Search Results

Search found 15224 results on 609 pages for 'parallel python'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 388/609 | < Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • Counting amount of items in Pythons 'for'

    - by Markum
    Kind of hard to explain, but when I run something like this: fruits = ['apple', 'orange', 'banana', 'strawberry', 'kiwi'] for fruit in fruits: print fruit.capitalize() It gives me this, as expected: Apple Orange Banana Strawberry Kiwi How would I edit that code so that it would "count" the amount of times it's performing the for, and print this? 1 Apple 2 Orange 3 Banana 4 Strawberry 5 Kiwi

    Read the article

  • grabbing a substring while scraping with Python2.6

    - by Diego
    Hey can someone help with the following? I'm trying to scrape a site that has the following information.. I need to pull just the number after the </strong> tag.. [<li><strong>ISBN-13:</strong> 9780375853401</li>, <li><strong>Pub. Date: </strong> 05/11/2010</li>] [<li><strong>UPC:</strong> 490355000372</li>, <li><strong>Catalog No:</strong> 15024/25</li>, <li><strong>Label:</strong> CAMERATA</li>] here's a piece of the code I've been using to grab the above data using mechanize and BeautifulSoup. I'm stuck here as it won't let me use the find() function for a list br_results = mechanize.urlopen(br_results) html = br_results.read() soup = BeautifulSoup(html) local_links = soup.findAll("a", {"class" : "down-arrow csa"}) upc_code = soup.findAll("ul", {"class" : "bc-meta3"}) for upc in upc_code: upc_text = upc.contents.contents print upc_text

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Accented characters in matplotlib

    - by OldJim
    Does anyone know a way to get matplotlib to render accented chars (é,ã,â,etc)? For instance i'm trying to use accented chars on set_yticklabels() and matplot renders squares instead, and when i use unicode() it renders the wrong chars. Is there a way to make this work? Thanks in advance, Jim.

    Read the article

  • mod_wsgi daemon mode vs threaded fastcgi

    - by t0ster
    Can someone explain the difference between apache mod_wsgi in daemon mode and django fastcgi in threaded mode. They both use threads for concurrency I think. Supposing that I'm using nginx as front end to apache mod_wsgi. UPDATE: I'm comparing django built in fastcgi(./manage.py method=threaded maxchildren=15) and mod_wsgi in 'daemon' mode(WSGIDaemonProcess example threads=15). They both use threads and acquire GIL, am I right?

    Read the article

  • Algorithm to match natural text in mail

    - by snøreven
    I need to separate natural, coherent text/sentences in emails from lists, signatures, greetings and so on before further processing. example: Hi tom, last monday we did bla bla, lore Lorem ipsum dolor sit amet, consectetur adipisici elit, sed eiusmod tempor incidunt ut labore et dolore magna aliqua. list item 2 list item 3 list item 3 Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquid x ea commodi consequat. Quis aute iure reprehenderit in voluptate velit regards, K. ---line-of-funny-characters-####### example inc. 33 evil street, london mobile: 00 234534/234345 Ideally the algorithm would match only the bold parts. Is there any recommended approach - or are there even existing algorithms for that problem? Should I try approximate regular expressions or more statistical stuff based on number of punctation marks, length and so on?

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • Performing non-blocking requests? - Django

    - by RadiantHex
    Hi folks, I have been playing with other frameworks, such as NodeJS, lately. I love the possibility to return a response, and still being able to do further operations. e.g. def view(request): do_something() return HttpResponse() do_more_stuff() #not possible!!! Maybe Django already offers a way to perform operations after returning a request, if that is the case that would be great. Help would be very much appreciated! =D

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • How do i add a new object with suds?

    - by Jerome
    I'm trying to use suds but have so far been unsuccessful at figuring this out. Hopefully it's something simple that i'm missing. Any help would be highly appreciated. This is supposed to be the raw soap message that i need to achieve: <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:api="http://api.service.apimember.soapservice.com/"> <soapenv:Header/> <soapenv:Body> <api:insertOrUpdateMemberByObj> <token>t67GFCygjhkjyUy8y9hkjhlkjhuii</token> <member> <dynContent> <entry> <key>FIRSTNAME</key> <value>hhhhbbbbb</value> </entry> </dynContent> <email>[email protected]</email> </member> </api:insertOrUpdateMemberByObj> </soapenv:Body> </soapenv:Envelope> So i use suds to create the member object: member = client.factory.create('member') produces: (apiMember){ attributes = (attributes){ entry[] = <empty> } } How exactly do i append an 'entry'? I try this: member.attributes.entry.append({'key':'FIRSTNAME','value':'test'}) and that produces this: (apiMember){ attributes = (attributes){ entry[] = { value = "test" key = "FIRSTNAME" }, } } However, what i actually need is: (apiMember){ attributes = (attributes){ entry[] = (entry) { value = "test" key = "FIRSTNAME" }, } } How do i achieve this?

    Read the article

  • Pygame, sounds don't play

    - by terabytest
    I'm trying to play sound files (.wav) with pygame but when I start it I never hear anything. This is the code: import pygame pygame.init() pygame.mixer.init() sounda= pygame.mixer.Sound("desert_rustle.wav") sounda.play() I also tried using channels but the result is the same

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >