Search Results

Search found 15224 results on 609 pages for 'parallel python'.

Page 392/609 | < Previous Page | 388 389 390 391 392 393 394 395 396 397 398 399  | Next Page >

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • Setting up repoze.who with make_redirecting_plugin

    - by Timmy
    my file is: [plugin:form] use = repoze.who.plugins.form:make_redirecting_plugin login_form_url = /account/signin login_handler_path = /account/login logout_handler_path = /account/logout [identifiers] plugins = form;browser auth_tkt i created a form on /account/signin, but it doesnt find the identity? what has to be on the form?

    Read the article

  • When to use \A in regex?

    - by S.Mark
    End of line anchor $ match even there is extra trailing \n in matched string, so we use \Z instead of $ For example ^\w+$ will match the string abcd\n but ^\w+\Z is not How about \A and when to use?

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • How to set a __str__ method for all ctype Structure classes?

    - by Reuben Thomas
    [Since asking this question, I've found: http://www.cs.unc.edu/~gb/blog/2007/02/11/ctypes-tricks/ which gives a good answer.] I just wrote a __str__ method for a ctype-generated Structure class 'foo' thus: def foo_to_str(self): s = [] for i in foo._fields_: s.append('{}: {}'.format(i[0], foo.\_\_getattribute__(self, i[0]))) return '\n'.join(s) foo.\_\_str__ = foo_to_str But this is a fairly natural way to produce a __str__ method for any Structure class. How can I add this method directly to the Structure class, so that all Structure classes generated by ctypes get it? (I am using the h2xml and xml2py scripts to auto-generate ctypes code, and this offers no obvious way to change the names of the classes output, so simply subclassing Structure, Union &c. and adding my __str__ method there would involve post-processing the output of xml2py.)

    Read the article

  • SQLAlchemy: who is in charge of the "session"? ( and how to unit-test with sessions )

    - by Nick Perkins
    I need some guidance on how to use session objects with SQLAlchemy, and how to organize Unit Tests of my mapped objects. What I would like to able to do is something like this: thing = BigThing() # mapped object child = thing.new_child() # create and return a related object thing.save() # will also save the child object In order to achieve this, I was thinking of having the BigThing actually add itself ( and it's children ) to the database -- but maybe this not a good idea? One reason to add objects as soon as possible is Automatic id values that are assigned by the database -- the sooner they are available, the fewer problems there are ( right? ) What is the best way to manage session objects? Who is in charge of the session? Should it be created only when required? or saved for a long time? What about Unit Tests for my mapped objects?...how should the session be handled? Is it ever OK to have mapped objects just automatically add themselves to a database? or is that going to lead to trouble?

    Read the article

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Union on ValuesQuerySet in django

    - by Wuxab
    I've been searching for a way to take the union of querysets in django. From what I read you can use query1 | query2 to take the union... This doesn't seem to work when using values() though. I'd skip using values until after taking the union but I need to use annotate to take the sum of a field and filter on it and since there's no way to do "group by" I have to use values(). The other suggestions I read were to use Q objects but I can't think of a way that would work. Do I pretty much need to just use straight SQL or is there a django way of doing this? What I want is: q1 = mymodel.objects.filter(date__lt = '2010-06-11').values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) q2 = mymodel.objects.values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) query = q1|q2 But this doesn't work and as far as I know I need the "values" part because there's no other way for Sum to know how to act since it's a 15 column table.

    Read the article

  • How to convert string "0671" or "0x45" into integer form with 0 and 0x in the beginning.

    - by Harshit Sharma
    I wanted to make my own encryption algorithm and decryption algorithm , encryption algorithm works fine and converts ascii value of the characters into alternate hexadecimal and octal representations. But when I tried decryption, problem occured as it return int('0671') = 671, as 0671 is string type in the following code. Is there a method to convert "ox56" into integer form?????? NOTE: Following string is alternate octal and hexa of ascii value of char. ///////////////DECRYPTION/////// l="01630x7401620x6901560x67" f=len(l) k=0 d=0 x=[] for i in range(0,f,4): g=l[i:i+4] print g k=k+1 if(k%2==0): p=g print p else: p=int(g) print p

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • SQLAlchemy: a better way for update with declarative?

    - by hadrien
    I am a SQLAlchemy noob. Let's say I have an user table in declarative mode: class User(Base): __tablename__ = 'user' id = Column(u'id', Integer(), primary_key=True) name = Column(u'name', String(50)) When I know user's id without object loaded into session, I update such user like this: ex = update(User.__table__).where(User.id==123).values(name=u"Bob Marley") Session.execute(ex) I dislike using User.__table__, should I stop worrying with that? Is there a better way to do this? Thanx!

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • sqlite3 'database is locked' won't go away with retries

    - by Azarias
    I have a sqlite3 database that is accessed by a few threads (3-4). I am aware of the general limitations of sqlite3 with regards to concurrency as stated http://www.sqlite.org/faq.html#q6 , but I am convinced that is not the problem. All of the threads both read and write from this database. Whenever I do a write, I have the following construct: try: Cursor.execute(q, params) Connection.commit() except sqlite3.IntegrityError: Notify except sqlite3.OperationalError: print sys.exc_info() print("DATABASE LOCKED; sleeping for 3 seconds and trying again") time.sleep(3) Retry On some runs, I won't even hit this block, but when I do, it never comes out of it (keeps retrying, but I keep getting the 'database is locked' error from exc_info. If I understand the reader/writer lock usage correctly, some amount of waiting should help with the contention. What this sounds like is deadlock, but I do not use any transactions in my code, and every SELECT or INSERT is simply a one off. Some threads, however, keep the same connection when they do their operation (which includes a mix of SELECTS and INSERTS and other modifiers). I would appericiate it if you could shade a light on this, and also ways around fixing it (besides using a different database engine.)

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

< Previous Page | 388 389 390 391 392 393 394 395 396 397 398 399  | Next Page >