Search Results

Search found 33227 results on 1330 pages for 'open stackoverflow'.

Page 378/1330 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • Sendmail Issue - Local Mail / Inner Domain Mail

    - by ngl5000
    Environments: Ubuntu / Sendmail / Google Apps Emailing: I send and receive all of my emails through google apps besides emails that are sent directly from my website. My Web Domain: example.com (for the purpose of the question only) Problem: When my website sends an email, using sendmail, to any local address ([email protected]) I get an unknown user error. Emails sent to other domains seem to work just fine. Question: I believe this is because I don't have these users defined on my ubuntu server, this is besides the point I need to configure sendmail such that it doesn't pick out local emails sent to ([email protected]) and instead finds their name server which points to google apps and sends it there instead. This is my first try at serverfault, I normally use stackoverflow so let me know if I'm messing up! Thank you!

    Read the article

  • Redirect folder to different server

    - by yuval
    Just for clarity, I already posted this on StackOverflow and got advice that this better fits in ServerFault.com so here goes: I know you can redirect subdomains to a different server, but can you do the same with folders? Say I have example.com. I can redirect mysubdomain.example.com to a different server, but can I redirect example.com/mysubdomain to a different server? I'd like to host a rails app in that folder on a site that runs php while still maintaining good search engines ratings (by not creating a sub domain which in my experience in recognized as a different site). Any help? Thanks!

    Read the article

  • WMD editor freezes IE7 for 3 seconds on load

    - by dhruvbird
    Hello all, I am using the WMD editor's original code(not the stackoverflow version) since I need multiple of 'em on the same page and stackoverflow's version makes heavy use of element IDs internally since they aren't going to be having more than one editor instance per page. The code runs fin in FF 3.5, etc.. However, when I run it in IE8 (in IE7 compatibility mode), it freezes the whole browser for about 3 sec. before a new instance shows up. I tried profiling it with IE's dev. tools, and it seems that the getWidth() function on line 520 of the minified version of the code is taking up all the time. However, when I tried to hard-code the return (since it was always returning the same thing), the bottleneck shifted to the getHeight() function. I am attaching the code I am using to convert it to a jQuery plugin. jQuery.fn.wmd = function(params) { function createInstance(container, params) { /* Make sure WMD has finished loading */ if (!Attacklab || !Attacklab.wmd) { alert("WMD hasn't finished loading!"); return; } var defaultParams = { width : "600px", rows : 6, autogrow : false, preview : false, previewDivClassName: "wmd-preview-div" }; if (typeof(params) == "undefined") { var params = defaultParams; } else { var params = jQuery.extend({}, defaultParams, params); } /* Build the DOM elements */ var textarea = document.createElement("textarea"); textarea.style.width = params.width; textarea.rows = params.rows; jQuery(container).append(textarea); var previewDiv = document.createElement("div"); if (params.preview) { jQuery(previewDiv).addClass(params.previewDivClassName); jQuery(container).append(previewDiv); } /* Build the preview manager */ var panes = {input:textarea, preview:previewDiv, output:null}; var previewManager = new Attacklab.wmd.previewManager(panes); /* Build the editor and tell it to refresh the preview after commands */ var editor = new Attacklab.wmd.editor(textarea,previewManager.refresh); /* Save everything so we can destroy it all later */ var wmdInstance = {ta:textarea, div:previewDiv, ed:editor, pm:previewManager}; var wmdInstanceId = $(container).attr('postID'); wmdInstanceProcs.add(wmdInstanceId, wmdInstance); if (params.autogrow) { // $(textarea).autogrow(); } }; if (jQuery(this).html().length > 0) { var wmdInstanceId = jQuery(this).attr('postID'); var inst = wmdInstanceProcs.get(wmdInstanceId); jQuery(inst.ta).show(); } else { createInstance(this, params); } } jQuery.fn.unwmd = function(params) { var wmdInstanceId = $(this).attr('postID'); var inst = wmdInstanceProcs.get(wmdInstanceId); if (inst != null) { jQuery(inst.ta).hide(); } } wmdInstanceProcs = function() { var wmdInstances = { }; var getProc = function(wmdInstanceId) { var inst = wmdInstances[wmdInstanceId]; if (typeof(inst) != "undefined") { return inst; } else { return null; } }; var addProc = function(wmdInstanceId, wmdInstance) { wmdInstances[wmdInstanceId] = wmdInstance; }; return { add: addProc, get: getProc }; }(); Any help would be much appreciated.

    Read the article

  • which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

    - by ijjo
    i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

    Read the article

  • How to set the default file permissions on ALL newly created files in linux

    - by eviljack
    My question is similar to this: http://stackoverflow.com/questions/228534/linux-default-file-permission but there is no scp/ftp client involved and that question looks abandoned. Simply put: I want to be able to, at some global level decree that all newly created files will never have world writable permissions (0775). I tried putting a umask 02 in /etc/profile then in my bash_profile but it only works for scripts or new files that I create in a shell. It doesn't work for files that another binary creates. Is there anyway to have all new files that are created?

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Does the nginx “upstream” directive have a port setting?

    - by user55467
    moved from:http://stackoverflow.com/questions/3748517/does-nginx-upstream-has-a-port-setting I use upstream and proxy for load balancing. The directive proxy_pass http://upstream_name uses the default port, which is 80. However, if the upstream server does not listen on this port, then the request fails. How do I specify an alternate port? my configuration: http{ #... upstream myups{ server 192.168.1.100:6666; server 192.168.1.101:9999; } #.... server{ listen 81; #..... location ~ /myapp { proxy_pass http://myups:81/; } } nginx -t: [warn]: upstream "myups" may not have port 81 in /opt/nginx/conf/nginx.conf:78.

    Read the article

  • ASP.net roles and Projects

    - by Zyphrax
    EDIT - Rewrote my original question to give a bit more information Background info At my work I'm working on a ASP.Net web application for our customers. In our implementation we use technologies like Forms authentication with MembershipProviders and RoleProviders. All went well until I ran into some difficulties with configuring the roles, because the roles aren't system-wide, but related to the customer accounts and projects. I can't name our exact setup/formula, because I think our company wouldn't approve that... What's a customer / project? Our company provides management information for our customers on a yearly (or other interval) basis. In our systems a customer/contract consists of: one Account: information about the Company per Account, one or more Products: the bundle of management information we'll provide per Product, one or more Measurements: a period of time, in which we gather and report the data Extranet site setup Eventually we want all customers to be able to access their management information with our online system. The extranet consists of two sites: Company site: provides an overview of Account information and the Products Measurement site: after selecting a Measurement, detailed information on that period of time The measurement site is the most interesting part of the extranet. We will create submodules for new overviews, reports, managing and maintaining resources that are important for the research. Our Visual Studio solution consists of a number of projects. One web application named Portal for the basis. The sites and modules are virtual directories within that application (makes it easier to share MasterPages among things). What kind of roles? The following users (read: roles) will be using the system: Admins: development users :) (not customer related, full access) Employees: employees of our company (not customer related, full access) Customer SuperUser: top level managers (full access to their account/measurement) Customer ContactPerson: primary contact (full access to their measurement(s)) Customer Manager: a department manager (limited access, specific data of a measurement) What about ASP.Net users? The system will have many ASP.Net users, let's focus on the customer users: Users are not shared between Accounts SuperUser X automatically has access to all (and new) measurements User Y could be Primary contact for Measurement 1, but have no role for Measurement 2 User Y could be Primary contact for Measurement 1, but have a Manager role for Measurement 2 The department managers are many individual users (per Measurement), if Manager Z had a login for Measurement 1, we would like to use that login again if he participates in Measurement 2. URL structure These are typical urls in our application: http://host/login - the login screen http://host/project - the account/product overview screen (measurement selection) http://host/project/1000 - measurement (id:1000) details http://host/project/1000/planning - planning overview (for primary contact/superuser) http://host/project/1000/reports - report downloads (manager department X can only access report X) We will also create a document url, where you can request a specific document by it's GUID. The system will have to check if the user has rights to the document. The document is related to a Measurement, the User or specific roles have specific rights to the document. What's the problem? (finally ;)) Roles aren't enough to determine what a user is allowed to see/access/download a specific item. It's not enough to say that a certain navigation item is accessible to Managers. When the user requests Measurement 1000, we have to check that the user not only has a Manager role, but a Manager role for Measurement 1000. Summarized: How can we limit users to their accounts/measurements? (remember superusers see all measurements, some managers only specific measurements) How can we apply roles at a product/measurement level? (user X could be primarycontact for measurement 1, but just a manager for measurement 2) How can we limit manager access to the reports screen and only to their department's reports? All with the magic of asp.net classes, perhaps with a custom roleprovider implementation. Similar Stackoverflow question/problem http://stackoverflow.com/questions/1367483/asp-net-how-to-manage-users-with-different-types-of-roles

