLNestedException: Cannot create PoolableConnectionFactory (Communications link failure The last packet sent successfully to the server was 0 milliseconds ago. The driver has not received any packets from the server.)" org.apache.jasper.servlet.JspServletWrapper.handleJspException(JspServletWrapper.java:522) org.apache.jasper.servlet.JspServletWrapper.service(JspServletWrapper.java:398) org.apache.jasper.servlet.JspServlet.serviceJspFile(JspServlet.java:342) org.apache.jasper.servlet.JspServlet.service(JspServlet.java:267) javax.servlet.http.HttpServlet.service(HttpServlet.java:717) root cause javax.servlet.ServletException: javax.servlet.jsp.JspException: Unable to get connection, DataSource invalid: "org.apache.commons.dbcp.SQLNestedException: Cannot create PoolableConnectionFactory (Communications link failure The last packet sent successfully to the server was 0 milliseconds ago. The driver has not received any packets from the server.)" org.apache.jasper.runtime.PageContextImpl.doHandlePageException(PageContextImpl.java:862) org.apache.jasper.runtime.PageContextImpl.handlePageException(PageContextImpl.java:791) org.apache.jsp.index_jsp._jspService(index_jsp.java:104) org.apache.jasper.runtime.HttpJspBase.service(HttpJspBase.java:70) javax.servlet.http.HttpServlet.service(HttpServlet.java:717) org.apache.jasper.servlet.JspServletWrapper.service(JspServletWrapper.java:374) org.apache.jasper.servlet.JspServlet.serviceJspFile(JspServlet.java:342) org.apache.jasper.servlet.JspServlet.service(JspServlet.java:267) javax.servlet.http.HttpServlet.service(HttpServlet.java:717) root cause javax.servlet.jsp.JspException: Unable to get connection, DataSource invalid: "org.apache.commons.dbcp.SQLNestedException: Cannot create PoolableConnectionFactory (Communications link failure The last packet sent successfully to the server was 0 milliseconds ago. The driver has not received any packets from the server.)" org.apache.taglibs.standard.tag.common.sql.QueryTagSupport.getConnection(QueryTagSupport.java:285) org.apache.taglibs.standard.tag.common.sql.QueryTagSupport.doStartTag(QueryTagSupport.java:168) org.apache.jsp.index_jsp._jspx_meth_sql_005fquery_005f0(index_jsp.java:274) org.apache.jsp.index_jsp._jspx_meth_c_005fotherwise_005f0(index_jsp.java:216) org.apache.jsp.index_jsp._jspx_meth_c_005fchoose_005f0(index_jsp.java:130) org.apache.jsp.index_jsp._jspService(index_jsp.java:93) org.apache.jasper.runtime.HttpJspBase.service(HttpJspBase.java:70) javax.servlet.http.HttpServlet.service(HttpServlet.java:717) org.apache.jasper.servlet.JspServletWrapper.service(JspServletWrapper.java:374) org.apache.jasper.servlet.JspServlet.serviceJspFile(JspServlet.java:342) org.apache.jasper.servlet.JspServlet.service(JspServlet.java:267) javax.servlet.http.HttpServlet.service(HttpServlet.java:717) my web.xml looks like this : <?xml version="1.0" encoding="utf-8"?> <web-app xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_2_5.xsd" version="2.5"> <resource-ref> <description>DB Connection</description> <res-ref-name>jdbc/testDB</res-ref-name> <res-type>javax.sql.DataSource</res-type> <res-auth>Container</res-auth> </resource-ref> </web-app> the context.xml looks like this : <?xml version="1.0" encoding="UTF-8"?> <Context path="/my1stApp" docBase="/var/www/jsp/my1stApp" debug="5" reloadable="true" crossContext="true"> <Resource name="jdbc/testDB" auth="Container" type="javax.sql.DataSource" maxActive="5" maxIdle="5" maxWait="10000" username="user" password="password" driverClassName="com.mysql.jdbc.Driver" url="jdbc:mysql://localhost:3306/some"/> </Context> and the jsp file looks like this: <%@ page contentType="text/html" %> <%@ taglib prefix="c" uri="http://java.sun.com/jsp/jstl/core" %> <%@ taglib prefix="fn" uri="http://java.sun.com/jsp/jstl/functions" %> <%@ taglib prefix="fmt" uri="http://java.sun.com/jsp/jstl/fmt" %> <%@ taglib prefix="sql" uri="http://java.sun.com/jsp/jstl/sql" %> <html> <head> <title>DroneLootTool</title> </head> <body bgcolor="white"> <sql:query var="res" dataSource="jdbc/testDB"> select name, othername from mytable </sql:query> <h2>Results</h2> <c:forEach var="row" items="${res.rows}"> Name ${row.name}<br/> MoreName ${row.othername}<br/><br/> </c:forEach> </body> </html> read lots of forum entries / tried lots of different settings (always changed back to original settings when it didnt' work) set TOMCAT6_SECURITY=no in /etc/default/tomcat6 because TOMCAT6_SECURITY=yes was causing trouble too the skip-networking flag is not set for the DB (BIND 127.0.0.1 is set) firewall is swiched off (sudo ufw disable) MySQL works (tested several times with user used in this skript) telnet localhost 3306 says Trying ::1... Trying 127.0.0.1... Connected to localhost. Escape character is '^]'. Connection closed by foreign host. The TestConnection.java produced the following output: me@my-laptop:~/Desktop$ java -classpath '/usr/share/java/mysql.jar:./' TestConnection com.mysql.jdbc.Driver jdbc:mysql://localhost:3306/testDB myuser mypassword com.mysql.jdbc.CommunicationsException: Communications link failure Last packet sent to the server was 0 ms ago. at com.mysql.jdbc.SQLError.createCommunicationsException(SQLError.java:1070) at com.mysql.jdbc.ConnectionImpl.createNewIO(ConnectionImpl.java:2103) at com.mysql.jdbc.ConnectionImpl.<init>(ConnectionImpl.java:718) at com.mysql.jdbc.ConnectionImpl.getInstance(ConnectionImpl.java:298) at com.mysql.jdbc.NonRegisteringDriver.connect(NonRegisteringDriver.java:282) at java.sql.DriverManager.getConnection(DriverManager.java:582) at java.sql.DriverManager.getConnection(DriverManager.java:185) at TestConnection.checkConnection(TestConnection.java:40) at TestConnection.main(TestConnection.java:21) Caused by: com.mysql.jdbc.CommunicationsException: Communications link failure Last packet sent to the server was 0 ms ago. at com.mysql.jdbc.SQLError.createCommunicationsException(SQLError.java:1070) at com.mysql.jdbc.MysqlIO.readPacket(MysqlIO.java:666) at com.mysql.jdbc.MysqlIO.doHandshake(MysqlIO.java:1069) at com.mysql.jdbc.ConnectionImpl.createNewIO(ConnectionImpl.java:2031) ... 7 more Caused by: java.io.EOFException: Can not read response from server. Expected to read 4 bytes, read 0 bytes before connection was unexpectedly lost. at com.mysql.jdbc.MysqlIO.readFully(MysqlIO.java:2431) at com.mysql.jdbc.MysqlIO.readPacket(MysqlIO.java:590) ... 9 more Connection failed. i don't know if there is a difference between the way the java driver connects to the DB and the Perl DBI module does, but this PERL skript works #!/usr/bin/perl -w use CGI; use DBI; use strict; print CGI::header(); my $dbh = DBI->connect("dbi:mysql:some:localhost", "user", "password"); my $sSql = "SELECT * from mytable"; my $ppl = $dbh->selectall_arrayref( $sSql ); foreach my $pl (@$ppl) { my @array = @$pl; print @array; } $dbh->disconnect; enabled --log-warnings on the mysql, but i didn't get any new warnings. When i was searching the logs for warnings i found this messages when i restart the tomcat, don't know if it helps to find the problem : Feb 2 19:50:37 tobias-laptop jsvc.exec[3129]: 02.02.2010 19:50:37 org.apache.catalina.startup.HostConfig checkResources#012INFO: Undeploying context [/myapp] Feb 2 19:50:37 tobias-laptop jsvc.exec[3129]: 02.02.2010 19:50:37 org.apache.catalina.loader.WebappClassLoader clearReferencesThreads#012SCHWERWIEGEND: A web application appears to have started a thread named [MySQL Statement Cancellation Timer] but has failed to stop it. This is very likely to create a memory leak. Feb 2 19:50:37 tobias-laptop jsvc.exec[3129]: 02.02.2010 19:50:37 org.apache.catalina.startup.HostConfig deployDescriptor#012INFO: Deploying configuration descriptor myapp.xml

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • I want to install and get to building a personal MySQL DB

    - by Ari Hall
    So how do I go from installing MySQL from the Software Center to inputing data into fields and bringing in a comma delimited file? I've only had brief experience with MSAccess and OOo Base a long time ago, so details are appreciated, I just want to get up and running. I have Ubuntu 10.10, 64 bit, if that affects much. If you can link me to a howto that does exactly what I'm looking for, that would work. Again, Thanks!

    Read the article

  • How to Map a CSV or Tab Delimited File to MySQL Multi-Table Database [migrated]

    - by Keefer
    I've got a pretty substantial XLS file a client provided 830 total tabs/sheets. I've designed a multi table database with PHPMyAdmin (MySQL obviously) to house the information that's in there, and have populated about 5 of those sheets by hand to ensure the data will fit into the designed database. Is there a piece of software or some sort of tool that will help me format this XLS document and map it to the right places in the database?

    Read the article

  • How to change root password for mysql and phpmyadmin

    - by Jon
    I've set up mysql and phpmyadmin and chose not to set a password when installing hoping that once set up i could login with root and no password but i get the following error from phpmyadmin Login without a password is forbidden by configuration (see AllowNoPassword) I have previously moved the phpmyadmin folder to /var/www/ I have tried changing the following line $cfg['Servers'][$i]['AllowNoPassword'] = false; to $cfg['Servers'][$i]['AllowNoPassword'] = true; but still had no success, so i am wondering is there a way i can change the root passwords for both so i can access phpmyadmin and create databases. Thanks

    Read the article

  • Next lowest value in MySQL Database [migrated]

    - by Justin Edwards
    SELECT * FROM `experience` WHERE `reqexp` <> '4793' ORDER BY 'lvl' DESC LIMIT 1 Here is what I want to do. I am making an online game for a client, and need to be able to use a mysql query with a random value, and find the level associated with that amount of experience. In this case, I need to find the next value lower than 4793 that already exists in the database so I can determine the players appropriate level. Any Ideas?

    Read the article

  • Upgrade MySQL to 5.5 on Lucid, upgrade server to Precise or switch to Percona?

    - by xref
    Looking into upgrading mysql on our development server to which is running 10.04 so is stuck at MySQL 5.1, as it appears there is no apt-get support for upgrading to 5.5 except by certain 3rd party PPAs. So I'm looking for which route to take and what other people have done: a) Follow a couple year old guide to manually install MySQL 5.5 and then invest ongoing time into manually downloading and installing security updates every month or two? b) Upgrade 10.04 to 12.04, and from other peoples experience I work with spend several days working out the kinks of that large upgrade, then I'll have access to mysql 5.5 and easy apt-get installation of future security updates? c) Switch from MySQL to Percona Server 5.5 and get all the benefits of that version of mysql, plus easy apt-get updates with their PPA? d) Something else?

    Read the article

  • How to install MySQL 5.6?

    - by Ross Smith II
    I just installed Ubuntu 12.10 (amd64), and want to install a recent version of MySQL 5.6. If possible, I would like to install (not upgrade) it the "Debian Way' (i.e., using apt-get or dpkg). The only binaries I could find are here. Unfortunately, they are incomplete, as they only install files in /usr/share. If binaries aren't available, how could I install it from source, using the standard Debian method of installing from source. Thanks for any assistance.

    Read the article

< Previous Page | 32 33 34 35 36 37 38 39 40 41 42 43  | Next Page >