    Read the article

  • List files with last access date in linux

    - by kayaker243
    I'd like to clean up a server that my webmaster let turn into a mess. I know how to list all files not accessed within the last x days using find and -atime, but what I'm looking for is to come up with a listing of the last access date for files one level down in directory /foo: /foo/bar1.txt Dec 11, 2001 /foo/bar2.txt Nov 12, 2008 /foo/bar3.txt Jan 12, 2004 For folders one level down in directory /foo, list the date of the most recently accessed file within the directory (no limit on depth for identifying last access date) /foo/bar1/ Feb 13, 2012 /foo/bar2/ Oct 11, 2008 Where /foo/bar1/ has a file modified Jan 1, 1998 and Feb 13, 2012 and /foo/bar2/ has 30 files, most recent of which was accessed Oct 11, 2008. This question is similar to: http://stackoverflow.com/questions/5566310/how-to-recursively-find-and-list-the-latest-modified-files-in-a-directory-with-s but rather than the modification date, the date of interest is the last accessed date.

    Read the article

  • Why isn't my assets folder being installed on emulator?

    - by Brad Hein
    Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

    Read the article

  • Modern Java alternatives

    - by Ralph
    I'm not sure if stackoverflow is the best forum for this discussion. I have been a Java developer for 14 years and have written an enterprise-level (~500,000 line) Swing application that uses most of the standard library APIs. Recently, I have become disappointed with the progress that the language has made to "modernize" itself, and am looking for an alternative for ongoing development. I have considered moving to the .NET platform, but I have issues with using something the only runs well in Windows (I know about Mono, but that is still far behind Microsoft). I also plan on buying a new Macbook Pro as soon as Apple releases their new rumored Arrandale-based machines and want to develop in an environment that will feel "at home" in Unix/Linux. I have considered using Python or Ruby, but the standard Java library is arguably the largest of any modern language. In JVM-based languages, I looked at Groovy, but am disappointed with its performance. Rumor has it that with the soon-to-be released JDK7, with its InvokeDynamic instruction, this will improve, but I don't know how much. Groovy is also not truly a functional language, although it provides closures and some of the "functional" features on collections. It does not embrace immutability. I have narrowed my search down to two JVM-based alternatives: Scala and Clojure. Each has its strengths and weaknesses. I am looking for the stackoverflow readerships' opinions. I am not an expert at either of these languages; I have read 2 1/2 books on Scala and am currently reading Stu Halloway's book on Clojure. Scala is strongly statically typed. I know the dynamic language folks claim that static typing is a crutch for not doing unit testing, but it does provide a mechanism for compile-time location of a whole class of errors. Scala is more concise than Java, but not as much as Clojure. Scala's inter-operation with Java seems to be better than Clojure's, in that most Java operations are easier to do in Scala than in Clojure. For example, I can find no way in Clojure to create a non-static initialization block in a class derived from a Java superclass. For example, I like the Apache commons CLI library for command line argument parsing. In Java and Scala, I can create a new Options object and add Option items to it in an initialization block as follows (Java code): final Options options = new Options() { { addOption(new Option("?", "help", false, "Show this usage information"); // other options } }; I can't figure out how to the same thing in Clojure (except by using (doit...)), although that may reflect my lack of knowledge of the language. Clojure's collections are optimized for immutability. They rarely require copy-on-write semantics. I don't know if Scala's immutable collections are implemented using similar algorithms, but Rich Hickey (Clojure's inventor) goes out of his way to explain how that language's data structures are efficient. Clojure was designed from the beginning for concurrency (as was Scala) and with modern multi-core processors, concurrency takes on more importance, but I occasionally need to write simple non-concurrent utilities, and Scala code probably runs a little faster for these applications since it discourages, but does not prohibit, "simple" mutability. One could argue that one-off utilities do not have to be super-fast, but sometimes they do tasks that take hours or days to complete. I know that there is no right answer to this "question", but I thought I would open it up for discussion. If anyone has a suggestion for another JVM-based language that can be used for enterprise level development, please list it. Also, it is not my intent to start a flame war. Thanks, Ralph

    Read the article

  • Python urllib.urlopen IOError

    - by Michael
    So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • NETWORK_ERROR: XMLHttpRequest Exception 101

    - by pawan Mangal
    I am getting this Error NETWORK_ERROR: XMLHttpRequest Exception 101 when trying to get XML content from one site. Here is my code var xmlhttp; if(window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } if (xmlhttp==null) { alert ("Your browser does not support XMLHTTP!"); return; } xmlhttp.onReadyStateChange=function() { if(xmlhttp.readyState==4) { var value =xmlhttp.responseXML; alert(value); } } xmlhttp.open("GET",url,false); xmlhttp.send(); //alert(xmlhttp.responseXML); } xmlhttp.open("GET",url,false); xmlhttp.send(null); Does any one have a solution?

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

  • How do I make Chrome's Omnibar behave more like the Firefox Awesome bar?

    - by Agnel Kurian
    One of my favorite features of the Firefox awesome bar is that I can simply type a substring of any URL or page title in my history and it finds all matches sorted by how frequently they were accessed. Example: I simply type "ask" when I want to ask something on stackoverflow.com., "inbox" goes to my GMail Inbox and so on because the substring matches any part of the URL or the page title. Chrome's Omnibar is quite frustrating in this area. I am not able to predict what it's gonna fetch and I seem to have no way to train the thing to do my bidding. I have turned unchecked the option that says: "Use a suggestion service to help complete searches and URLs typed..." but there has been no noticeable improvement. Any clues how I can make the Omnibar behave?

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • How to check if a generic type definition inherits from another generic type definition

    - by Anne
    I'm trying to check whether an open generic type definition implements some open generic interface. Look at the sample below: public interface IService<T> { } public class ServiceImpl<T> : IService<T> { } private static bool OpenGenericTypeImplementsOpenGenericInterface( Type derivedType, Type interfaceType) { return derivedType.GetInterfaces().Contains(interfaceType); } [TestMethod] public void Verify() { Type openGenericImplementation = typeof(ServiceImpl<>); Type expectedInterfaceType = typeof(IService<>); bool implDoesImplementInterface = OpenGenericTypeImplementsOpenGenericInterface( openGenericImplementation, expectedInterfaceType); // This assert fails. Why? Assert.IsTrue(implDoesImplementInterface); } I found out that the returned type from the Type.GetInterfaces() method does not match the type returned from typeof(IService<>). I can't figure out why that is and how to correctly validate whether some generic type definition inherits or implements some other generic type definition. What's going on here and how do I solve fix this problem?

    Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >